CrRNA target and CRISPR-Cas13a system for detecting hantaan virus and application of crRNA target and CRISPR-Cas13a system

Abstract

The invention discloses a crRNA target spot and a CRISPR-Cas13a system for detecting hantaan virus and application of the crRNA target spot and the CRISPR-Cas13a system. The CRISPR-Cas13a system comprises Cas13a protein and crRNA or a complex formed by the Cas13a protein and the crRNA; the crRNA comprises an anchoring sequence used for being combined with Cas13a protein and a guide sequence targeting a Hantaan virus target sequence; the Hantaan virus target sequence is located at the 2642-2973 site of the L-segment gene of the Hantaan virus genome. The crRNA provided by the invention can realize high-sensitivity and high-specificity detection on Hantaan virus nucleic acid by activating Cas13a, and the sensitivity reaches 1 copy (1 copy / [mu] L).

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular diagnosis, and particularly relates to a crRNA target for detecting Hantaan virus, a CRISPR-Cas13a system and their applications. Background Art

[0002] Hemorrhagic fever with renal syndrome, also known as epidemic hemorrhagic fever, is a disease caused by Hantavirus (HV) infection, mainly manifested by hypotensive shock and kidney damage, accompanied by fever, congestion and bleeding. Hemorrhagic fever with renal syndrome is widely prevalent globally, and China is one of the main epidemic areas of this disease. Among them, Hantaan virus (HTNV) is one of the main pathogenic types of hemorrhagic fever with renal syndrome in China, often causing severe hemorrhagic fever with renal syndrome, and the main host is Apodemus agrarius.

[0003] Clustered regularly interspaced short palindromic repeats (CRISPR) and related proteins (Cas) are an acquired immune system, first discovered in archaea. With the in-depth research, researchers found that after binding to the target RNA, the Cas13a protein is activated and can cleave non-target RNA. By connecting detectable target groups to both ends of the non-target RNA, the target RNA can be indirectly detected by detecting the target groups, that is, the CRISPR-Cas13a detection method.

[0004] Currently, there are mainly three methods for the clinical inspection and diagnosis of hemorrhagic fever with renal syndrome, namely serological immunoassay, nucleic acid detection, and virus isolation and culture. Virus isolation and culture is the most direct diagnostic basis, but the operation is extremely cumbersome and complex. Immunological detection requires the use of professional medical instruments for detection, can only detect biological samples, and has a window period. PCR nucleic acid detection cannot be carried out for rapid on-site detection. In summary, the existing detection methods cannot meet the requirements of being rapid, simple, highly sensitive and highly specific at the same time, and there is an urgent need to develop a rapid, simple, highly sensitive and highly specific detection method for detecting Hantaan virus. Summary of the Invention

[0005] Based on the technical problems existing in the prior art, the present invention provides a crRNA target for detecting Hantaan virus, a CRISPR-Cas13a system and their applications. The present invention is a detection method combining RT-RAA-based detection technology and lateral flow chromatography test strips, with the technical advantages of simple operation, stable system and wide application in the field of clinical molecular diagnosis, realizing the highly sensitive detection of corresponding pathogens, and can detect viruses as low as single copy.

[0006] To achieve the above object, according to the first aspect of the technical solution of the present invention, a crRNA target for detecting Hantaan virus is provided, and the Hantaan virus target sequence is SEQ ID NO.1.

[0007] According to the second aspect of the technical solution of the present invention, a CRISPR-Cas13a system for detecting Hantaan virus is provided. The CRISPR-Cas13a system includes a Cas13a protein and a crRNA, or a complex formed by the two; the crRNA includes an anchor sequence for binding to the Cas13a protein and a guide sequence targeting the Hantaan virus target sequence; the Hantaan virus target sequence of the CRISPR-Cas13a system for detecting Hantaan virus is as shown in SEQ ID NO.1.

[0008] Furthermore, the crRNA sequence is as shown in SEQ ID NO.2. Preferably, the Cas13a protein is the LwCas13a protein.

[0009] According to the third aspect of the technical solution of the present invention, a kit for detecting Hantaan virus is provided, which includes the above-mentioned CRISPR-Cas13a system for detecting Hantaan virus. Preferably, the kit further includes RAA amplification primers for specifically amplifying the Hantaan virus target sequence; the RAA amplification primers are composed of a single-stranded DNA molecule shown in SEQ ID NO.4 and a single-stranded DNA molecule shown in SEQ ID NO.5.

[0010] According to the fourth aspect of the technical solution of the present invention, any of the following substances is provided: A1) The above-mentioned crRNA; A2) The above-mentioned Cas13a protein and crRNA, or a complex formed by the two; A3) The above-mentioned primer combination.

[0011] According to the fifth aspect of the technical solution of the present invention, any of the following applications is provided: B1) The application of the above-mentioned CRISPR-Cas13a system or the above-mentioned kit or the above-mentioned substance in detecting or assisting in detecting Hantaan virus or its nucleic acid; B2) The application of the above-mentioned CRISPR-Cas13a system or the above-mentioned kit or the above-mentioned substance in preparing a product for detecting or assisting in detecting Hantaan virus or its nucleic acid; B3) The application of the above-mentioned CRISPR-Cas13a system or the above-mentioned kit or the above-mentioned substance in detecting or assisting in detecting whether a test sample contains Hantaan virus or its nucleic acid; B4) Use of the above CRISPR-Cas13a system, or the above kit, or the above substance in the preparation of a product for detecting or assisting in detecting whether a test sample contains Hantaan virus or its nucleic acid; B5) Use of the above CRISPR-Cas13a system, or the above kit, or the above substance in screening or assisting in screening drugs for the prevention and treatment of Hantaan virus; B6) Use of the above CRISPR-Cas13a system, or the above kit, or the above substance in the preparation of a product for screening or assisting in screening drugs for the prevention and treatment of Hantaan virus; B7) Use of the above substance in the preparation of the above kit.

[0012] According to the sixth aspect of the technical solution of the present invention, a method for detecting or assisting in detecting Hantaan virus is provided, including the following steps: C1) Using the nucleic acid of the test sample as a template, performing RAA amplification with a primer pair composed of the single-stranded DNA molecule shown in SEQ ID NO.4 and the single-stranded DNA molecule shown in SEQ ID NO.5 to obtain an RAA product; C2) Preparing a CRISPR-Cas13a detection system containing the following components: the RAA product, the above Cas13a protein, the above crRNA, fluorescent reporter RNA, NTP, T7 RNA polymerase, and RNase inhibitor; simultaneously using water to replace the PCR product as a negative control; C3) Detecting the reaction product through the reaction of the CRISPR-Cas13a detection system, thereby determining whether the test sample contains Hantaan virus.

[0013] Further, in step C1), the reaction conditions for the RAA amplification are: reacting at a temperature of 42°C for 30 minutes.

[0014] Compared with the prior art, the present invention has the following beneficial effects: The method for detecting or assisting in detecting Hantaan virus provided by the present invention can be either a non-disease diagnosis and treatment method or a disease diagnosis and treatment method. Among them, the non-disease diagnosis and treatment method can be, for example, detecting whether Hantaan virus is contained in cells before and after drug use when screening drugs for the prevention and treatment of Hantaan virus at the cell level.

[0015] The present invention is a detection technology based on RT-RAA, which has the technical advantages of simple operation, stable system, and can be widely applied in the field of clinical molecular diagnosis.

[0016] The present invention combines RT-RAA technology with CRISPR-Cas13a nucleic acid detection technology. Through design, construction, and screening, a target sequence for detecting Hantaan virus and a specific crRNA capable of targeting this target sequence are finally provided. This crRNA can achieve highly sensitive and specific detection of Hantaan virus nucleic acid by activating Cas13a, with a sensitivity reaching 1 copy (1 copy / μL). Description of the Drawings

[0017] Figure 1 For the real-time fluorescence value results of plasmid PCR + CRISPR fluorescence screening of crRNA with 10 2 copies / µL.

[0018] Figure 2 For the final fluorescence value results (60 min) of plasmid PCR + CRISPR fluorescence screening of crRNA with 102 copies / µL.

[0019] Figure 3 For the results of screening RAA primer combinations with 10 2 copies / µL of plasmid and the preliminarily screened crRNA.

[0020] Figure 4 For the real-time fluorescence value results of screening crRNA with 10 2 copies / µL of plasmid and the preliminarily screened RAA primer combinations.

[0021] Figure 5 For the final fluorescence value results (60 min) of screening crRNA with 10 2 copies / µL of plasmid and the preliminarily screened RAA primer combinations.

[0022] Figure 6 For the real-time fluorescence value results of CRISPR-Cas13a detection of different concentrations of HTNV conserved sequences with the optimal RAA primer combination and the optimal crRNA.

[0023] Figure 7 For the final fluorescence value results (60 min) of CRISPR-Cas13a detection of different concentrations of HTNV conserved sequences with the optimal RAA primer combination and the optimal crRNA.

[0024] Figure 8 For the test strip images of CRISPR-Cas13a detection of different concentrations of HTNV conserved sequences with the optimal RAA primer combination and the optimal crRNA.

[0025] Figure 9The gray value diagram of the test strip T line for detecting different concentrations of HTNV conserved sequences by the optimal RAA primer combination and the optimal crRNA of CRISPR-Cas13a.

[0026] Figure 10 The test strip diagram showing that there is no cross-reaction when CRISPR-Cas13a targeting the HTNV conserved sequence detects other pathogens.

[0027] Figure 11 The gray value diagram of the test strip T line for detecting other pathogens without cross-reaction when CRISPR-Cas13a targeting HTNV nucleic acid is used. Detailed implementation manners

[0028] The present invention will be further described in detail below in conjunction with the specific implementation manners. The provided embodiments are only for clarifying the present invention and not for limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements and do not constitute any limitation to the present invention in any way.

[0029] In the experimental methods in the following embodiments, unless otherwise specified, they are all conventional methods and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can all be obtained from commercial channels.

[0030] The crRNA target and the CRISPR-Cas13a system for detecting Hantaan virus of the present invention are based on the principle of the CRISPR-Cas13a system and the selection principle of the target sequence. Five crRNAs are designed according to the Hantaan virus gene sequence, and the crRNA with the best activation effect on the CRISPR-Cas13a system is selected for detecting Hantaan virus nucleic acid.

[0031] The first technical solution of the present invention is to provide a crRNA target for detecting Hantaan virus, and the Hantaan virus target sequence is SEQ ID NO.1.

[0032] The second technical solution of the present invention is to provide a CRISPR-Cas13a system for detecting Hantaan virus. The CRISPR-Cas13a system includes a Cas13a protein and a crRNA, or a complex formed by the two; the crRNA includes an anchor sequence for binding to the Cas13a protein and a guide sequence targeting the Hantaan virus target sequence; the Hantaan virus target sequence is as shown in SEQ ID NO.1.

[0033] In some embodiments, the crRNA sequence is as shown in SEQ ID NO.2. Preferably, the Cas13a protein is the LwCas13a protein.

[0034] The third technical solution of the present invention is to provide a kit for detecting Hantaan virus, which comprises the above-mentioned CRISPR-Cas13a system for detecting Hantaan virus.

[0035] In some embodiments, the kit further comprises RAA amplification primers for specifically amplifying the target sequence of Hantaan virus; the RAA amplification primers are composed of the single-stranded DNA molecule shown in SEQ ID NO.4 and the single-stranded DNA molecule shown in SEQ ID NO.5.

[0036] The fourth technical solution of the present invention is to provide any one of the following substances: A1) The above-mentioned crRNA; A2) The above-mentioned Cas13a protein and crRNA, or the complex formed by the two; A3) The above-mentioned primer combination.

[0037] The fifth technical solution of the present invention is to provide any one of the following applications: B1) The application of the above-mentioned system or the above-mentioned kit or the above-mentioned substance in detecting or assisting in detecting Hantaan virus or its nucleic acid; B2) The application of the above-mentioned system or the above-mentioned kit or the above-mentioned substance in preparing a product for detecting or assisting in detecting Hantaan virus or its nucleic acid; B3) The application of the above-mentioned system or the above-mentioned kit or the above-mentioned substance in detecting or assisting in detecting whether a test sample contains Hantaan virus or its nucleic acid; B4) The application of the above-mentioned system or the above-mentioned kit or the above-mentioned substance in preparing a product for detecting or assisting in detecting whether a test sample contains Hantaan virus or its nucleic acid; B5) The application of the above-mentioned system or the above-mentioned kit or the above-mentioned substance in screening or assisting in screening drugs for preventing and treating Hantaan virus; B6) The application of the above-mentioned system or the above-mentioned kit or the above-mentioned substance in preparing a product for screening or assisting in screening drugs for preventing and treating Hantaan virus; B7) The application of the above-mentioned substance in preparing the above-mentioned kit.

[0038] The sixth technical solution of the present invention is to provide an application of the crRNA target for detecting Hantaan virus as described above, and the application is to prepare crRNA or to prepare RAA amplification primers for specifically amplifying the target sequence of Hantaan virus or to prepare a positive control for detecting Hantaan virus.

[0039] The seventh technical solution of the present invention is to provide a method for detecting or assisting in detecting Hantaan virus, which comprises the following steps: C1) Using the nucleic acid of the sample to be tested as a template, perform RAA amplification with a primer pair consisting of the single-stranded DNA molecule shown in SEQ ID NO.4 and the single-stranded DNA molecule shown in SEQ ID NO.5 to obtain an RAA product; C2) Prepare a CRISPR-Cas13a detection system containing the following components: the RAA product, Cas13a protein, the above-mentioned crRNA, fluorescent reporter RNA, NTP, T7 RNA polymerase, RNA enzyme inhibitor; at the same time, use water (ddH2O) to replace the PCR product as a negative control; C3) Detect the reaction product of the CRISPR-Cas13a detection system to determine whether the sample to be tested contains Hantaan virus.

[0040] The detection reaction of the above CRISPR-Cas13a detection system includes a fluorescence system reaction C3)-1 or a test strip system reaction C3)-2: C3)-1: The RNA in the CRISPR-Cas13a detection system is fluorescent reporter RNA. Put the CRISPR-Cas13a detection system into a fluorescence quantitative PCR instrument for reaction, detect the fluorescence intensity, and determine whether the sample to be tested contains Hantaan virus according to the magnitude of the fluorescence intensity: Set at least 3 groups of independent repeated experiments, and compare whether the mean difference of the fluorescence values at the 60th minute among groups is significant (using a t-test, P<0.05). If there is a significant difference between the sample to be tested and the negative control group (using ddH2O as a template), the sample to be tested contains or is candidate to contain Hantaan virus, otherwise the sample to be tested does not contain or is candidate not to contain Hantaan virus.

[0041] C3)-2: The CRISPR-Cas13a detection system reacts, and the RNA in the CRISPR-Cas13a detection system is the report RNA for test strip detection. Use a test strip to detect the reaction product, and determine whether the sample to be tested contains Hantaan virus according to whether the "T" line disappears and the "C" line appears: If within the same detection time, the "T" line of the sample to be tested detection system disappears and the "C" line appears, the sample to be tested contains or is candidate to contain Hantaan virus, otherwise the sample to be tested does not contain or is candidate not to contain Hantaan virus.

[0042] In some embodiments, in step C1), the reaction conditions for the RAA amplification are: react at 42°C for 30 minutes; in step C3)-1, the reaction conditions are: 37°C, read the fluorescence intensity value every 2 minutes, and read 30 times. In step C3)-2, the reaction conditions are: 37°C, react for 30 minutes.

[0043] The eighth technical solution of the present invention is to provide a CRISPR reaction system for detecting Hantaan virus, and the reaction system includes an RT-RAA primer combination for amplifying Hantaan virus, a crRNA for recognizing Hantaan virus, and a CRISPR reaction system.

[0044] The ninth technical solution of the present invention is to provide the application of the above CRISPR reaction system: the application is any one or more of the following d1-d10: d1) Detecting or assisting in detecting Hantaan virus; d2) Preparing a product for detecting or assisting in detecting Hantaan virus; d3) Detecting or assisting in detecting Hantaan virus nucleic acid; d4) Preparing a product for detecting or assisting in detecting Hantaan virus nucleic acid; d5) Detecting or assisting in detecting whether a test sample contains Hantaan virus; d6) Preparing a product for detecting or assisting in detecting whether a test sample contains Hantaan virus; d7) Detecting or assisting in detecting whether a test sample contains Hantaan virus nucleic acid; d8) Preparing a product for detecting or assisting in detecting whether a test sample contains Hantaan virus nucleic acid; d9) Screening or assisting in screening drugs for preventing and treating Hantaan virus; d10) Preparing a product for screening or assisting in screening drugs for preventing and treating Hantaan virus.

[0045] The tenth technical solution of the present invention is to provide an integrated device for detecting Hantaan virus, and the integrated device can implement the reagents of the above reaction system or the above method, and optionally a readable carrier recording the corresponding method.

[0046] Next, according to specific embodiments, the technical solutions of the present invention will be further described. The reagents involved in the following embodiments and their sources are as follows: Recombinase-mediated Strand Displacement Nucleic Acid Amplification (RAA) Kit (Hangzhou Zhongce, S001ZC), NTP Mix (BBI, B600057), RNase Inhibitor (Murine RNase inhibitor, Novoprotein, R301-03), 2×Taq Master Mix (Novoprotein, P111-01), T7 RNA Polymerase (NEB, M0251L), T7 Transcription Kit (T7 Quick HighYield RNA Synthesis kit, NEB, E2050S), Fluorescent Reporter RNA (RNaseAlertTM QC System v2, Thermo Fisher, 4479769), MgCl2 (Thermo Fisher, AM9530G), HEPES (Solarbio, 15630-080), LwaCas13a Protein (GenScript, Z03486), 2×Super PfxMasterMix (Cowin Biotech, CW2965M), Absolute Ethanol (Shanghai Reagent Co., Ltd. of Sinopharm Group, 20210809), Chloroform (Shanghai Reagent Co., Ltd. of Sinopharm Group, 20200908), RNA Clean XP Kit (BECKMANCOULTER, A63987), Tris DNA Extraction Phenol (Sollarbio, T0250), RNase-free ddH2O (Biomed, RA114-02), Test Strip Report RNA (Tianyi Huiyuan, 203130347), CRISPR Detection Test Strip (Hangzhou Zhongce, 211108004).

[0047] Extract the nucleic acids of 10 viruses, namely CHIKV (Chikungunya virus), JEV (Japanese encephalitis virus), TBEV (Tick-borne encephalitis virus), YFV (Yellow fever virus), DENV (Dengue virus), ZIKV (Zika virus), IBV (Influenza B virus), and HAdV4 / 5 / 7 (Human adenovirus types 4 / 5 / 7), respectively.

[0048] Example 1: A Kit and Detection Method for Detecting Hantaan Virus Nucleic Acid Based on the CRISPR-Cas13a System

[0049] (I) Hantaan virus nucleic acid detection kit based on the CRISPR-Cas13a system I. Preparation of crRNA A total of 5 crRNAs were designed in the conserved sequence (SEQ ID NO.3) of Hantaan virus HTNV: HTNV-crRNA1, HTNV-crRNA2, HTNV-crRNA3, HTNV-crRNA4, and HTNV-crRNA5. The target sequences corresponding to each HTNV-crRNA sequence are as follows: The target sequences of HTNV-crRNA1 are as follows: AAGAAAATATCAAAGGACAGAGGCAGAT, located at positions 2683-2710 of the L segment gene of the HTNV genome (GeneID: KU207157.1.1); the target sequences of HTNV-crRNA2 are as follows: TTTATCACAACACTTCCTACTAGATGCA, located at positions 2693-2720 of the L segment gene of the HTNV genome (GeneID: KU207157.1.1); the target sequences of HTNV-crRNA3 are as follows: CATATGGAGGTGAAAAAAAGATTCTTGC, located at positions 2811-2838 of the L segment gene of the HTNV genome (GeneID: KU207157.1.1); the target sequences of HTNV-crRNA4 are as follows: GGGGCACTTGAGAAGGCCTTGAGATGGG, located at positions 2846-2873 of the L segment gene of the HTNV genome (GeneID: KU207157.1.1); the target sequences of HTNV-crRNA5 are as follows: CAGGTGAAAGCTTTATTGAACTTAGTAA(SEQ ID NO.1), located at positions 2877-2904 of the L segment gene of the HTNV genome (GeneID: KU207157.1.1); The synthesis methods of the above-mentioned crRNAs are as follows: 1. Synthesis of primer sequences Synthesize each sequence in Table 1.

[0050] Table 1. Primer sequences

[0051] 2. PCR amplification Dilute the sequences synthesized in step 1 above with ddH2O to 10 μM and prepare a PCR reaction system. The PCR reaction system is prepared as shown in Table 2.

[0052] Table 2. PCR amplification system

[0053] PCR reaction conditions: Heat denaturation at 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 30 s, for a total of 35 cycles; automatic extension at 72°C for 10 min; store the PCR product at 4°C. Five PCR products amplified by the HTNV-gRNA primer pairs shown in Table 1 are obtained.

[0054] 3. Purification of PCR products Purify the 5 kinds of PCR products obtained in step 2 using TrisDNA extraction phenol. The specific steps are as follows: Take 700 μL of TrisDNA extraction phenol, add an equal volume of chloroform, mix well by shaking and then briefly centrifuge and discard the supernatant; Take 600 μL of phenol-chloroform mixture and add it to 200 μL of PCR product, mix well and centrifuge at 12,000 rpm for 10 min; Take the supernatant to a new 1.5 mL centrifuge tube, add absolute ethanol so that the ratio of supernatant to ethanol is 3:7, centrifuge at 12,000 rpm for 10 min and then discard the supernatant; Add 200 μL of 75% ethanol, centrifuge at 12,000 rpm for 10 min and then discard the supernatant (this step is carried out three times in total). Dry the obtained precipitate at room temperature (about 10 min) to obtain 5 kinds of purified PCR products.

[0055] Add the above 5 kinds of purified PCR products to 40 μL of RNase-free water, detect the concentration using a ultra-micro spectrophotometer, and store at -80 °C.

[0056] 4. Transcription Take 1 μg of the aqueous solution of the 5 kinds of purified PCR products obtained in step 3 and transcribe crRNA using the T7 transcription kit (NEB) respectively. The crRNA transcription system is shown in Table 3.

[0057] Table 3. crRNA transcription system

[0058] After mixing the above crRNA transcription system, transcribe at 37 °C for 18 hours.

[0059] Name the crRNA sequences obtained by transcription as HTNV-crRNA1, HTNV-crRNA2, HTNV-crRNA3, HTNV-crRNA4, HTNV-crRNA5. The specific sequence of HTNV-crRNA5 is as follows: GGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACTTACTAAGTTCAATAAAGCTTTCACCTG (SEQ ID NO.2); Among them, the 1st - 38th positions of sequence 2 are the anchor sequences for binding to the Cas13a protein; The 39th - 66th positions of SEQ ID NO.2 are the guide sequences targeting the HTNV target sequence.

[0060] The HTNV-crRNA5 target sequence is as follows: CAGGTGAAAGCTTTATTGAACTTAGTAA (SEQ ID NO.1), located at positions 2877 - 2904 of the HTNV genome (GeneID: KU207157.1.1). The prepared HTNV-crRNA5 is used for subsequent CRISPR-Cas13a detection.

[0061] 5. crRNA Purification The specific steps are as follows: Vortex and mix the magnetic beads (RNA Clean XP). Add 36 μL of magnetic beads and 100 μL of isopropanol to 20 μL of the transcription product. Pipette 10 times to mix the magnetic beads and the transcription system, and let it stand at room temperature for 10 min. Place the reaction system on a magnetic stand and let it stand for 10 min to separate the magnetic beads. Gently aspirate the liquid in the system, avoiding aspirating the magnetic beads. Add 200 μL of 70% ethanol (prepared with RNase-free ddH2O) to the magnetic beads, incubate at room temperature for 30 s, and aspirate the ethanol; repeat this process to wash the magnetic beads, for a total of 3 times. Air-dry the system at room temperature to remove the ethanol in the system, about 10 min. Add 30 μL of RNase-free ddH2O, pipette 10 times, let it stand for 5 min, then place it on the magnetic stand until the system is clear, aspirate the supernatant, transfer it to a 1.5 mL centrifuge tube, and use a ultra-micro spectrophotometer to measure the concentration of the purified crRNA and dilute it to 100 ng / μL respectively, and store it in aliquots at -80 °C for later use.

[0062] The above crRNA sequence is used for the following CRISPR-Cas13a detection of Hantaan virus.

[0063] II. Preparation of Plasmid Standard 1. Plasmid Sequence Plasmid-HTNV is a recombinant plasmid obtained by inserting the following sequence from the Hantaan virus genome: TATGAGGAGACAAGAGAGCAGAAAGCAATGGCAAGAATTGTAAGAAAATATCAAAGGACAGAGGCAGATAGGGGCTTTTTTATCACAACACTTCCTACTAGATGCAGGCTTGAAATTATTGAGGACTACTATGATGCCATTGCCAAGAATATTTCTGAAGAATACATATCATATGGAGGTGAAAAAAAGATTCTTGCAATCCAAGGGGCACTTGAGAAGGCCTTGAGATGGGCATCAGGTGAAAGCTTTATTGAACTTAGTAATCACAAATTTATTAGGATGAAACGTAAACTCATGTATGTTAGTGCAGATGCTACAAAGTGGTCACCAGG (SEQ ID NO.3) into the pUC57 vector (Beijing Tianyi Huiyuan Company).

[0064] Beijing Tianyi Huiyuan Company extracts 5 μg of the recombinant plasmid.

[0065] According to the formula: copies / μL = 6.02×10 23× (ng / μL) × 10 -9 / (DNA Length × 660). Dilute the above 5 μg of recombinant plasmid with 200 μL of water to obtain plasmid Plasmid-HTNV with a copy number of 1.53 × 10 10 copies / μL.

[0066] 2. Dilution Gradually dilute the above plasmid by a factor of 10 in concentration to obtain plasmid standards with different concentrations.

[0067] III. Design of RAA Amplification Primers and Obtaining of RAA Amplification Products 1. Design of RAA Amplification Primers Design HTNV Virus-specific RAA primers for CRISPR detection according to the primers in the reference (PMID: 27246147). There is a T7 transcription sequence (AATTCTAATACGACTCACTATAGGG) at the 5' end of the primers, so that the double-stranded DNA (dsDNA) obtained by RAA amplification can be recognized by T7 RNA polymerase and transcribed. The primer sequences are shown in Table 4 and are synthesized by Beijing Tianyi Huiyuan Company.

[0068] Table 4. HTNV-RAA Amplification Primers

[0069] 2. Obtaining of RAA Amplification Products Use the plasmid standard as a template and perform RAA amplification with the primers designed in step 1 to obtain RAA amplification products. The RAA amplification system is shown in Table 5.

[0070] Table 5. RAA Amplification System

[0071] Add the well-mixed 47.5 μL solution to the basic reaction unit containing the lyophilized powder to fully redissolve and homogenize the lyophilized powder. Add 2.5 μL of B Buffer (a component in the RAA amplification kit) to the cap of each reaction tube, close the tube cap and centrifuge briefly to collect and mix evenly. Place the above reaction tubes in a 42 °C water bath for 30 minutes to obtain RAA amplification products.

[0072] (II) Method for Detecting Hantaan Virus Nucleic Acid Based on CRISPR-Cas13a System I. Preparation of Plasmid PCR + CRISPR-Cas13a Fluorescence Detection System 1. According to the PCR primer design principles and the reference (PMID: 32160714), the upstream and downstream primers for plasmid PCR were designed. At the same time, the T7 promoter sequence (AATTCTAATACGACTCACTATAGGG) was introduced at the 5′ end of the upstream primer for subsequent transcription. Upstream primer: The sequence of HTNV-PCR-F is AATTCTAATACGACTCACTATAGGGGCAGAAAGCAATGGCAAGAATT (where 1-25 are the T7 promoter sequence). The downstream primer HTNV-PCR-R sequence is TGCACTAACATACATGAGTTTACGT. The upstream and downstream primers were synthesized by Beijing Tianyi Huiyuan Company.

[0073] 2. Obtaining the plasmid PCR product The synthesized sequence in step 1 above was diluted to 10 μM with ddH2O, and the plasmid PCR reaction system was prepared according to Table 6 Table 6. Plasmid PCR system

[0074] Plasmid PCR reaction conditions: Heat denaturation at 95°C for 3 min; 95°C for 15 s, 60°C for 15 s, 72°C for 20 s, for a total of 35 cycles; Automatic extension at 72°C for 5 min; Store the PCR product at 4°C.

[0075] 3. Take 5 μL of the plasmid PCR amplification product obtained above as a template, and prepare the CRISPR-Cas13a detection system according to Table 7 below.

[0076] Table 7. CRISPR-Cas13a fluorescence detection system

[0077] The PCR tube containing the reaction system shown in Table 7 above in part one was placed in a fluorescence quantitative PCR instrument, and the channel excitation light wavelength was set to 490 nm, the emission light wavelength was 520 nm, at 37°C, and the value was read every 2 min for 30 times for a total of 60 minutes to detect the change in fluorescence intensity in the detection system.

[0078] Result determination: If within the same detection time, the mean fluorescence intensity value of the test sample detection system has a significant statistical difference compared to the mean fluorescence intensity value of the negative control (ddH2O), then the test sample contains or is a candidate for containing Hantaan virus; otherwise, the test sample does not contain or is not a candidate for containing Hantaan virus. II. Preparation of the RAA + CRISPR-Cas13a fluorescence detection system The nucleic acid of the test sample was amplified by RAA using the primers HTNV-RAA-F3 and HTNV-RAA-R3 in 1 of part (I) above to obtain the RAA amplification product. Take 5 μL of the RAA amplification product obtained above as a template, and prepare the CRISPR-Cas13a detection system according to Table 8 below.

[0079] Replace the RAA product in Table 8 with ddH2O, and keep other reagent components unchanged, which is the negative control.

[0080] Table 8. CRISPR-Cas13a fluorescence detection system

[0081] Put the PCR tube containing the reaction system shown in Table 8 above into a fluorescence quantitative PCR instrument, set the excitation light wavelength of the channel to 490 nm, the emission light wavelength to 520 nm, at 37 °C, read the value once every 2 minutes, read 30 times for a total of 60 minutes, and detect the change in fluorescence intensity in the detection system.

[0082] Result determination: If there is a significant statistical difference between the mean fluorescence intensity value of the test sample detection system and the mean fluorescence intensity value of the negative control (ddH2O) within the same detection time, the test sample contains or is a candidate for containing Hantaan virus; otherwise, the test sample does not contain or is a candidate for not containing Hantaan virus. III. Preparation of the CRISPR-Cas13a test strip detection system Use the primers HTNV-RAA-F3 and HTNV-RAA-R3 in 1 of (1) above to perform RAA amplification on the nucleic acid of the test sample to obtain the RAA amplification product. Take 5 μL of the RAA amplification product obtained above as a template, and prepare the CRISPR-Cas13a detection system according to Table 9 below.

[0083] Replace the RAA product in Table 9 with ddH2O, and keep other reagent components unchanged, which is the negative control.

[0084] Table 9. CRISPR-Cas13a test strip detection system

[0085] Cover the reaction tube containing the reaction system shown in Table 9, invert it 5 - 6 times to mix well, and centrifuge at low speed for 10 seconds. Place the above reaction tube at 37 °C for 30 minutes. After the reaction is completed, add the entire reaction system (50 μL) to the sample addition hole of the CRISPR test strip.

[0086] Result determination: Interpretation is performed 2 - 5 minutes after the detection reaction system is dropped on the test strip. If there is no "T" line and there is a "C" line on the test strip, the sample to be tested contains or is suspected to contain Hantaan virus; if there is a "T" line and a "C" line on the test strip, the sample to be tested does not contain or is suspected not to contain Hantaan virus; if there is no "C" line on the test strip, the test strip is invalid and needs to be replaced for a new experiment.

[0087] (III) Condition optimization of the method for detecting Hantaan virus nucleic acid based on the CRISPR-Cas13a system I. Screening of the optimal RAA primers and the optimal crRNA 1. Using the plasmid standard product with a diluted concentration of 10 2 copies / μL prepared in (I) (II) as a template, perform plasmid PCR amplification using the method in Table 6 of (II) (I) 2, to obtain plasmid PCR amplification products.

[0088] Take 5 μL of the product after the above plasmid PCR amplification, perform fluorescence detection using the method in Table 7 of (II) (I) 3 and the 5 kinds of crRNA prepared in (I) (I), and the results are as Figure 1 ., Figure 2 shown.

[0089] Figure 1 shown: The fluorescence increase rate of crRNA5 is the fastest, reaching the plateau at about 30 min, and the fluorescence value is the highest.

[0090] Figure 2 shown: After 60 min, all 5 groups of crRNA are significantly different from the negative control group. Among them, the fluorescence value of crRNA5 is (35404.12 ± 2310.29) RFU, which is better than the fluorescence value of crRNA1 (13440.02 ± 2432.09) RFU, the fluorescence value of crRNA2 (7748.44 ± 278.11) RFU, the fluorescence value of crRNA3 (29321.43 ± 2122.32) RFU, and the fluorescence value of crRNA4 (28348.44 ± 1644.28) RFU. Select crRNA5 as the initially screened crRNA for the next experiment.

[0091] 2. Using the plasmid standard product with a diluted concentration of 10 2 copies / μL prepared in (I) (II) as a template, combine the RAA upstream and downstream primers in pairs (F1R1, F1R2, F1R3, F2R1, F2R2, F2R3, F3R1, F3R2, F3R3), and perform amplification according to the method in Table 5 of (I) (III) 2.

[0092] Take 5 μL of the above amplified product and perform fluorescence detection according to the method in Table 8 of (II) (II), with crRNA being HTNV-crRNA5, and the results are asFigure 3 as shown

[0093] Figure 3 Shown: In the three repeated experiments, the F3R3 fluorescence values were high in the first, second, and third times. Considering the results of the 3 times, F3R3 was selected as the RAA primer for primary screening for the next experiment.

[0094] 3. Using the plasmid standard product with a diluted concentration of 10 2 copies / μL prepared in (2) of (1) as the template, and performing amplification with the primary screening RAA primer F3R3 according to the method in Table 5 of (3) in (1).

[0095] Taking 5 μL of the above amplified product and the 5 kinds of crRNAs prepared in (1) of (1), performing fluorescence detection according to the method in Table 8 of (2) in (2), and the results are as Figure 4 and Figure 5 shown.

[0096] Figure 4 Shown: The fluorescence rising rate of crRNA5 is the fastest and the fluorescence value is the highest.

[0097] Figure 5 Shown: Comparing the fluorescence values at the 60th minute, the fluorescence value of crRNA1 is (7532.02 ± 67.63) RFU, the fluorescence value of crRNA2 is (4269.22 ± 65.88) RFU, the fluorescence value of crRNA3 is (11172.83 ± 1564.98) RFU, the fluorescence value of crRNA4 is (4886.00 ± 477.81) RFU, and the fluorescence value of crRNA5 is (22546.66 ± 1033.98) RFU. The fluorescence value of crRNA5 is higher than that of the other 4 groups of crRNAs and the negative control group, and there are significant differences. CrRNA5 was selected as the optimal crRNA for the next experiment.

[0098] Example 2: Sensitivity Detection of Detecting Hantaan Virus Nucleic Acid Based on the CRISPR-Cas13a System

[0099] Using the gradient-diluted plasmid standard product as the template, detecting plasmids containing HTNV gene fragments at different concentrations according to the method in Example 1 to detect the sensitivity of the method of the present invention. The specific steps are as follows: 1. Gradient-diluting the plasmid standard product obtained in step (2) of step (1) of Example 1 with water to obtain plasmid solutions containing HTNV gene fragments at different concentrations: 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL, 10 -1 copies / μL.

[0100] 2. Perform RAA amplification according to the method in item (i) of Example 1, with primers HTNV-RAA-F3 and HTNV-RAA-R3 (optimal primers), to obtain the RAA amplification product.

[0101] 3. CRISPR fluorescence detection: Take 5 μL of the RAA amplification product and detect the nucleic acid of Hantaan virus based on the CRISPR-Cas13a fluorescence system according to the method in item (ii) of Example 1, while setting the amplification product with water as the template as the negative control. The crRNA is HTNV-crRNA4 (optimal crRNA). The CRISPR-Cas13a detection results are as Figure 6 、 Figure 7 shown.

[0102] Figure 6 Shown: The curve graph of the CRISPR-Cas13a detection of different concentrations of HTNV conserved sequences with the optimal RAA primer combination and the optimal crRNA.

[0103] Figure 7 Shown: Comparing the fluorescence values at the 60th minute, 10 3 -10 0 copies / μL compared with the negative control, there are significant statistical differences in fluorescence intensity. The results show that the sensitivity of the CRISPR-Cas13a detection system involved in the present invention for detecting HTNV nucleic acid reaches 1 copy (1 copies / μL).

[0104] 4. CRISPR test strip detection Gradiently dilute the plasmid standard obtained in item (ii) of Example 1 with water to obtain plasmid solutions containing different concentrations of HTNV gene fragments: 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL, 10 -1 copies / μL.

[0105] Perform RAA amplification according to the method in item (i) of Example 1, with primers HTNV-RAA-F3 and HTNV-RAA-R3 (optimal primers), to obtain the RAA amplification product.

[0106] Take 5 μL of the RAA amplification product and detect HTNV nucleic acid based on the CRISPR-Cas13a system according to the method in item 3 of step (ii) in Example 1. At the same time, set the amplification product with ddH2O as the template as the negative control. The crRNA is HTNV-crRNA4. The RAA-CRISPR test strip detection results are as Figure 8 , Figure 9 shown.

[0107] Figure 8 shown: When detecting HTNV nucleic acid with HTNV-crRNA4, at 10 3 -10 0 copies / μL group, the "T" line disappeared and the "C" line appeared. At 10 -1 copies / μL and the negative control group, both the "T" line and the "C" line appeared. Therefore, it was determined that the 10 3 -10 0 copies / μL group was positive, and the 10 -1 copies / μL and the negative control group were negative. Figure 9 shown: For the 10 3 -10 0 copies / μL group in three repeated experiments, the gray value of the "T" line was 0 in all cases. For the 10 -1 copies / μL and the negative control group in three repeated experiments, the gray value of the "T" line was greater than 0 in all cases. Combining Figure 8 and Figure 9 the results, the sensitivity of the RAA-CRISPR test strip for detecting HTNV nucleic acid reached 1 copy (1 copy / μL).

[0108] Example 3: Specificity Detection of Detecting Hantaan Virus Nucleic Acid Based on the CRISPR-Cas13a System Using 10 viruses including CHIKV (Chikungunya virus), JEV (Japanese encephalitis virus), TBEV (Tick-borne encephalitis virus), YFV (Yellow fever virus), DENV (Dengue virus), ZIKV (Zika virus), IBV (Influenza B virus), and HAdV4 / 5 / 7 (Human adenovirus types 4 / 5 / 7), detect the nucleic acids of different viruses according to the method in Example 1 (ii) to verify the specificity of the method of the present invention. The specific steps are as follows: 1. Respectively use 10 3 copies / μL of the nucleic acids of 10 viruses including CHIKV (Chikungunya virus), JEV (Japanese encephalitis virus), TBEV (Tick-borne encephalitis virus), YFV (Yellow fever virus), DENV (Dengue virus), ZIKV (Zika virus), IBV (Influenza B virus), and HAdV4 / 5 / 7 (Human adenovirus types 4 / 5 / 7) and 10 3HTNV plasmid at copies / μL was used as the detection template, and RAA amplification was performed according to the method in item (1) of step (1) of Example 1 to obtain the RAA amplification product. Primers HTNV-RAA-F3 and HTNV-RAA-R3.

[0109] 2. Take 5 μL of the RAA amplification product and detect HTNV nucleic acid based on the CRISPR-Cas13a system according to the method in item (3) of step (2) of Example 1. At the same time, set the amplification product with ddH2O as the template as the negative control. The crRNA is HTNV-crRNA5. The CRISPR-Cas13a detection results are as Figure 10 and Figure 11 shown Figure 10 shown: When detecting different viral nucleic acids with HTNV-crRNA5, only the "T" line disappeared and the "C" line appeared in the HTNV group, while the "T" line and the "C" line appeared in other groups and the negative control group.

[0110] Figure 11 shown: Three repeated experiments were carried out. The gray value of the "T" line in the HTNV group was 0, and the gray value of the "T" line in other groups and the negative control group was greater than 0. Combining Figure 10 and Figure 11 the results, the method for detecting the Hantaan virus site based on the CRISPR-Cas13a system of the present invention has high specificity and no cross-reaction occurs during the detection process.

[0111] The above is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the technical principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

[0112] The present invention has been described in detail above; for those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. According to the principle of the present invention, this application intends to cover any changes, uses or improvements to the present invention, including those that depart from the scope disclosed in this application and are made with conventional techniques known in the art. According to the scope of the following appended claims, some basic features can be applied.

Claims

1. A crRNA target for detecting Hantaan virus, characterized in that, The Hantaan virus target sequence is SEQ ID NO.

1.

2. A CRISPR-Cas13a system for detecting Hantaan virus, characterized in that, The CRISPR-Cas13a system includes a Cas13a protein and a crRNA, or a complex formed by the two; the crRNA includes an anchoring sequence for binding to the Cas13a protein and a guiding sequence targeting the Hantaan virus target sequence; the Hantaan virus target sequence of the CRISPR-Cas13a system for detecting the Hantaan virus is as shown in SEQ ID NO.

1.

3. The CRISPR-Cas13a system for detecting Hantaan virus according to claim 2, characterized in that: The crRNA sequence is as shown in SEQ ID NO.

2.

4. The CRISPR-Cas13a system for detecting Hantaan virus according to claim 2 or 3, characterized in that: The Cas13a protein is the LwCas13a protein.

5. A kit for detecting the Hantaan virus, which includes the CRISPR-Cas13a system for detecting the Hantaan virus according to any one of claims 2-4.

6. The kit according to claim 5, wherein: The kit further includes RAA amplification primers for specifically amplifying the Hantaan virus target sequence; the RAA amplification primers are composed of a single-stranded DNA molecule shown in SEQ ID NO.4 and a single-stranded DNA molecule shown in SEQ ID NO.

5.

7. Any of the following substances: A1) The crRNA described in any one of claims 2-4; A2) The Cas13a protein and the crRNA described in any one of claims 2-4, or a complex formed by the two; A3) The primer combination described in claim 6.

8. Any of the following applications: B1) The application of the CRISPR-Cas13a system described in any one of claims 2-4, or the kit described in claim 5 or claim 6, or the substance described in claim 7 in detecting or assisting in detecting the Hantaan virus or its nucleic acid; B2) The application of the CRISPR-Cas13a system described in any one of claims 2-4, or the kit described in claim 5 or claim 6, or the substance described in claim 7 in preparing a product for detecting or assisting in detecting the Hantaan virus or its nucleic acid; B3) The application of the CRISPR-Cas13a system described in any one of claims 2-4, or the kit described in claim 5 or claim 6, or the substance described in claim 7 in detecting or assisting in detecting whether the test sample contains the Hantaan virus or its nucleic acid; B4) The application of the CRISPR-Cas13a system described in any one of claims 2-4, or the kit described in claim 5 or claim 6, or the substance described in claim 7 in preparing a product for detecting or assisting in detecting whether the test sample contains the Hantaan virus or its nucleic acid; B5) The application of the CRISPR-Cas13a system described in any one of claims 2-4, or the kit described in claim 5 or claim 6, or the substance described in claim 7 in screening or assisting in screening drugs for preventing and treating the Hantaan virus; B6) The application of the CRISPR-Cas13a system described in any one of claims 2-4, or the kit described in claim 5 or claim 6, or the substance described in claim 7 in preparing a product for screening or assisting in screening drugs for preventing and treating the Hantaan virus; Use of the substance according to claim 7 in the preparation of the kit according to claim 5 or claim 6.

9. A method for detecting or assisting in the detection of Hantaan virus, comprising the following steps: C1) Using the nucleic acid of the sample to be tested as a template, performing RAA amplification with a primer pair composed of the single-stranded DNA molecule shown in SEQ ID NO.4 and the single-stranded DNA molecule shown in SEQ ID NO.5 to obtain an RAA product; C2) Preparing a CRISPR-Cas13a detection system containing the following components: the RAA product, the Cas13a protein described in any one of claims 2-4, the crRNA described in any one of claims 2-4, a fluorescent reporter RNA, NTP, T7 RNA polymerase, and an RNA enzyme inhibitor; simultaneously using water to replace the PCR product as a negative control; C3) Detecting the reaction product through the reaction of the CRISPR-Cas13a detection system, thereby determining whether the sample to be tested contains Hantaan virus.

10. The method according to claim 9, wherein: In step C1), the reaction conditions for the RAA amplification are: reacting at a temperature of 42 °C for 30 minutes.

Images