A siRNA reagent, composition and application for inhibiting human PPP1R3B gene expression

Abstract

This invention provides an siRNA reagent, composition, and application for inhibiting human PPP1R3B gene expression, belonging to the field of biomedical technology. The siRNA reagent for inhibiting human PPP1R3B gene expression in this invention includes siRNA and a delivery system; the siRNA is a double-stranded RNA molecule composed of one sense strand and one antisense strand, and the delivery system is a lipid nanoparticle delivery system or a GalNAc delivery system. This invention, by designing siRNA sequences based on the human PPP1R3B gene and by chemically modifying the siRNA sequence and optimizing the delivery system, solves the problems of off-target effects, low delivery efficiency, and poor in vivo stability in existing technologies, achieving comprehensive protection of this target.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and in particular relates to an siRNA reagent, composition and application for inhibiting human PPP1R3B gene expression. Background Technology

[0002] Human protein phosphatase 1 regulatory subunit 3B (PPP1R3B) is a key regulator of glycogen metabolism, primarily highly expressed in the liver. Its abnormal expression is closely associated with type 2 diabetes, non-alcoholic fatty liver disease (NAFLD), and tumorigenesis. Studies have shown that inhibiting PPP1R3B expression can improve insulin resistance and reduce hepatic lipid deposition. Current technologies often use small molecule inhibitors or gene editing to inhibit PPP1R3B expression; however, small molecule inhibitors have poor specificity and are prone to off-target effects, while gene editing carries irreversible and safety risks. siRNA technology, by targeting and silencing disease-causing genes, has made significant progress in disease treatment. Currently, the FDA has approved drugs such as Patisiran (for hereditary transthyretin amyloidosis) and Inclisiran (for lowering cholesterol), confirming their clinical feasibility. However, systematic reports on siRNA sequence design targeting PPP1R3B have not yet been found. Summary of the Invention

[0003] In view of this, the purpose of the present invention is to provide an siRNA reagent, composition and application for inhibiting human PPP1R3B gene expression. The present invention designs siRNA sequences for human PPP1R3B gene and optimizes them through chemical modification and delivery system, thereby solving the problems of off-target effects, low delivery efficiency and poor in vivo stability in the prior art, and achieving comprehensive protection of the target.

[0004] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0005] This invention provides an siRNA reagent for inhibiting the expression of the human PPP1R3B gene, comprising siRNA and a delivery system;

[0006] The siRNA is a double-stranded RNA molecule consisting of one sense strand and one antisense strand.

[0007] The siRNA includes siRNA-1, siRNA-2, siRNA-3, siRNA-4, or siRNA-5;

[0008] The antisense strand of siRNA-1 is shown in SEQ ID NO.1, and the sense strand of siRNA-1 is shown in SEQ ID NO.2;

[0009] The antisense strand of siRNA-2 is shown in SEQ ID NO.3, and the sense strand of siRNA-2 is shown in SEQ ID NO.4;

[0010] The antisense strand of siRNA-3 is shown in SEQ ID NO.5, and the sense strand of siRNA-3 is shown in SEQ ID NO.6;

[0011] The antisense strand of siRNA-4 is shown in SEQ ID NO.7, and the sense strand of siRNA-4 is shown in SEQ ID NO.8;

[0012] The antisense strand of siRNA-5 is shown in SEQ ID NO.9, and the sense strand of siRNA-5 is shown in SEQ ID NO.10;

[0013] The delivery system is a lipid nanoparticle delivery system or a GalNAc delivery system.

[0014] Preferably, any one of the sense or antisense strands in the siRNA is chemically modified; the chemical modification includes fluorination modification at positions 8, 10, and 15 of the sense strand and positions 4, 5, 6, 9, 13, 16, and 17 of the antisense strand, in the direction from the 5' end to the 3' end.

[0015] Each of the remaining nucleotides was modified with a methoxy group;

[0016] In the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 2 and 3 of the sense strand are linked by thiophosphate groups, and the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 of the antisense strand are linked by thiophosphate groups.

[0017] Preferably, the 3' end of the siRNA also contains two dTdT dT dT dT bases.

[0018] This invention provides a method for preparing the siRNA reagent, comprising the following steps:

[0019] (1) Mix DLin-MC3-DMA, DSPC, cholesterol, and DMG-PEG2000 in a molar ratio of 40-60:5-15:35-40:1-2 to obtain a mixture;

[0020] (2) Dissolve the mixture in an organic solvent to obtain a delivery system solution;

[0021] (3) Dissolve the siRNA in citrate buffer solution to obtain the siRNA solution;

[0022] (4) Mix the delivery system solution with the siRNA solution, encapsulate them, and after removing the organic solvent, obtain siRNA nucleic acid lipid nanoparticles, which are the siRNA reagent.

[0023] Preferably, the concentration of the mixture in the delivery system solution is 15–20 mmol / L, and the concentration of the siRNA solution is 300–350 μg / mL.

[0024] Preferably, the volume ratio of the delivery system solution to the siRNA solution is 1:2 to 4.

[0025] The present invention also provides a pharmaceutical composition comprising the siRNA reagent for inhibiting human PPP1R3B gene expression or the siRNA reagent obtained according to the preparation method described above.

[0026] Preferably, the pharmaceutical composition further includes a pharmaceutically acceptable carrier.

[0027] The present invention also provides the use of the siRNA reagent or the siRNA reagent obtained according to the preparation method, and the pharmaceutical composition thereof, in the preparation of drugs for the prevention or treatment of PPP1R3B gene-mediated diseases.

[0028] Preferably, the diseases mediated by the PPP1R3B gene include type 2 diabetes, NAFLD, obesity, and liver cancer.

[0029] Compared with existing technologies, the present invention has the following beneficial effects: The present invention provides an siRNA reagent, composition, and application for inhibiting human PPP1R3B gene expression. By designing siRNA sequences for the human PPP1R3B gene and optimizing the delivery system through chemical modification of the siRNA sequences, the present invention solves the problems of off-target effects, low delivery efficiency, and poor in vivo stability in existing technologies, achieving comprehensive protection of this target. Using the siRNA sequence provided by the present invention, PPP1R3B gene expression can be significantly silenced, lipid droplet fusion can be inhibited, and lipolysis can be promoted. Attached Figure Description

[0030] Figure 1 This is a diagram showing the average particle size distribution of liposome nanoparticles.

[0031] Figure 2 Figure showing the validation results of the silencing effect of siRNA-1 to siRNA-5 on the PPP1R3B gene;

[0032] Figure 3 This is a photograph taken by laser confocal microscopy after staining HepG2 without oleic acid-induced lipid droplets.

[0033] Figure 4 Intracellular lipid droplets in HepG2 cells after oleic acid induction, and photographed using laser confocal microscopy after staining;

[0034] Figure 5 To illustrate the transfection of siRNA-2 into oleic acid-induced HepG2 cells, and to illustrate the results of laser confocal microscopy after staining.

[0035] Figure 6 To illustrate the transfection of siRNA-3 into oleic acid-induced HepG2 cells, and to illustrate the results of laser confocal microscopy after staining.

[0036] Figure 7 To transfect siRNA into oleic acid-induced HepG2 hepatocytes, nucleic acids were extracted from each group, reverse transcribed, and the expression level of the target gene PPP1R3B was amplified by real-time quantitative PCR. Detailed Implementation

[0037] This invention provides an siRNA reagent for inhibiting the expression of the human PPP1R3B gene, comprising siRNA and a delivery system;

[0038] The siRNA is a double-stranded RNA molecule consisting of one sense strand and one antisense strand.

[0039] The siRNA includes siRNA-1, siRNA-2, siRNA-3, siRNA-4, or siRNA-5;

[0040] The antisense strand of siRNA-1 is shown in SEQ ID NO.1, and the sense strand of siRNA-1 is shown in SEQ ID NO.2, as detailed below:

[0041] SEQ ID NO.1: UAGAUGAACAGGCUUUUGGGC;

[0042] SEQ ID NO.2: CCAAAAGCCUGUUCCAUCUAGC;

[0043] The antisense strand of siRNA-2 is shown in SEQ ID NO.3, and the sense strand of siRNA-2 is shown in SEQ ID NO.4, as detailed below:

[0044] SEQ ID NO.3: ACACUUUGACCAUUGUCAGGG;

[0045] SEQ ID NO.4: CUGACAAUGGUCAAAGUGUUC;

[0046] The antisense strand of siRNA-3 is shown in SEQ ID NO.5, and the sense strand of siRNA-3 is shown in SEQ ID NO.6, as detailed below:

[0047] SEQ ID NO.5: UGUUGAAUGGCAUAUCUAGCG;

[0048] SEQ ID NO.6: CUAGAUAUGCCAUUCAACAUC;

[0049] The antisense strand of siRNA-4 is shown in SEQ ID NO.7, and the sense strand of siRNA-4 is shown in SEQ ID NO.8, as detailed below:

[0050] SEQ ID NO.7: UAAAGUCUAAGUAAUCUGCAG;

[0051] SEQ ID NO.8: GCAGAUUACUUAGACUUUAGA;

[0052] The antisense strand of siRNA-5 is shown in SEQ ID NO.9, and the sense strand of siRNA-5 is shown in SEQ ID NO.10, as detailed below:

[0053] SEQ ID NO.9: UCUUUCAUAAGACUGAAUCUU;

[0054] SEQ ID NO.10: GAUUCAGUCUUAUGAAAGAAU;

[0055] The delivery system is a lipid nanoparticle delivery system or a GalNAc delivery system.

[0056] In this invention, any one of the sense or antisense strands of the siRNA is chemically modified; the chemical modification includes: fluorination at positions 8, 10, and 15 of the sense strand and positions 4, 5, 6, 9, 13, 16, and 17 of the antisense strand, in the direction from the 5' end to the 3' end; methoxylation on each of the remaining nucleotides; and the nucleotides at positions 1 and 2, and positions 2 and 3 of the sense strand linked by thiophosphate groups in the direction from the 5' end to the 3' end, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 of the antisense strand linked by thiophosphate groups.

[0057] In this invention, when using a GalNAc delivery system, the chemical modification further includes conjugating a GalNAc conjugate at the 3' or 5' end of the oligonucleotide.

[0058] In this invention, the 3' end of the siRNA also contains two dTdT ...

[0059] This invention provides a method for preparing the siRNA reagent, comprising the following steps:

[0060] (1) Mix DLin-MC3-DMA, DSPC, cholesterol, and DMG-PEG2000 in a molar ratio of 40-60:5-15:35-40:1-2 to obtain a mixture;

[0061] (2) Dissolve the mixture in an organic solvent to obtain a delivery system solution;

[0062] (3) Dissolve the siRNA in citrate buffer solution to obtain the siRNA solution;

[0063] (4) Mix the delivery system solution with the siRNA solution, encapsulate them, and after removing the organic solvent, obtain siRNA nucleic acid lipid nanoparticles, which are the siRNA reagent.

[0064] In this invention, DLin-MC3-DMA, DSPC, cholesterol, and DMG-PEG2000 are mixed in a molar ratio of 40-60:5-15:35-40:1-2 to obtain a mixture; the preferred molar ratio of DLin-MC3-DMA, DSPC, cholesterol, and DMG-PEG2000 is 45-55:7-12:36-39:1.3-1.8, and more preferably 50:10:38.5:1.5.

[0065] In this invention, the mixture is dissolved in an organic solvent to obtain a delivery system solution; the mixture is dissolved in anhydrous ethanol to prepare a solution with a concentration of 15-20 mmol / L, wherein the concentration of the solution is preferably 17-19 mmol / L, more preferably 18 mmol / L.

[0066] In this invention, siRNA is dissolved in a citrate buffer solution to obtain an siRNA solution; the modified siRNA is then dissolved in a 0.05–0.2 mol / L citrate buffer solution to prepare an siRNA solution with a concentration of 300–350 μg / mL. The concentration of the citrate buffer solution is preferably 0.07–0.15 mol / L, more preferably 0.1 mol / L, and the concentration of the siRNA solution is preferably 320–340 μg / mL, more preferably 330 μg / mL.

[0067] In this invention, the delivery system solution and siRNA solution are mixed and encapsulated. After removing the organic solvent, siRNA nucleic acid lipid nanoparticles are obtained, which are the siRNA reagent. The delivery system solution and siRNA solution are injected into the two inlet channels of a microfluidic preparation system at a volume ratio of 1:2 to 4. Through rapid mixing of the two solutions, the nucleic acid lipid nanoparticles LNP-siRNA are encapsulated. After removing the organic solvent, siRNA nucleic acid lipid nanoparticles are obtained. The volume ratio is preferably 1:2.5 to 3.5, and more preferably 1:3. The encapsulated nucleic acid lipid nanoparticles LNP-siRNA are dialyzed in ddH2O using a dialysis bag to remove ethanol. The molecular weight cutoff of the dialysis bag is 3000D. The dialysis method is as follows: dialysis for 1 hour, change the dialysate and dialyze for another 1.5 hours, then change the dialysate again and dialyze overnight.

[0068] The present invention also provides a pharmaceutical composition comprising the siRNA reagent for inhibiting human PPP1R3B gene expression or the siRNA reagent obtained according to the preparation method described above.

[0069] In this invention, the pharmaceutical composition further includes a pharmaceutically acceptable carrier.

[0070] The present invention also provides the use of the siRNA reagent or the siRNA reagent obtained according to the preparation method, and the pharmaceutical composition thereof, in the preparation of drugs for the prevention or treatment of PPP1R3B gene-mediated diseases.

[0071] In this invention, the diseases mediated by the PPP1R3B gene include type 2 diabetes, NAFLD, obesity, and liver cancer.

[0072] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0073] Example 1: siRNA nucleic acid lipid nanoparticles

[0074] Based on the human PPP1R3B gene sequence (accession number: NM_024607.4) obtained from the Genebank database, five siRNA target sequences (SEQ ID NO:11~SEQ ID NO:15) were designed using siDirect siRNA design software. The sense strand sequence was identical to the target sequence designed on the target gene (U replaced T), and the antisense strand sequence was completely complementary to the target sequence (U replaced T), as shown in Table 1.

[0075] Table 1. Designed siRNA target sequences and their antisense and sense strand sequences.

[0076]

[0077] The siRNA sequence in Table 1 was chemically synthesized, and two dTdT dangling nucleotides were added to the 3' end to enhance its stability. Fluorination was performed at positions 8, 10, and 15 of the sense strand and positions 4, 5, 6, 9, 13, 16, and 17 of the antisense strand, following a 5'-to-3' direction. Each remaining nucleotide was methoxylated. The nucleotides at positions 1 and 2, and 2 and 3 of the sense strand were linked by phosphate thioester groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 of the antisense strand were also linked by phosphate thioester groups to enhance stability, resulting in the modified siRNA (commissioned by Sangon Biotech (Shanghai) Co., Ltd.).

[0078] DLin-MC3-DMA, DSPC, cholesterol, and DMG-PEG2000 were dissolved in anhydrous ethanol at a molar ratio of 50:10:38.5:1.5 to prepare a solution with a concentration of 18 mmol / L. Modified siRNA was dissolved in 0.1 mol / L citrate buffer at a concentration of 330 μg / mL. The two solutions were injected into the two inlet channels of a microfluidic preparation system at a ratio of 1:3. Rapid mixing of the two solutions encapsulated the nucleic acid lipid nanoparticles (LNP-siRNA). The prepared product was dialyzed in ddH2O using a dialysis bag (3000D). After 1 hour of dialysis, the dialysate was replaced for a second dialysis, followed by a third overnight dialysis after 1.5 hours to remove ethanol and obtain the siRNA nucleic acid lipid nanoparticles.

[0079] 100 μL of the prepared LNP-siRNA was diluted to 1 mL with ddH2O and placed in a Malvern Zetasizer Nano ZS90 nanoparticle size potential analyzer for particle size determination. The average particle size and distribution were obtained by five repeated measurements at 25 °C. Figure 1 As shown.

[0080] Depend on Figure 1 It can be seen that the particle size distribution of LNP-siRNA is between 90 and 250 nm, with an average particle size of 147.6 nm.

[0081] Example 2 In vitro inhibition efficiency

[0082] 1. qPCR validation of the PPP1R3B gene silencing effect

[0083] In HepG2 cells (purchased from Shanghai Enzyme Research Biotechnology Co., Ltd., catalog number: C2056-1A), the expression level of PPP1R3B mRNA was reduced by using the preferred siRNA-1 to siRNA-5.

[0084] Experimental group setup: siRNA-1 to siRNA-5 nucleic acid lipid nanoparticles (LNP-siRNA-1 to LNP-siRNA-5) prepared using the method in Example 1 were used as transfection reagents for cell transfection; Control group: uncoated siRNA-1 to siRNA-5 (naked siRNA) were used as transfection reagents for cell transfection; A blank control (no transfection reagents added) was also set up. Each group had 3 replicates.

[0085] Experimental method: Take a six-well plate and test it according to 2×10⁻⁶ mm. 5 Cells are cultured at a density of cells / well until cell confluence reaches 70% or higher.

[0086] Before transfection, the culture medium was changed, and 20 μL of transfection reagent was evenly added to each culture dish for transfection. The control group did not receive any transfection reagent. Six hours after transfection, the culture medium was aspirated, and the cells were washed twice with PBS. Then, the medium was replaced with DMEM containing 10% fetal bovine serum and 1% penicillin antibiotics, which had been preheated in a 37°C water bath. The cells were incubated at 37°C and 5% CO2 for 48 hours.

[0087] Total RNA was extracted from the above samples: The culture medium in the 6-well plate was aspirated using a pipette. Cells were washed once with 500 μL of 1×PBS buffer, and the PBS was discarded. 1 mL of TRIzol cell lysis buffer was added to each well. Cells were pipetted to ensure complete lysis. The lysis buffer was transferred to a 1.5 mL EP tube. 200 μL of chloroform was added to the mixture, vortexed for 30 s, incubated for 5 min, and centrifuged at 12,000 rpm for 10 min. The supernatant was retained. 1 mL of isopropanol was added to the supernatant, vortexed for 30 s, incubated for 5 min, and centrifuged at 12,000 rpm for 10 min. The supernatant was discarded. 1 mL of 75% ethanol was added to the precipitate, incubated for 5 min, and centrifuged at 12,000 rpm for 10 min. The supernatant was discarded. The RNA precipitate was dissolved in 50 μL of ddH2O. The RNA concentration was determined using NANODROP, and 500 ng of RNA was used for reverse transcription to convert the total RNA into single-stranded cDNA.

[0088] Total RNA was reverse transcribed into single-stranded cDNA using a reverse transcription kit (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.). After preparing the kit according to the instructions, the mixture was vortexed and placed in a PCR instrument. The reaction was carried out at 37°C for 15 min, followed by a reaction at 85°C for 5 s. After the reaction, the cDNA product was removed and stored at -20°C for later use.

[0089] For quantitative real-time PCR: The quantitative real-time reaction system was prepared by adding 10 μL of SYBR Green, 0.8 μL of the upstream primer, 0.8 μL of the downstream primer, and 0.1 μg of cDNA template. Finally, DEPC water was added to bring the volume to 20 μL. The primer sequences were (5'→3'): Primer F: GGCCCAAAAGCCTGTTCATCTA (SEQ ID NO:16), Primer R: AAGTTCCCACGTTGCTCCTCC (SEQ ID NO:17).

[0090] After preparing the above system in eight-tube strips, centrifuge the strips and place them in a real-time PCR instrument. The reaction program is as follows: Stage 1: 95℃ for 30s; Stage 2 (40 cycles): 95℃ for 5s, 60℃ for 30s, 95℃ for 15s; Stage 3: 60℃ for 1min, 95℃ for 15s. After the reaction, use 2... -△△Ct The method calculates expression levels from raw CT values, processes the results using a normalization method, and then plots them using Graphpad software. The results are shown below. Figure 2 As shown.

[0091] Depend on Figure 2 It is known that when using the siRNA provided by this invention to silence the PPP1R3B gene in HepG2 cells, the unwrapped siRNA-1 to siRNA-5 (naked siRNA) did not have a good silencing effect on the PPP1R3B gene. However, after being wrapped with LNP provided by this application, the silencing effect on the PPP1R3B gene was better than that of the control group, and siRNA-3 had the best silencing effect on the PPP1R3B gene.

[0092] 2. In vitro pharmacodynamics

[0093] 2.1 Observation of lipid droplets by imaging

[0094] Oleic acid (OA), as a monounsaturated fatty acid, can induce lipid droplet accumulation in hepatocytes by promoting the synthesis of neutral lipids (such as triglycerides, TAG) and inhibiting fatty acid oxidation, thus mimicking the pathological features of obesity and non-alcoholic fatty liver disease (NAFLD).

[0095] siRNA-2 and siRNA-3 were preferred for the experiments. The cells were divided into the following groups: Blank group (no oleic acid induction), siRNA-2 group (oleic acid induction followed by siRNA-2), siRNA-3 group (oleic acid induction followed by siRNA-3), and Control group (oleic acid induction without siRNA).

[0096] Experimental methods:

[0097] (1) Induction of intracellular lipid droplet formation in HepG2 cells using oleic acid: Oleic acid was combined with bovine serum albumin (BSA) at a molar ratio of 1:6. The resulting oleic acid-BSA complex was dissolved in serum-free medium to prepare a final concentration of 500 μmol / L. Cell seeding density (5 × 10⁻⁶ cells / year) 4 ~1×10 5 / mL), treated with oleic acid for 24h (37℃, 5% CO2);

[0098] (2) Using the delivery system described in this invention, siRNA is delivered into oleic acid-induced HepG2 cells;

[0099] (3) After 48 hours of culture, the lipid droplets were stained with BODIPY 505 / 515 dye, and their size and morphology were observed by laser confocal microscopy. The results are shown in […]. Figures 3-6 .

[0100] Depend on Figures 3-6 Staining results showed that the Blank group had very few lipid droplets and low fluorescence intensity. Compared with the Blank group, the Control group, after oleic acid induction, exhibited typical round and strong fluorescence lipid droplets in HepG2 cells, and confocal images showed a densely distributed lipid droplet structure, indicating that 500 μmol / L oleic acid treatment for 24 h successfully simulated the pathological features of obesity and non-alcoholic fatty liver disease (NAFLD). Both siRNA-2 and siRNA-3 groups significantly reduced lipid droplet accumulation, with siRNA-3 showing better inhibitory effects. The lipid droplet volume was reduced and the distribution was more dispersed in the siRNA-treated groups, demonstrating that the interference target gene PPP1R3B may exert its effects by inhibiting lipid droplet fusion or promoting lipolysis. Targeting PPP1R3B reveals its key role in the dynamic regulation of lipid droplets for the first time, possessing potential for clinical application.

[0101] 2.2 qPCR verification of changes in PPP1R3B expression levels

[0102] After laser confocal microscopy imaging, nucleic acid was extracted from the experimental cells. The extracted RNA was reverse transcribed into cDNA using a reverse transcription kit purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., and the expression level of the target gene was verified using TAKARA's SYBRGREEN real-time PCR. The results are as follows: Figure 7 As shown.

[0103] Depend on Figure 7 It was found that the expression level of the PPP1R3B gene in the HepG2 group induced by oleic acid without the addition of siRNA was higher than that in the Blank group; the expression level of the PPP1R3B gene in the HepG2 group induced by oleic acid with the addition of siRNA-2 and siRNA-3 was lower than that in the Blank group, and the siRNA-3 group had the highest silencing efficiency for the PPP1R3B gene. Combined with the results of laser confocal imaging, it was demonstrated that after silencing the PPP1R3B gene in HepG2 cells with siRNA-2 and siRNA-3, the formation of lipid droplets in HepG2 cells was reduced.

[0104] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An siRNA agent that inhibits the expression of a human PPP1R3B gene, characterized in that, comprising siRNA and a delivery system; the siRNA is a double-stranded RNA molecule consisting of a sense strand and an antisense strand; the siRNA is siRNA-1, siRNA-2, siRNA-3, siRNA-4 or siRNA-5; the antisense strand of the siRNA-1 is shown as SEQ ID NO. 1, and the sense strand of the siRNA-1 is shown as SEQ ID NO. 2; the antisense strand of the siRNA-2 is shown as SEQ ID NO. 3, and the sense strand of the siRNA-2 is shown as SEQ ID NO. 4; the antisense strand of the siRNA-3 is shown as SEQ ID NO. 5, and the sense strand of the siRNA-3 is shown as SEQ ID NO. 6; the antisense strand of the siRNA-4 is shown as SEQ ID NO. 7, and the sense strand of the siRNA-4 is shown as SEQ ID NO. 8; the antisense strand of the siRNA-5 is shown as SEQ ID NO. 9, and the sense strand of the siRNA-5 is shown as SEQ ID NO. 10; the delivery system is a lipid nanoparticle delivery system.

2. The siRNA agent of claim 1, which inhibits human PPP1R3B gene expression, characterized in that, any one of the sense strand or the antisense strand in the siRNA is chemically modified; the chemical modification comprises: in the direction from the 5' end to the 3' end, the 8th, 10th and 15th positions of the sense strand, and the 4th, 5th, 6th, 9th, 13th, 16th and 17th positions of the antisense strand are fluorinated; each remaining nucleotide is methoxylated; in the direction from the 5' end to the 3' end, the nucleotides at the 1st and 2nd positions, and the 2nd and 3rd positions of the sense strand are connected by a phosphorothioate group, and the nucleotides at the 1st and 2nd positions, the 2nd and 3rd positions, the 19th and 20th positions, and the 20th and 21st positions of the antisense strand are connected by a phosphorothioate group.

3. The siRNA agent of claim 1, which inhibits human PPP1R3B gene expression, characterized in that, the 3' end of the siRNA further contains two overhanging bases, and the overhanging bases are dTdT.

4. The method for preparing the siRNA reagent according to any one of claims 1 to 3, characterized in that, comprising the following steps: (1) mixing DLin-MC3-DMA, DSPC, cholesterol and DMG-PEG2000 in a molar ratio of (40-60):(5-15):(35-40):(1-2) to obtain a mixture; (2) dissolving the mixture in an organic solvent to obtain a delivery system solution; (3) dissolving siRNA in a citrate buffer solution to obtain an siRNA solution; (4) mixing and wrapping the delivery system solution and the siRNA solution, and removing the organic solvent to obtain an siRNA nucleic acid lipid nanoparticle, which is an siRNA reagent.

5. The preparation method according to claim 4, characterized in that, The concentration of the mixture in the delivery system solution is 15-20 mmol / L, and the concentration of the siRNA solution is 300-350 μg / mL.

6. The preparation method according to claim 4, characterized in that, The volume ratio of the delivery system solution to the siRNA solution is 1:(2-4).

7. A pharmaceutical composition, characterized by, The pharmaceutical composition comprises the siRNA agent of any one of claims 1 to 3 for inhibiting the expression of a human PPP1R3B gene or the siRNA agent obtained by the method of any one of claims 4 to 6.

8. The pharmaceutical composition of claim 7, wherein, The pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

9. Use of the siRNA agent according to any one of claims 1 to 3 or the siRNA agent obtained by the method according to any one of claims 4 to 6, the pharmaceutical composition according to claim 7 or 8 for the manufacture of a medicament for the prevention or treatment of a genetic mediated disease, characterized in that, PPP1R3B the genetic mediated disease is a disease caused by a mutation in a gene selected from the group consisting of the genes listed in Table 1. The PPP1R3B PPP1R3B Gene-mediated diseases are non-alcoholic fatty liver, obesity; The siRNA agent is siRNA-2, siRNA-3. The siRNA agent is siRNA-2, siRNA-3.

Images