Composition and application thereof in caries prevention
Through the complexing of fluoride and polypeptide, the problems of limited anti-caries and drug resistance of fluoride are solved, and the effect of effectively preventing caries and regulating oral microecology at low concentrations is achieved, and the health risks and bacterial resistance of high concentrations of fluoride are avoided.
Patent Information
- Application Number
- CN202510440264.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-09
- Publication Date
- 2025-07-04
AI Technical Summary
Fluoride in existing toothpastes has limited anti-caries effect and is prone to long-term use to lead to drug resistance of mutated streptococci, and high concentrations of fluoride may cause health problems. The use of broad-spectrum antibacterial agents may also lead to bacterial resistance.
The polypeptide with amino acid sequence as shown in SEQ ID NO:1 is combined with fluoride, with a concentration range of 1.79-7.14 mM and 1.56-12.5 μM. The advantage of the polypeptide's resistance is not easy to produce drug resistance is enhanced to enhance the inhibitory effect of fluoride on mutant Streptococcus.
It significantly enhances the anti-caries effect of fluoride at lower concentrations, reduces the risk of drug resistance of mutated streptococci, and regulates the oral microecological balance without damaging oral probiotics.
Smart Images

Figure CN120241952A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biomedicine. More specifically, it relates to a composition and its application in preventing dental caries. Background Art
[0002] Dental caries, commonly known as tooth decay or cavities, is an oral disease mainly caused by the activities of bacteria such as Streptococcus mutans. It has a high incidence rate and a wide distribution range. If not treated in time, it will not only cause tooth defects, but may also develop into pulpitis, periapical periodontitis, and even eventually lead to tooth loss.
[0003] Fluoride, due to its advantages such as enhancing the acid resistance of teeth and protecting teeth from acid erosion and dental caries, is often added to toothpaste for preventing and treating dental caries. However, the effect of fluoride in inhibiting Streptococcus mutans is limited, and usually a relatively high concentration (F - concentration reaching above 14.28 mM) is required to achieve the expected effect. But high concentrations of fluoride may induce health problems such as dental fluorosis (appearance of chalky or brown patches on the tooth surface) and skeletal fluorosis (a chronic disease caused by long-term excessive intake of fluoride in bones), and long-term use of fluoride-containing toothpaste may also cause bacteria such as Streptococcus mutans in the oral cavity to gradually develop fluoride resistance, thereby reducing the anti-caries effect of fluoride.
[0004] Currently, to overcome the above problems, toothpaste on the market usually uses broad-spectrum antibacterial agents (such as chlorhexidine, triclosan, silver ions, etc.) in combination with fluoride to enhance its anti-caries effect, and thus reduce the use concentration of fluoride. However, the long-term application of these broad-spectrum antibacterial agents may cause bacteria such as Streptococcus mutans to develop drug resistance. Summary of the Invention
[0005] Aiming at the deficiencies of the prior art, the present invention aims to provide a composition by combining a polypeptide with the amino acid sequence shown in SEQ ID NO:1 with fluoride. It not only takes advantage of the natural advantage that polypeptides are not prone to drug resistance, greatly reducing the risk of bacteria such as Streptococcus mutans developing drug resistance, but also can significantly enhance the inhibitory effect of fluoride on Streptococcus mutans, enabling fluoride to achieve better anti-caries effects at a lower concentration (F - concentration of 1.79 - 7.14 mM).
[0006] The first object of the present invention is to provide a composition.
[0007] The second object of the present invention is to provide the application of the above composition in the preparation of anti-caries products.
[0008] The third object of the present invention is to provide the application of the above composition in the preparation of products for inhibiting Streptococcus mutans.
[0009] The fourth object of the present invention is to provide the application of the above composition in the preparation of products for regulating the oral microecological balance.
[0010] The above object of the present invention is achieved by the following technical solutions:
[0011] The present invention provides a composition, which comprises a fluoride and a polypeptide; the concentration of F in the fluoride - is 1.79 - 7.14 mM in the composition; the concentration of the polypeptide is 1.56 - 12.5 μM in the composition, and the amino acid sequence of the polypeptide is as shown in SEQ ID NO:1.
[0012] The present invention uses the polypeptide with the amino acid sequence as shown in SEQ ID NO:1 for compounding with the fluoride. Not only does it utilize the natural advantage that the polypeptide is not prone to produce drug resistance, greatly reducing the risk of drug resistance in bacteria such as Streptococcus mutans, but it can also significantly enhance the inhibitory effect of the fluoride on Streptococcus mutans, enabling the fluoride to achieve a better anti-caries effect at a lower concentration (F - is 1.79 - 7.14 mM). In addition, the composition of the present invention will not have an adverse effect on oral probiotics, and thus is used to regulate the oral microecological balance. Therefore, the composition of the present invention is suitable for the preparation of products for anti-caries, inhibiting Streptococcus mutans and regulating the oral microecological balance.
[0013] Preferably, the concentrations of F - and the polypeptide are 1.79 - 7.14 mM and 12.5 μM respectively, or 3.57 - 7.14 mM and 6.25 μM respectively, or 7.14 mM and 3.13 μM respectively. At this concentration, the composition of the present invention can more effectively inhibit Streptococcus mutans, and thus play a better anti-caries role. More preferably, it is 3.57 - 7.14 mM and 12.5 μM, and most preferably it is 7.14 mM and 12.5 μM.
[0014] Preferably, the concentrations of F - and the polypeptide are 1.79 mM and 1.56 - 12.5 μM respectively. At this concentration, the fluoride and the polypeptide in the composition of the present invention can play a synergistic effect in regulating the oral microecological balance.
[0015] Particularly, when the concentrations of F - and the polypeptide are 7.14 mM and 1.56 - 6.25 μM respectively, or 3.57 mM and 3.13 - 12.5 μM respectively, or 1.79 mM and 12.5 μM respectively, or 1.79 mM and 1.56 - 3.13 μM respectively, the fluoride and the polypeptide in the composition of the present invention can play a synergistic effect in inhibiting Streptococcus mutans.
[0016] Preferably, the fluoride is one or more of sodium fluoride, stannous fluoride, sodium monofluorophosphate, and oraprime fluoride.
[0017] In addition, the present invention also provides a composition, which comprises a fluoride and an active peptide; the concentration of F in the fluoride - in the composition is 1.79 - 7.14 mM; the concentration of the active peptide in the composition is 1.56 - 12.5 μM, and the active peptide has a homology of more than 85% with the polypeptide shown in the amino acid sequence of SEQ ID NO:1.
[0018] The present invention uses the polypeptide shown in the amino acid sequence of SEQ ID NO:1 for compounding with the fluoride. Not only does it utilize the natural advantage that polypeptides are not prone to generating drug resistance, greatly reducing the risk of bacteria such as Streptococcus mutans generating drug resistance, but it can also significantly enhance the inhibitory effect of the fluoride on Streptococcus mutans, enabling the fluoride to achieve a better caries prevention effect at a lower concentration (F - is 1.79 - 7.14 mM). In addition, the composition of the present invention will not have an adverse effect on oral probiotics, and thus is used to regulate the oral microecological balance. Therefore, the applications of the above composition in preparing caries prevention products, products for inhibiting Streptococcus mutans, or products for regulating the oral microecological balance should all be within the protection scope of the present invention.
[0019] Optionally, the product is a drug or an oral care product.
[0020] Further, the preparation of the drug is one of oral liquid, spirit, tincture, aerosol, powder for inhalation, injection, sterile powder for injection, suppository. The types of the above preparations can be understood according to the relevant definitions in Pharmaceutics (Sixth Edition, People's Medical Publishing House, Cui Fude), and the preparation of the above preparations can be formulated according to the methods of the relevant preparations in Pharmaceutics (Sixth Edition, People's Medical Publishing House, Cui Fude).
[0021] Further, the drug also contains pharmaceutically acceptable excipients.
[0022] Furthermore, the excipients are one or more of solid lubricants (such as stearic acid and / or magnesium stearate, etc., used to reduce friction and ensure the success of pharmaceutical manufacturing), vegetable oils (such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and / or cocoa butter, etc., used as solvents or carriers to help pharmaceutical ingredients dissolve or disperse better), polyols (such as propylene glycol, glycerol, sorbitol, mannitol and / or polyethylene glycol, etc., used to improve the stability of pharmaceuticals, prevent water loss or deterioration of pharmaceuticals during storage, and also used to improve the taste and solubility of pharmaceuticals), alginic acid (maintaining the physical stability of pharmaceuticals, preventing sedimentation or aggregation of pharmaceutical particles), emulsifiers (such as Tween and / or polyoxyethylene castor oil, etc., used to reduce the interfacial tension, promote the emulsification of the dispersed phase and maintain the stability of the emulsion), wetting agents (such as sodium lauryl sulfate, etc., used to help pharmaceutical ingredients disperse and dissolve better), colorants (used to improve the appearance color of pharmaceuticals, making them easier to identify and distinguish), flavoring agents (used to improve the taste of pharmaceuticals and enhance the medication compliance of patients), tabletting agents (facilitating the compression of loose granular substances into solid tablets, convenient for patients to take and carry, and also conducive to improving the stability and bioavailability of pharmaceuticals), stabilizers (increasing the physical stability of pharmaceuticals, preventing deterioration or degradation of pharmaceuticals during storage or transportation), antioxidants (used to prevent the deterioration of pharmaceuticals due to oxidation during storage or use, extending the shelf life of pharmaceuticals), isotonic saline solutions (used to adjust the osmotic pressure of pharmaceuticals to meet the physiological requirements of the human body, thereby reducing irritation and adverse reactions to the human body), phosphate buffer solutions (used to adjust the pH value of pharmaceuticals to meet the physiological requirements of the human body, thereby reducing irritation and adverse reactions to the human body), saccharides (such as lactose, glucose and / or sucrose, etc., used to help pharmaceutical ingredients disperse and dissolve better, and at the same time provide necessary energy support), starches (such as corn starch and / or potato starch, etc., used to help tablets disintegrate rapidly after administration and release pharmaceutical ingredients, thereby improving the bioavailability of pharmaceuticals), cellulose and its derivatives (such as sodium carboxymethyl cellulose, ethyl cellulose and / or methyl cellulose, etc., used to improve the compressibility and formability of pharmaceuticals, and also used to control the release rate of pharmaceuticals), binders (such as gelatin, etc., used to help pharmaceutical ingredients bind together better), lubricants (such as talc, etc., used to reduce the friction of pharmaceuticals). The types of the excipients can be selected according to the needs of improving the stability, activity and / or bioavailability of pharmaceuticals, etc.
[0023] Furthermore, the oral care products are one or more of oral lozenges, effervescent tablets for gargling, oral care liquids, toothpastes or mouthwashes.
[0024] Furthermore, the oral care products also contain excipients acceptable for oral care products.
[0025] Furthermore, the adjuvants are one or more of solvents (such as glycerol, propylene glycol, and / or ethanol, etc., which are used to dissolve raw materials for easy use and storage), flavors (such as mint flavor, etc., which are used to increase the aroma and taste of oral care products and enhance the sensory experience of users), preservatives (such as potassium sorbate, sodium benzoate, methylparaben, and / or propylparaben, etc., which are used to prevent the growth of microorganisms in oral care products and extend the shelf life of oral care products), bacteriostatic agents (such as cetylpyridinium chloride, chlorhexidine gluconate, and / or benzalkonium chloride, etc., which are used to inhibit or kill harmful microorganisms in the oral cavity and contribute to maintaining oral health), pH regulators (such as disodium hydrogen phosphate, sodium dihydrogen phosphate, and / or sodium citrate, etc., which are used to adjust the pH value of oral care products to meet the physiological requirements of the oral environment and reduce the irritation to oral tissues), thickeners (such as poloxamer 407, etc., which are used to increase the viscosity of oral care products, improve the use experience, and also used to improve the stability of oral care products, making them not easy to layer or precipitate), sweeteners (such as sucralose, sodium saccharin, sorbitol, xylitol, and / or maltitol, etc., which are used to increase the sweetness of oral care products and enhance the sensory experience of users), coolants (such as menthol and its derivatives, etc., which are used to increase the cool feeling of oral care products and enhance the sensory experience of users), and surfactants (such as sodium lauryl sulfate and / or sodium lauroyl sarcosinate, etc., which are used to reduce the surface tension of oral care products and enhance the cleaning effect). The types of these adjuvants can be selected according to the needs of improving the stability, safety, effectiveness of oral care products or improving the use experience, etc.
[0026] Preferably, the regulation of oral microecological balance is to inhibit the growth of harmful oral bacteria and promote and / or not inhibit the growth of oral probiotics.
[0027] More preferably, the harmful oral bacteria are Streptococcus mutans.
[0028] More preferably, the oral probiotics are Streptococcus sanguinis and / or Streptococcus salivarius.
[0029] The present invention has the following beneficial effects:
[0030] The present invention uses a polypeptide with the amino acid sequence shown in SEQ ID NO:1 for compounding with fluoride. Not only does it utilize the natural advantage that polypeptides are not prone to generating drug resistance, greatly reducing the risk of drug resistance in bacteria such as Streptococcus mutans, but also it can significantly enhance the inhibitory effect of fluoride on Streptococcus mutans, enabling fluoride to achieve a better anti-caries effect at a lower concentration (F - is 1.79 - 7.14 mM). In addition, the composition of the present invention will not have an adverse effect on oral probiotics, and thus is used to regulate the oral microecological balance. Therefore, the composition of the present invention is suitable for preparing products for anti-caries, inhibiting Streptococcus mutans, and regulating the oral microecological balance. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 The ratio of the number of probiotics (Streptococcus sanguinis, Streptococcus salivarius) to the number of harmful bacteria (Streptococcus mutans) in the mixed flora. Figure 1 In it, "P" represents polypeptide; "F" represents fluoride. Specific implementation manners
[0032] The present invention will be further described below in conjunction with the accompanying drawings of the specification and specific embodiments, but the embodiments do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the technical field.
[0033] Unless otherwise specified, the reagents and materials used in the following embodiments are all commercially available.
[0034] Example 1 Synthesis of polypeptide
[0035] The polypeptide (amino acid sequence shown in SEQ ID NO:1: GLDWWQL) was synthesized by entrusting Sangon Biotech Co., Ltd.
[0036] Example 2 The composition has an anti-caries effect
[0037] Streptococcus mutans (No. ATCC 700610, purchased from American Type Culture Collection ATCC) was resuscitated and cultured using BHI medium, and the Streptococcus mutans in the logarithmic phase was collected. After washing with PBS, it was resuspended with CDM medium. In a 96-well plate, Streptococcus mutans was inoculated into 200 μL of CDM medium at an initial concentration of 1×10 7 CFU / mL. Subsequently, polypeptides were added to the medium to make the final concentrations 1.56, 3.13, 6.25, 12.5 μM respectively, and sodium fluoride (NaF) was added to make the final concentrations 1.79, 3.57, 7.14 mM respectively (the experiment without adding polypeptides and fluorides was used as the blank group, the experiment with only adding fluorides was used as control group 1, and the experiment with only adding polypeptides was used as control group 2). Anaerobic culture was carried out at 37 °C and 5% CO2 for 24 h, and finally the OD value of the bacterial solution at 595 nm was detected by an enzyme-labeled instrument.
[0038] The results are shown in Table 1.
[0039] Table 1
[0040]
[0041] It can be seen that:
[0042] (1) Compared with the blank group (without polypeptides and fluorides), the experimental group (1.79 - 7.14 mM fluorides combined with 1.56 - 12.5 μM polypeptides) could effectively inhibit Streptococcus mutans, indicating that the composition of the present invention is suitable for preparing products for inhibiting Streptococcus mutans and preventing dental caries.
[0043] (2) Compared with control group 1 (1.79 - 7.14 mM fluorides alone) and control group 2 (1.56 - 12.5 μM polypeptides alone), the OD value of the experimental group (1.79 - 7.14 mM fluorides combined with 1.56 - 12.5 μM polypeptides) was significantly reduced, indicating that in the composition of the present invention, fluorides and polypeptides synergistically enhanced the inhibitory effect on Streptococcus mutans and are suitable for preparing products for inhibiting Streptococcus mutans and preventing dental caries.
[0044] The composition of Example 3 has the effect of regulating the balance of oral microecology.
[0045] Use BHI medium to resuscitate and culture Streptococcus mutans (number ATCC 700610, purchased from American Type Culture Collection ATCC), Streptococcus sanguinis (number ATCC 10556, purchased from American Type Culture Collection), and Streptococcus salivarius (number ATCC 27975, purchased from American Type Culture Collection) respectively. Collect the logarithmic-phase Streptococcus mutans, Streptococcus sanguinis, and Streptococcus salivarius, wash them with PBS, and resuspend them with CDM medium containing 1 wt% sucrose. In a 24-well plate, inoculate Streptococcus mutans, Streptococcus sanguinis, and Streptococcus salivarius at a density of 1×10 6Inoculate at an initial concentration of CFU / mL in CDM medium containing 1 wt% sucrose. Subsequently, add sodium fluoride (NaF) to the medium to a final concentration of 1.79 mM, and add polypeptides to final concentrations of 1.56, 3.13, 6.25, and 12.5 μM respectively, as the experimental groups (using the experiment without polypeptides and fluoride as the blank group, the experiment with only fluoride as control group 1, and the experiment with only polypeptides as control group 2). Anaerobically culture at 37 °C and 5% CO2 for 24 h to form a Streptococcus mutans - Streptococcus sanguinis - Streptococcus salivarius three - strain biofilm. After the culture, remove the supernatant, wash three times with PBS, collect the Streptococcus mutans - Streptococcus sanguinis - Streptococcus salivarius three - strain biofilm, and extract genomic DNA. Use 16S rRNA specific primers (for Streptococcus mutans: forward primer SEQ ID NO:2: GCCTACAGCTCAGAGATGCTATTCT, reverse primer SEQ ID NO:3: GCCATACACCACTCATGAATTGA; for Streptococcus sanguinis: forward primer SEQ ID NO:4: CAAAATTGTTGCAAATCCAAAGG, reverse primer SEQ ID NO:5: GCTATCGCTCCCTGTCTTTGA; for Streptococcus salivarius: forward primer SEQ ID NO:6: CTGCTCTTGTGACAGCCCAT, reverse primer SEQ ID NO:7: ACGGGAAGCTGATCTTTCGTA) to amplify the DNA of Streptococcus mutans, Streptococcus sanguinis, and Streptococcus salivarius respectively, record the Ct values of each strain, and then calculate the proportion of the number of probiotics (Streptococcus sanguinis, Streptococcus salivarius) to harmful bacteria (Streptococcus mutans) in the mixed flora according to the Ct - CFU standard curve of each strain.
[0046] The results are as Figure 1 shown, and it can be seen that:
[0047] (1) Compared with the blank group (without polypeptides and fluoride), the experimental groups (1.79 mM fluoride compounded with 1.56 - 12.5 μM polypeptides) can effectively inhibit harmful bacteria and promote probiotics, indicating that the composition of the present invention can target and inhibit oral harmful bacteria (Streptococcus mutans) and promote oral probiotics (Streptococcus sanguinis, Streptococcus salivarius), thereby effectively regulating the oral micro - ecological balance.
[0048] (2) Compared with the blank group (without polypeptides and fluorides), control group 1 (1.79 mM fluoride alone) promoted harmful bacteria and inhibited probiotics, while control group 2 (1.56 - 12.5 μM polypeptides alone) inhibited harmful bacteria and promoted probiotics, and the effects of the two were exactly opposite. However, when 1.79 mM fluoride was compounded with 1.56 - 12.5 μM polypeptides in the experimental group, the effect of inhibiting harmful bacteria and promoting probiotics was further enhanced, and the effect was significantly better than that of polypeptides alone and even better than that of fluoride alone, indicating that the composition of the present invention played a synergistic effect in regulating the oral microecological balance.
[0049] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.
Claims
1. A composition, characterized in that, Containing fluoride and polypeptide; F in the fluoride - The concentration in the composition is 1.79 to 7.14 mM; the concentration of the polypeptide in the composition is 1.56 to 12.5 μM, and the amino acid sequence of the polypeptide is as shown in SEQ ID NO:
1.
2. The composition according to claim 1, wherein The fluoride is one or more of sodium fluoride, stannous fluoride, sodium monofluorophosphate, and oraprime fluoride.
3. A composition, characterized in that, Containing fluoride and active peptide; F in the fluoride - The concentration in the composition is 1.79 - 7.14 mM; the concentration of the active peptide in the composition is 1.56 - 12.5 μM, and the active peptide has a homology of more than 85% with the polypeptide having the amino acid sequence shown in SEQ ID NO:
1.
4. Use of the composition according to any one of claims 1 to 3 in the preparation of an anti-caries product.
5. Use of the composition according to any one of claims 1 to 3 in the preparation of a product for inhibiting Streptococcus mutans.
6. Use of the composition according to any one of claims 1 to 3 in the preparation of a product for regulating the oral microecological balance.
7. The application according to any one of claims 4 to 6, characterized in that The product is a drug or an oral care product.
8. The application according to claim 6, wherein The regulation of the oral microecological balance is to inhibit the growth of oral harmful bacteria and promote and / or not inhibit the growth of oral probiotics.
9. The application according to claim 8, wherein The oral harmful bacteria are Streptococcus mutans.
10. The application according to claim 8, wherein The oral probiotics are Streptococcus sanguinis and / or Streptococcus salivarius.
Citation Information
Cited By
Polypeptide and use thereof in preparation of streptococcus mutans inhibitor
WO2026170856A1