Construction method of stably transfected cell strain based on COS-7 cell LXR alpha reporter gene

Abstract

The invention relates to the technical field of biology, and particularly discloses a construction method of a stably transfected cell strain based on a COS-7 cell LXR alpha reporter gene. An in-vitro monkey-derived kidney cell COS-7 is used as a host cell, a lentivirus transfection LUC reporter gene vector and a human LXR alpha expression vector are used to construct a stably-transfected recombinant cell, and the recombinant cell can be used for evaluating the activation or inhibition effect of an exogenous compound on LXR alpha, and can be used for preparing a human LXR alpha expression vector. Therefore, the method has a good application prospect in the aspects of LXR alpha gene function research, target verification, drug screening, endocrine disrupter (EDCs) screening and the like. The method for carrying out LXR alpha effector in-vitro screening by using the recombinant cell has the advantages of simplicity in operation, short experimental period, high sensitivity, high accuracy, suitability for high-throughput screening and the like.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a stable transfection cell line of LXRα reporter gene based on COS-7 cells and a construction method thereof. Background Art

[0002] Liver X receptor α (LXRα) belongs to the lipid receptor subclass in the nuclear receptor superfamily and is a transcription factor that plays a key role in cholesterol metabolism, lipid homeostasis maintenance, and inflammatory response regulation. Its protein structure is similar to other members of the nuclear receptor family, and four functional domains, namely A / B, C, D, and E, are distributed in sequence from the amino terminus to the carboxyl terminus. Among them, the A / B domain participates in ligand-independent transcriptional activation, the C domain undertakes the function of DNA binding, and the E domain serves as the ligand-binding and dimerization interface. LXRα forms a heterodimer (LXRα / RXR) with retinoid X receptor (RXR), and binds to a specific DNA response element (such as LXRE) in the promoter region of the target gene, thereby realizing the regulation of downstream gene expression.

[0003] Currently, the research and development of in vitro screening methods for LXRα effectors are still in the initial stage, and it is urgent to develop more novel methods to accurately evaluate the regulatory effects of compounds on LXRα. In the prior art, the screening of LXRα effectors mainly adopts in vitro screening schemes. This scheme has prominent advantages such as high response sensitivity, fast detection speed, significant economic benefits, and suitability for high-throughput detection. Common in vitro screening methods for LXRα effectors include screening systems based on yeast cells and screening systems based on mammalian cells, which are mainly used to screen LXRα effectors and predict the possible effects on exposed organisms.

[0004] However, the LXR screening system constructed with yeast as the host cell has obvious limitations. On the one hand, it cannot fully simulate the transcriptional activation or inhibition effect of compounds on human LXRα; on the other hand, compared with mammalian cells, the number of passages of yeast cells is limited, and it is difficult to maintain cell viability, so it is not suitable for automated high-throughput screening. The LXR screening systems based on mammalian cells in the prior art mainly rely on the homo- or hetero-polymerization of LXR, and have problems of poor generality and insufficient stability, and it is difficult to meet the requirements of various aspects such as LXRα gene function research, target validation, drug screening, and screening of endocrine disrupting chemicals (EDCs).

[0005] In view of the pleiotropy of LXRα and the importance of related signal pathways in the prior art, it is urgent to develop an LXRα effector screening system with good stability, strong anti-interference ability and applicable to high-throughput screening. Such a screening system will become an important tool for carrying out LXRα gene function research, target validation, drug screening, and screening of endocrine disrupting chemicals (EDCs). Summary of the Invention

[0006] To solve the above problems, the present invention specifically provides a stable transfection cell line of LXRα reporter gene based on COS-7 cells and its construction method. Using the in vitro monkey kidney cells COS-7 as host cells, a stable transfection recombinant cell was constructed by lentiviral transfection of the Luc reporter gene vector and the human LXRα expression vector. The recombinant cell can be used to evaluate the activation or inhibition effect of exogenous compounds on LXRα, thus having good application prospects in aspects such as LXRα gene function research, target verification, drug screening, and EDCs screening. The method for carrying out in vitro screening of LXRα effectors using the recombinant cell has the advantages of simple operation, short experimental period, high sensitivity, high accuracy, and suitability for high-throughput screening. In addition, the recombinant cell constructed by the present invention using the double-vector system can more truly reflect the agonistic / antagonistic effect of the candidate substance on LXRα, providing a more accurate, efficient, and convenient model for drug screening for related diseases and screening of the endocrine disruption effect of compounds.

[0007] To solve the above technical problems, the technical means adopted in this application are as follows:

[0008] A stable transfection cell line of LXRα reporter gene based on COS-7 cells, in which an LXRα gene nucleic acid construct and an LXRα reporter gene nucleic acid construct are introduced into mammalian cells,

[0009] The LXRα reporter gene nucleic acid construct includes an LXRα binding element, a promoter, a reporter gene, and / or a first selection marker gene that are operably linked in sequence from 5' to 3'; wherein the sequence of the LXRα binding element is as shown in SEQ ID NO:1;

[0010] The LXRα gene nucleic acid construct includes an LXRα gene expression cassette and a second selection marker gene expression cassette;

[0011] The LXRα gene sequence is as shown in SEQ ID NO:2.

[0012] Further,

[0013] The mammalian cells are passaged cells;

[0014] At least some elements of the LXRα gene nucleic acid construct and the LXRα reporter gene nucleic acid construct are integrated into the cell chromosome;

[0015] The reporter gene includes a green fluorescent protein gene and a luciferase gene;

[0016] The first selection marker gene and the second selection marker gene are respectively selected from the blasticidin resistance gene and the puromycin resistance gene.

[0017] On the other hand, the present application also claims protection for the method for constructing a stable transfection cell line of LXRα reporter gene based on COS-7 cells as described above, including the following steps:

[0018] S1 Prepare an LXRα gene nucleic acid construct and an LXRα reporter gene nucleic acid construct;

[0019] S2 Introduce the LXRα gene nucleic acid construct and the LXRα reporter gene nucleic acid construct into cells and perform screening.

[0020] Further, the S1 includes:

[0021] (1) Construct an overexpression recombinant plasmid of the LXRα gene and a recombinant plasmid of the LXRα reporter gene;

[0022] (2) Package the overexpression recombinant plasmid of the LXRα gene to produce an overexpression recombinant lentivirus of the LXRα gene, and package the recombinant plasmid of the LXRα reporter gene to produce a recombinant lentivirus of the LXRα reporter gene.

[0023] Further, in step (2) of the S1, the overexpression recombinant plasmid of the LXRα gene and the recombinant plasmid of the LXRα reporter gene are co-transfected into packaging cells with a packaging plasmid respectively;

[0024] The transfection reagent used for the co-transfection is Lipofactamine 3000;

[0025] The packaging cells are 293T cells.

[0026] Further, the S2 includes:

[0027] (1) Culture mammalian cells;

[0028] (2) Transfect the recombinant lentivirus of the LXRα reporter gene into cells, and perform screening with a first screening marker to obtain stably transfected intermediate recombinant cells; then transfect the overexpression recombinant lentivirus of the LXRα gene into the intermediate recombinant cells, and perform screening with a second screening marker to obtain the stable transfection cell line of the LXRα reporter gene based on COS-7 cells.

[0029] Further, the mammalian cells cultured in step (1) of the S2 are COS-7, the kidney cells transformed by African green monkey SV40;

[0030] In step (2), the first screening marker and the second screening marker are different. The first screening marker is puromycin, and the second screening marker is blasticidin.

[0031] On yet another aspect, the present application also claims protection for the use of any of the aforementioned stable transfection cell lines in screening LXRα effectors.

[0032] Further, it includes the following steps:

[0033] Contact the substance to be tested with the stably transfected cell line,

[0034] Detect the signal of the reporter gene,

[0035] Determine the effect of the substance to be tested on LXRα according to the signal of the reporter gene.

[0036] Further, the LXRα effector includes an LXRα agonist and an LXRα antagonist;

[0037] The method or application further includes using a known LXRα agonist and / or LXRα antagonist as a positive control.

[0038] Compared with the prior art, the present invention has the following advantages:

[0039] 1. A stably transfected cell line capable of stably expressing LXRα was constructed based on the COS-7 cell line. This cell line uses mammalian cell COS-7 as the host and stably expresses the LXRα receptor, better simulating the agonist / antagonist effects of exogenous chemicals on the LXRα nuclear receptor, and can be used for high-throughput testing of exogenous chemicals.

[0040] 2. The present invention characterizes the transcriptional activity of LXRα by introducing a luciferase reporter gene. The luciferase reporter gene detection method can digitalize the expression intensity data of the target gene, has extremely low background signal values and extremely high sensitivity, and is widely used in the research of intracellular signaling pathways.

[0041] 3. For the stably transfected cell line constructed in the present invention, when performing biological activity tests of agonists and antagonists, the positive agonist GW3965 and the antagonist GSK2033 both produced good dose-effect relationships, presenting typical "S"-shaped curves or inverted "S"-shaped curves.

[0042] 4. The sensitivity of this stably transfected cell line is relatively high. The EC 50 value of the agonist GW3965 is 0.14 μM, and the lowest observable effect concentration (LOEC) is 0.01 μM; the IC 50 value of the antagonist GSK2033 is 0.32 μM, and the LOEC value is 0.05 μM.

[0043] 5. When this stably transfected cell line is used for in vitro screening of LXRα effectors, the response interval is relatively wide. The linear range of the agonist GW3965 is 0.01 - 2 μM, and the linear range of the antagonist GSK2033 is 0.1 - 2 μM.

[0044] 6. When the stable cell line is used for in vitro screening of LXRα effectors, the data has good stability, and the relative standard deviations (RSD) of each concentration induced by the agonist GW3965 and the antagonist GSK2033 are all < 25%.

[0045] 7. Conduct multi-generation agonist response tests on the stable cell line, and the EC 50 has no obvious change, indicating that the cell line has good stability and reliable data when used for long-term tests. Description of the Drawings

[0046] Figure 1 is the map of the lentiviral recombinant plasmid overexpressing LXRα and the map of the reporter gene plasmid.

[0047] Figure 2 is the observation result after drug screening of the stable cell line of the LXRα reporter gene.

[0048] Figure 3 is the verification of the LXRα gene expression in the stable cell line of the LXRα reporter gene.

[0049] Figure 4 is the evaluation result of the transfection efficiency of the recombinant lentivirus overexpressing LXRα.

[0050] Figure 5 is the detection result of the method development and determination of the method for measuring the concentration of LXRα agonist or antagonist using the stable cell line of the LXRα reporter gene. Detailed Embodiments

[0051] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0052] In the first aspect, the present invention provides a stable cell line of the LXRα reporter gene based on COS-7 cells, introducing an LXRα gene nucleic acid construct and an LXRα reporter gene nucleic acid construct into mammalian cells.

[0053] The LXRα reporter gene nucleic acid construct includes an LXRα binding element, a promoter, a reporter gene, and / or a first selection marker gene operably linked in sequence from 5' to 3'; wherein the sequence of the LXRα binding element is as shown in SEQ ID NO: 1.

[0054] The LXRα gene nucleic acid construct includes an LXRα gene expression cassette and a second selection marker gene expression cassette.

[0055] Preferably, for the LXRα reporter gene stably transfected cell line based on COS-7 cells of the present invention,

[0056] the mammalian cell is a subculture cell;

[0057] at least some elements of the LXRα gene nucleic acid construct and the LXRα reporter gene nucleic acid construct are integrated into the cell chromosome;

[0058] the reporter gene includes a green fluorescent protein gene and a luciferase gene;

[0059] the first selection marker gene and the second selection marker gene are respectively selected from the blasticidin resistance gene and the puromycin resistance gene.

[0060] Secondly, the present invention also provides a method for constructing an LXRα reporter gene stably transfected cell line based on COS-7 cells, which includes:

[0061] S1 Prepare an LXRα gene nucleic acid construct and an LXRα reporter gene nucleic acid construct;

[0062] S2 Introduce the LXRα gene nucleic acid construct and the LXRα reporter gene nucleic acid construct into cells and perform screening.

[0063] Preferably, for the method for constructing an LXRα reporter gene stably transfected cell line based on COS-7 cells of the present invention, it is characterized in that:

[0064] S1 includes:

[0065] (1) Respectively construct an LXRα gene overexpression recombinant plasmid and an LXRα reporter gene recombinant plasmid;

[0066] (2) Package the LXRα gene overexpression recombinant plasmid to produce an LXRα gene overexpression recombinant lentivirus, and package the LXRα reporter gene recombinant plasmid to produce an LXRα reporter gene recombinant lentivirus.

[0067] Preferably, for the method for constructing an LXRα reporter gene stably transfected cell line based on COS-7 cells of the present invention, it is characterized in that in step (2) of S1, the LXRα gene overexpression recombinant plasmid and the LXRα reporter gene recombinant plasmid are co-transfected into packaging cells with a packaging plasmid;

[0068] The transfection reagent used for the co-transfection is Lipofactamine 3000;

[0069] The packaging cell is a 293T cell.

[0070] Preferably, for the method for constructing an LXRα reporter gene stably transfected cell line based on COS-7 cells of the present invention, it is characterized in that:

[0071] S2 includes:

[0072] (1) Culturing mammalian cells;

[0073] (2) Transfecting the cells with the recombinant lentivirus of the LXRα reporter gene, and screening with a first selection marker to obtain stably transfected intermediate recombinant cells; then transfecting the intermediate recombinant cells with the recombinant lentivirus overexpressing the LXRα gene, and screening with a second selection marker to obtain the stable transfection cell line of the LXRα reporter gene based on COS-7 cells.

[0074] Preferably, for the method for constructing the stable transfection cell line of the LXRα reporter gene based on COS-7 cells according to the present invention, it is characterized in that: the mammalian cells in step (1) of S2 are COS-7, the kidney cells transformed by African green monkey SV40;

[0075] In step (2), the first selection marker and the second selection marker are different. The first selection marker is preferably puromycin, and the second selection marker is preferably blasticidin.

[0076] In a third aspect, the present invention also provides a method or application of any of the foregoing stable transfection cell lines for screening LXRα effectors.

[0077] Preferably, for the method or application of the stable transfection cell line of the present invention for screening LXRα effectors, it includes:

[0078] Contacting the test substance with the stable transfection cell line,

[0079] Detecting the signal of the reporter gene,

[0080] Determining the effect of the test substance on LXRα according to the signal of the reporter gene.

[0081] Preferably, for the method or application of the stable transfection cell line of the present invention for screening LXRα effectors, it is characterized in that:

[0082] The LXRα effectors include LXRα agonists and LXRα antagonists;

[0083] The method or application of the stable transfection cell line for screening LXRα effectors also includes using a known LXRα agonist and / or a known LXRα antagonist as a positive control.

[0084] In a specific embodiment, the present invention provides a method for constructing a stable transfection cell line of the LXRα reporter gene, and the construction steps are as follows:

[0085] S1: Preparing a recombinant lentivirus overexpressing LXRα and a recombinant lentivirus of the LXRα reporter gene

[0086] (1) Construct the LXRα overexpression recombinant plasmid. Transform the LXRα overexpression recombinant plasmid and the LXRα reporter gene recombinant plasmid into stbl3 competent cells respectively for plasmid amplification. Then, perform large-scale endotoxin-free extraction to make the final plasmid concentration > 500 ng / μL;

[0087] (2) Co-transfect the LXRα reporter gene plasmid and the LXRα overexpression plasmid with the packaging plasmid into the lentivirus packaging cells respectively. Then, collect the virus supernatant, filter and collect the filtrate containing the virus. Obtain the LXRα reporter gene recombinant lentivirus and the LXRα overexpression recombinant lentivirus.

[0088] S2: Lentivirus transduction and screening of stable transfected cell lines

[0089] (1) Resuscitate the African green monkey SV40-transformed kidney cells COS-7 and culture them in a 37 °C cell culture incubator containing 5% carbon dioxide (CO2). The culture medium used is DMEM high-glucose complete medium containing 10% fetal bovine serum and 1% penicillin-streptomycin;

[0090] (2) Transduce the LXRα reporter gene recombinant lentivirus into the COS-7 target cells. After puromycin resistance screening, obtain the stable transfected cell line of the reporter gene. Then, transduce the LXRα overexpression recombinant lentivirus into the stable transfected cell line of the reporter gene. After screening with blasticidin, obtain the stable transfected cell line of the LXRα reporter gene.

[0091] Furthermore, the LXRα overexpression plasmid contains the LXRα gene and the blasticidin resistance gene sequence.

[0092] Furthermore, the LXRα reporter gene plasmid contains the LXRα binding element, mini-promoter, green fluorescent protein gene, LUC2 luciferase gene and puromycin resistance gene.

[0093] Furthermore, in step (2) of S1, the lentivirus packaging cells used are 293T cells.

[0094] Furthermore, in step (2) of S1, when co-transfecting the reporter gene plasmid and the LXRα gene expression plasmid with the packaging plasmid into the 293T cells, the transfection reagent used is Lipo3000.

[0095] Furthermore, in step (2) of S1, co-transfect the reporter gene plasmid and the LXRα gene expression plasmid with the packaging auxiliary plasmid into the 293T cells. Replace the fresh medium 8 h later to terminate the transfection. Collect the supernatant at 48 h and 72 h respectively, filter it with a 0.45 μm filter, and concentrate and purify the lentivirus with the lentivirus concentrate for the filtrate;

[0096] Further, in step 2) of S1, the virus titer of the obtained LXRα gene recombinant lentivirus is not less than 10 8 TU / mL

[0097] Further, in S2, the penicillin-streptomycin refers to penicillin with a concentration of 100 U / mL and streptomycin with a concentration of 100 μg / mL.

[0098] Further, step 2 of S2 is specifically as follows:

[0099] Transduce the reporter gene recombinant lentivirus into COS-7 target cells. The transduction enhancer used is Polybrene, with a concentration of 8 μg / mL. Replace the culture medium 8 h after transduction to terminate virus transduction. 48 h after cell transduction, perform drug screening with puromycin at a screening concentration of 4 μg / mL to obtain reporter gene stably transfected cells. Then transduce the LXRα gene expression lentivirus into the reporter gene stably transfected cells. Replace the culture medium 8 h after transduction to terminate virus transduction. 48 h after cell transduction, perform drug screening with blasticidin at a screening concentration of 15 μg / mL to obtain the LXRα reporter gene stably transfected cell line.

[0100] In another specific embodiment, the present invention also provides a detection method for the biological activity of an LXRα agonist or antagonist by using the construction method of an LXRα reporter gene stably transfected cell line.

[0101] Example 1: Construction of recombinant cells for screening LXRα effectors

[0102] Step 1: Construct the LXRα overexpression vector as Figure 1A shown

[0103] (1) According to the reference, log in to NCBI to query and obtain the required LXRα gene sequence. Synthesize the transcript sequence NM_005693.4 (SEQ ID NO: 2) of the human LXRα receptor by gene synthesis, and amplify the target gene by PCR.

[0104] (2) Digest the vector pCDH-CMV-MCS-EF1α-BSD with restriction endonucleases, and recover the vector fragment by 1% agarose gel electrophoresis.

[0105] (3) Use the In-Fusion ligation system to recombinantly connect the vector fragment and the target gene LXRα to form the LXRα overexpression plasmid pCDH-CMV-LXRA-EF1α-BSD. Among them, "pCDH" represents the pCDH backbone vector, CMV represents the CMV promoter sequence, "LXRA" represents the LXRα coding sequence, "EF1α" represents the EF1α promoter sequence, and "BSD" represents the blasticidin resistance gene sequence. The ligation product is transformed into stbl3 competent cells. The grown monoclonal clones are sequenced and identified, and the sequencing results are compared and analyzed. The construction is successful if the sequence is completely correct, and then the plasmid is amplified.

[0106] (4) Perform a large-scale extraction of LXRα overexpression plasmid to remove endotoxin, so that the final concentration of the plasmid is >500 ng / μL;

[0107] Step 2: Build Figure 1B LXRα reporter gene vector shown

[0108] Design as Figure 1B The LXRα reporter gene vector pCDH-LXRα-mini-LUC2-EF1α-GFP-Puro was shown, and the inserted gene was sequenced and confirmed. Among them, "pCDH" represents the pCDH backbone vector, "LXRα" represents the LXRα binding element, "mini" represents the mini-promoter sequence, "LUC2" represents the insect luciferase gene, "EF1α" represents the EF1α promoter sequence, "GFP" represents the green fluorescent protein gene, and "Puro" represents the puromycin resistance gene.

[0109] The sequence of the synthetic LXRα binding element is shown in SEQ ID NO: 1:

[0110] TGAGGTTACTGCTGGTCATTCAGCTGAGGTTACTGCTGGTCATTCA

[0111] Step 3: Lentiviral transduction and cell line drug screening

[0112] (1) 293T cells in good growth condition were inoculated into a 15 cm cell culture dish. After 24 h, the LXRα reporter gene plasmid (prepared in step 2, such as Figure 1B As shown), LXRα overexpression plasmid (prepared in step 1, as shown Figure 1AThey were co-transfected with the lentiviral packaging plasmid into 293T cells respectively as shown in the figure. After 8 hours, the fresh medium was replaced to terminate the transfection. The viral supernatants were collected at 48 hours and 72 hours after transfection respectively. After filtering through a 0.45 μm filter, the lentivirus was concentrated and purified with a lentivirus concentrate to obtain the recombinant lentivirus of the LXRα reporter gene (containing the LXRα binding element, mini-promoter, green fluorescent protein gene, LUC2 luciferase gene and puromycin resistance gene, named Lenti-GFP-Puro-LXRα-mini-LUC2) and the recombinant lentivirus of overexpressed LXRα (containing the LXRα gene expression cassette and the blasticidin resistance gene expression cassette, named Lenti-LXRα-BSD) concentrate, which was stored at -80 °C for later use.

[0113] (2) After the COS-7 cells were resuscitated, they were cultured in a 37 °C cell incubator containing 5% CO2. The medium was a complete medium, that is, 10% fetal bovine serum and 1% penicillin-streptomycin were added to the high-glucose DMEM basal medium.

[0114] (3) Transduction; The lentivirus Lenti-GFP-Puro-LXRα-mini-LUC2 was transduced into COS-7 cells. The concentration of the transduction enhancer Polybrene was 8 μg / mL. After 8 hours of transduction, the culture medium was replaced to terminate the transduction. 48 hours after cell transduction, drug resistance screening was carried out with 4 μg / mL puromycin. After 24 hours, the medium was replaced and the cells were passaged, maintaining the puromycin drug screening concentration of 4 μg / mL until all the cell lines not transduced with the virus died. Then the drug concentration was slowly decreased to expand the cells, and the COS7-GFP-Puro-LXRα-mini-LUC2 intermediate recombinant cells were obtained.

[0115] The lentivirus Lenti-LXRα-BSD plasmid was transduced into the COS7-GFP-Puro-LXRα-mini-LUC2 intermediate recombinant cells obtained in the previous step. After 8 hours of transduction, the culture medium was replaced to terminate the transduction. 40 hours after replacing the medium, the cell line was screened for blasticidin resistance at a concentration of 15 μg / ml. After 72 hours, the medium was replaced and the cells were passaged. During the subculture process, the drug screening concentration of 15 μg / ml was maintained until all the cells not transduced with the virus died. Subsequently, the drug concentration was slowly decreased to expand the cells, and finally the COS7-GFP-Puro-P LXRα -mini-LUC2-LXRα-BSD stable transfected cell line, that is, a recombinant stable transfected cell line carrying the LXRα reporter gene and can be used to screen for LXRα effectors.

[0116] Figure 2A and Figure 2BThey are the white field and GFP field of fluorescence detection under the same field of view respectively. The results show that the fluorescence rate of the cell line can reach 100%, that is, the transfection rate of the stable transfected cell line is 100%. For the obtained recombinant stable transfected cell line carrying the LXRα reporter gene and available for screening LXRα effectors, the mycoplasma contamination was detected using the mycoplasma detection kit (PCR method) of Hangzhou Hua'an Biotechnology Co., Ltd.

[0117] Example 2: Verification of the expression of LXRα gene in COS-7-LXRα-LUC stable transfected cell line by qPCR

[0118] Three experimental groups were set up in this experiment, as follows:

[0119] COS7: Un-transfected wild-type COS-7 cells

[0120] COS7-LUC: COS7-GFP-Puro-LXRα-mini-LUC2 cells

[0121] COS7-LXRα-LUC: COS7-GFP-Puro-P LXRα -mini-LUC2-LXRα-BSD cells

[0122] (1) Design specific primer sequences:

[0123] LXRα-qF (SEQ ID NO:3): CCTTCAGAACCCACAGAGATCC

[0124] LXRα-qR (SEQ ID NO:4): ACGCTGCATAGCTCGTTCC

[0125] (2) Use Trizol (Takara) to extract total RNA from the cell pellet, and then reverse transcribe the total RNA into cDNA using the reverse transcription kit primescript RT Master Mix (Takara).

[0126] (3) Use the SYBR Green I dye method for qPCR to detect the expression of LXRα in the three groups of cells and perform relative quantitative analysis. Three parallels were made for each sample. The qPCR results of the stable transfected cell line obtained in Example 1 and the blank control are as Figure 3 shown.

[0127] It can be seen from the results that after infection with the LXRα overexpression lentivirus, the expression level of LXRα increased significantly; while there was no amplification in wild-type COS-7 cells and COS-7-LUC transfected only with the LXRα reporter gene lentivirus.

[0128] Example 3 Compound Exposure and Reporter Gene Assay

[0129] (1) Compound Exposure: The LXRα reporter gene stably transfected cell line was seeded into a clear-bottom 96-well white plate at a density of 20,000 CFU / well. The cells were exposed to the test compounds at different concentrations with no obvious cytotoxicity (cell viability > 80%) for 18 h. The exposure medium was phenol red-free DMEM high-glucose medium containing 10% FBS and 1% penicillin-streptomycin. The compound stock solution prepared with dimethyl sulfoxide (DMSO) was diluted into a series of concentrations using the exposure medium.

[0130] a. To detect the agonistic activity of GW3965, the transfected cells were directly exposed to the diluted agonist (DMSO content ≤ 0.1%). The compound concentration gradients were 0.001, 0.01, 0.025, 0.05, 0.1, 0.25, 0.5, 1, 2 μM, and 0.1% DMSO was used as the control group; at least 3 wells were set as replicates for each concentration gradient.

[0131] b. To detect the antagonistic activity of GSK2033, 10 nM of GW3965 should be included in each concentration of the antagonist. The exposure concentrations of GSK2033 were 0.001, 0.01, 0.05, 0.1, 0.25, 0.5, 1, 2 μM.

[0132] The total amount of DMSO in the antagonist GSK2033 and the agonist GW3965 was ≤ 0.1%, and the group containing only 2 μM of GW3965 was used as the control group. The compound exposure time was 18 h, and at least 3 wells were set as replicates for each concentration of the test compound.

[0133] (2) Firefly Luciferase (LUC) Activity Assay: The Luc activity after 18 h of compound exposure was measured using a detection kit. The detection method was the mono-Luc assay.

[0134] Result Analysis. The in vitro screening methods for the agonistic or antagonistic activity effectors of LXRα were evaluated using the positive selective agonist GW3965 and the selective antagonist GSK2033, respectively. As Figure 4 and Figure 5 shown, under the mono-Luc assay, both the positive agonist GW3965 and the positive antagonist GSK2033 produced good dose-effect relationships, presenting typical "S"-shaped curves or inverted "S"-shaped curves. With high sensitivity, the EC 50 value of GW3965 was 0.14 μM, and the IC 50The value is 0.32 μM, and the lowest observable effect concentrations (LOECs) of GW3965 and GSK2033 are 0.01 μM and 0.05 μM respectively; this method has a wide response range, and the response ranges of GW3965 and GSK2033 are 0.001 - 2 μM and 0.05 - 2 μM respectively; this method has good reproducibility, and the relative standard deviations (RSDs) of each concentration induced by GW3965 and GSK2033 are all < 25%.

[0135] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A COS-7 cell line stably transfected with an LXRα reporter gene, characterized in that: Introduce the LXRα gene nucleic acid construct and the LXRα reporter gene nucleic acid construct into mammalian cells, The LXRα reporter gene nucleic acid construct includes an LXRα binding element, a promoter, a reporter gene, and / or a first selection marker gene operably linked in sequence from 5' to 3'; wherein the sequence of the LXRα binding element is as shown in SEQ ID NO:1; The LXRα gene nucleic acid construct includes an LXRα gene expression cassette and a second selection marker gene expression cassette; The LXRα gene sequence is as shown in SEQ ID NO:

2.

2. The cell line according to claim 1, characterized in that: The mammalian cell is a passage cell; At least some elements of the LXRα gene nucleic acid construct and the LXRα reporter gene nucleic acid construct are integrated into the cell chromosome; The reporter gene includes a green fluorescent protein gene and a luciferase gene; The first selection marker gene and the second selection marker gene are respectively selected from the blasticidin resistance gene and the puromycin resistance gene.

3. The construction method of the COS-7 cell LXRα reporter gene stably transfected cell line according to claim 1 or 2, characterized in that: Comprising the following steps: S1 Prepare the LXRα gene nucleic acid construct and the LXRα reporter gene nucleic acid construct; S2 Introduce the LXRα gene nucleic acid construct and the LXRα reporter gene nucleic acid construct into cells and perform screening.

4. The construction method according to claim 3, characterized in that: S1 includes: (1) Construct an LXRα gene overexpression recombinant plasmid and an LXRα reporter gene recombinant plasmid; (2) Package the LXRα gene overexpression recombinant plasmid to produce an LXRα gene overexpression recombinant lentivirus, and package the LXRα reporter gene recombinant plasmid to produce an LXRα reporter gene recombinant lentivirus.

5. The construction method according to claim 4, characterized in that: In step (2) of S1, the LXRα gene overexpression recombinant plasmid and the LXRα reporter gene recombinant plasmid are co-transfected into packaging cells respectively; The transfection reagent used for co-transfection is Lipofactamine 3000; The packaging cell is 293T cell.

6. The construction method according to claim 3, characterized in that: S2 includes: (1) Culture mammalian cells; (2) Transfect the LXRα reporter gene recombinant lentivirus into cells, and perform screening using the first selection marker to obtain stably transfected intermediate recombinant cells; then transfect the LXRα gene overexpression recombinant lentivirus into the intermediate recombinant cells, and perform screening using the second selection marker to obtain the stable transfection cell line of the LXRα reporter gene based on COS-7 cells.

7. The construction method according to claim 4, wherein: The mammalian cells cultured in step (1) of S2 are African green monkey SV40-transformed kidney cells COS-7; In step (2), the first selection marker and the second selection marker are different, the first selection marker is puromycin, and the second selection marker is blasticidin.

8. Use of the stable transfection cell line according to any one of claims 1-2 in screening LXRα effectors.

9. Use of the stably transfected cell line according to claim 8 in screening for LXRα effectors, characterized in that: Comprising the following steps: Contact the test substance with the stable transfection cell line, Detect the signal of the reporter gene, Determine the effect of the test substance on LXRα according to the signal of the reporter gene.

10. Use of the stably transfected cell line according to claim 8 or 9 in screening for LXRα effectors, characterized in that: The LXRα effectors include LXRα agonists and LXRα antagonists; The method or use further includes using a known LXRα agonist and / or LXRα antagonist as a positive control.

Images