Seamless cloning process with static recovery phase

Abstract

The present invention relates to a seamless cloning method comprising a single step of assembling two or more polynucleotides (e.g., plasmid vectors and gene insertion fragments) carried out at 58 to 100 DEG C, the preferred temperature is equal to or higher than a particular one of the following temperatures: 58 DEG C, 59 DEG C, 60 DEG C, 61 DEG C, 62 DEG C, 63 DEG C, 64 DEG C, 65 DEG C, 66 DEG C, 67 DEG C, 68 DEG C, 69 DEG C, 70 DEG C, 71 DEG C, 72 DEG C, 73 DEG C, 74 DEG C, 75 DEG C, 76 DEG C, 77 DEG C, 78 DEG C, 79 DEG C, 80 DEG C, 84 DEG C, 88 DEG C, 92 DEG C, 96 DEG C and 100 DEG C, and converting the assembled product to a chemically competent cell for covalent ligation, preferably including a static recovery phase.

Description

Background Art

[0001] Seamless cloning is a recombinant molecular biology technique that can insert one or more DNA fragments into a vector without relying on specific sequences and without leaving any extra traces. The Gibson Assembly (GA) method exemplifies this approach, which enables the direct combination of up to 10 DNA fragments. This method relies on the incorporation of homologous regions at the ends of the fragments to be cloned. Subsequently, the concerted action of an exonuclease that trims the 5' end to form a 3' compatible overhang, a DNA polymerase that fills the gaps in the annealed fragments, and a DNA ligase that seals the gaps in the assembled DNA facilitates the generation of recombinant DNA.

[0002] Multiple sequence homology-based seamless DNA assembly methods / kits are commercially available or described in the literature (see References 1 - 39 below). Table 1 summarizes these sequence homology-based seamless ligase-independent DNA assembly methods in alphabetical order, including information such as method name, reference, reaction temperature, reaction time, vector usage, and inactivation temperature (if any), covering both commercially available kits and / or literature-reported protocols (regardless of whether there are commercial products).

[0003] Table 1: Comparison of Seamless Cloning Methods Based on Homologous Sequences

[0004]

[0005]

[0006]

[0007]

[0008] As can be seen from Table 1, although there are many variants of molecular cloning methods, for methods that use only a single reaction step, the temperature of the assembly reaction does not exceed 50°C. There are a total of four cases where the inactivation temperature is set at 75°C, but this temperature is always significantly higher than the actual reaction temperature. DATEL and Simplified DATEL are exceptions because they require multiple steps, although they do not differ much from single-step processes in other aspects; in addition to requiring different PCR instrument operation procedures and having the longest actual reaction time (Table 1), totaling 111.5 minutes.

[0009] Some of the described methods are in vitro recombination systems that assemble and repair overlapping DNA molecules in a single isothermal step. In most of the methods that implement a single reaction step, the temperature at which single-stranded DNA of the homologous region is generated is about 50 °C. Most of the available methods require a minimum of 20 ng of plasmid vector to obtain targeted colonies of 100 transformed bacterial colonies. Therefore, the amount of plasmid vector required in the existing methods is quite high.

[0010] Transformation of competent cells with a plasmid vector containing a gene insert can be mediated by using cations (such as Ca 2+ ) and low temperature. The efficiency of competent cells depends on several factors, including ion concentration and type, treatment time, heat shock, and incubation time. When transforming the vector into chemically competent Escherichia coli, an Escherichia coli (E.Coli) bacterium selected for drug resistance with ampicillin, most commercially available cell transformation procedures allow direct plating on an agar plate containing ampicillin. Ampicillin hinders the formation of the cell wall but does not rapidly kill the cells, giving the bacterium Escherichia coli enough time to synthesize the ampicillin resistance enzyme to prevent the destruction of ampicillin in the plate. The enzyme secreted in the culture medium causes the degradation of ampicillin, allowing even cells lacking the ampicillin resistance gene to grow. In liquid medium, the secretion of the ampicillin resistance enzyme reduces the drug resistance pressure, reducing the plasmid content and relative protein production. Therefore, using ampicillin as a selectable marker may result in transformed cells with a low plasmid content.

[0011] In contrast, the use of antibiotics such as kanamycin, chloramphenicol, tetracycline, or other antibiotics that inhibit protein synthesis will retain the original colonies without producing satellite colonies because the resistance enzymes are not secreted. Since drug resistance is not immediately generated after heat shock, a recovery period is usually required. The recovery of competent cells includes adding 4 to 9 times the volume of SOC medium or other recovery medium after heat shock at 42 °C, shaking at 37 °C (200 to 300 rpm) for 1 hour, and then centrifuging all cells before resuspending in a smaller volume for plating. Various methods known in the art require a minimum of 5 minutes to 111.5 minutes (DATEL and simplified DATEL) as the recovery / reaction time of competent cells. Although the SOC medium addition and shaking steps are not time-consuming for some samples, they will significantly reduce the practical efficiency in high-throughput transformation.

[0012] Therefore, there is an urgent need to develop a method that can eliminate the transformation recovery period of competent cells after they take up a plasmid vector carrying an exogenous gene insert, thereby significantly shortening the time required for this technical process. In addition, the method should also have the following characteristics: faster operation, simpler process requirements, high transformation efficiency, and be able to adapt to existing PCR instruments in terms of system and process parameter requirements. Summary of the Invention

[0013] This section provides an overview of the present disclosure, rather than a full disclosure of its entire scope or all of its features.

[0014] Accordingly, the present invention relates to a seamless cloning method, including a single assembly step (including annealing) of two or more polynucleotides, wherein one is preferably a plasmid vector and the other is a gene insert, which is carried out between 58 °C and 100 °C, and preferably the temperature is equal to or greater than one of the following temperatures: 58 °C, 59 °C, 60 °C, 61 °C, 62 °C, 63 °C, 64 °C, 65 °C, 66 °C, 67 °C, 68 °C, 69 °C, 70 °C, 71 °C, 72 °C, 73 °C, 74 °C, 75 °C, 76 °C, 77 °C, 78 °C, 79 °C, 80 °C, 84 °C, 88 °C, 92 °C, 96 °C and 100 °C, and transforming the assembled product into chemically competent cells for covalent ligation, preferably including a static recovery period. Preferably, the cells in the static recovery period are incubated at 0 °C to 37 °C for 15 minutes and then cooled to 0 - 4 °C. The competent cells include DH10BC and DH10B and any other cells capable of replicating the plasmid.

[0015] In another embodiment, the concentration range of the plasmid vector is 0.07 - 3 ng / kb plasmid vector, and the concentration range of the gene insert is 0.014 - 9 ng / kb gene insert.

[0016] In another embodiment, the length of the homologous base pairs at the 3'- and 5'-ends of the plasmid vector and the gene insert is 10 - 40 base pairs, and the melting temperature (T m ) of the annealed plasmid and the two ends of the gene insert is in the range of 30 - 50 °C.

[0017] In another embodiment, the plasmid vector contains a selectable marker gene, which confers resistance to antibiotics that inhibit protein synthesis. The antibiotics include but are not limited to kanamycin, chloramphenicol, tetracycline and similar compounds, and preferably do not include the ampicillin resistance gene.

[0018] From the following detailed description, other aspects and advantages of the present invention will become apparent to those skilled in the art, where only illustrative embodiments of the present invention are shown and described. The present disclosure can be implemented in other different forms, and various obvious modifications can be made to several details without departing from the spirit of the present disclosure. Therefore, the description and examples in the present invention content are only for illustrative purposes and are not intended to limit the scope of the present disclosure. Detailed Description

[0019] With reference to the non-limiting embodiments shown in the accompanying drawings and the following description, the embodiments herein and their various features and advantageous details are more fully explained. Without departing from the present invention, many variations, changes, and substitutions can be envisioned by those skilled in the art. It should be understood that various alternatives of the embodiments of the present disclosure can be employed.

[0020] First, for ease of reference, certain terms used in this application and their meanings as used in the context are set forth. To the extent that the terms used herein are not defined below, the broadest definition given to the term by those skilled in the relevant art should be given, as reflected in at least one printed publication or an issued patent. Additionally, the present technology is not limited by the use of the terms shown below, as all equivalents, synonyms, new developments, and terms or techniques serving the same or similar purposes are considered to be within the scope of the present claims.

[0021] When applied to any feature in the embodiments of the present invention described in the specification and claims, the articles "a" and "an" used herein mean one or more. The use of "a" and "an" does not limit the meaning to a single feature unless such a limitation is specifically stated. The article "the" preceding a singular or plural noun or noun phrase refers to a specific designated feature or specific designated features and can have a singular or plural meaning depending on the context in which it is used. The adjective "any" indiscriminately means one, some, or all amounts.

[0022] The term "seamless cloning method" is defined as the insertion of one or more DNA fragments into a plasmid vector without sequence dependence and without a trace. This method typically utilizes polymerase chain reaction (PCR) to amplify the gene of interest, digests / removes the single-stranded ends of the insert and the vector by exonuclease, and covalently links the insert to the vector through a true phosphodiester bond by means of a ligase / recombination event or an in vivo repair system.

[0023] The term "Tm" (melting temperature) is defined as the temperature at which a DNA double helix undergoes denaturation and separates into individual DNA strands.

[0024] The term "transformation" refers to the uptake of a plasmid vector containing a gene insert by competent cells.

[0025] The term "unidirectional exonuclease" is defined as an enzyme having exonuclease activity in the direction from the 5'-primer to the 3'-primer or from the 3'-primer to the 5'-primer.

[0026] Accordingly, the present invention in one aspect relates to a seamless cloning method, comprising a single reaction step of a plasmid vector and a gene insert carried out between 58 °C and 100 °C, but preferably at 67 °C; and a transformation step of chemically competent cells having a static recovery period.

[0027] In one embodiment of the present invention, a single reaction step includes generating a single-stranded overhang region of a gene insert capable of annealing, and generating a linearized vector, wherein the overhangs of the plasmid vector and the gene insert are each capable of hybridizing to anneal the linearized vector and the gene insert having the single-stranded overhang region.

[0028] In one embodiment of the present invention, the generation of the single-stranded overhang region of the gene insert is carried out by a unidirectional 3' to 5' or 5' to 3' exonuclease.

[0029] In another embodiment, the present invention relates to the static recovery period of transformed competent cells, such that the cells are incubated at 0°C to 37°C for 15 minutes and then cooled to 0 - 4°C. The competent cells include DH10BC and DH10B.

[0030] In another embodiment, the concentration range of the plasmid vector is 0.07 - 3 ng / kb plasmid vector, and the concentration range of the gene insert is 0.014 - 9 ng / kb gene insert.

[0031] In another embodiment, the length of the homologous base pairs at the 3'- and 5'-ends of the plasmid vector and the gene insert is 10 - 40 base pairs, and the melting temperature (Tm) for annealing the plasmid and the gene insert at both ends is in the range of 30 - 50°C.

[0032] In another embodiment, the plasmid vector contains a selectable marker gene that confers resistance to antibiotics that inhibit protein synthesis. The antibiotics include but are not limited to kanamycin, chloramphenicol, tetracycline, and similar compounds.

[0033] In one embodiment, the single-step reaction of the plasmid vector is carried out by ligation-independent cloning (LIC), type II restriction enzyme cloning, Gibson assembly method, etc.

[0034] In another embodiment, seamless cloning is carried out by ligation-independent cloning (LIC), amplifying one or more target genes / DNA molecules by polymerase chain reaction (PCR) using forward and reverse primers to generate single-stranded end regions, annealing the DNA fragments with the linearized vector, and transforming competent cells with the annealed vector.

[0035] In one embodiment, seamless cloning is performed by a type II restriction endonuclease, such that a plasmid vector and a gene insert are contacted with two or more nucleic acid molecules, each nucleic acid molecule comprising a restriction enzyme recognition site. Subsequently, the plasmid vector and the gene insert are contacted with the restriction enzyme to generate overhanging ends, and the fragments of the plasmid vector and the gene insert are excised to produce the plasmid vector and the gene insert, wherein the overhanging ends of the plasmid vector and the gene insert are capable of hybridizing. Subsequently, hybridization of the overhanging ends and covalent ligation of the digested nucleic acid molecules to the digested nucleic acid molecule vector are performed to form a recombinant nucleic acid molecule.

[0036] In one embodiment, primers with overlapping sequences are designed and used to amplify the desired insert between adjacent DNA fragments by PCR for assembling them into a cloning vector. Exonuclease is added to generate single-stranded 3' overhanging ends, which helps the annealing of fragments sharing complementarity in the overlapping regions. DNA polymerase is added to fill the gaps within each annealed fragment, and DNA ligase is added to seal the gaps in the assembled DNA. The reaction is incubated at 50 °C for the reaction. Then the obtained vector carrying the target gene is transformed into competent cells.

[0037] The advantages of this method include:

[0038] 1. This method can be carried out in existing PCR instruments without special infrastructure and hardware requirements.

[0039] 2. The concentrations of the plasmid vector and the gene insert are very low; for example, the plasmid vector is 0.07 - 3 ng / kb, and the gene insert is 0.014 - 9 ng / kb.

[0040] 3. In this method, the requirements for the recovery period after transformation of competent cells are significantly reduced.

[0041] 4. This method is suitable for high-throughput processing.

[0042] Examples

[0043] Example 1

[0044] Comparison of reaction temperature

[0045] A linearized vector named 3701bp pKBXInH5 is used, which has a kanamycin resistance selection marker with a 12bp homologous region: CAGTCTGGCGGA (SEQ ID NO7:)... TGATAGTCGGCT (SEQ ID NO:8), and the 12bp homologous region is underlined in SEQ ID NO:1, which shows the full sequence of the linearized vector.

[0046] Complete sequence of linearized pKBXInH5 of SEQ ID NO:1

[0047] CAGTCTGGCGGA xxxxxxxxxxxx TGATAGTCGGCT

[0048] The inserted fragment (xxxxxxxxxxxx) in SEQ ID NO:1 is a 741bp enhanced green fluorescent protein (eGFP) gene fragment, which has the same homologous region as described above genetically, CAGTCTGGCGGA (SEQ ID NO:7)……TGATAGTCGGCT (SEQ ID NO:8). The inserted fragment is a gene fragment without adapters. All gene fragments in this application were synthesized by Twist Bioscience Corporation in California, USA. The complete sequence of the inserted fragment is shown in SEQ ID NO:2:

[0049] SEQ ID NO:2: Insertion sequence of eGFP

[0050] CAGTCTGGCGGAATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG TGATAGTCGGCT

[0051] Briefly, the reaction comparison procedure is as follows: Mix 1 μl of 11.1 ng / μl linearized pKBInH5 (3 ng per 1 kb vector), 1 μl of 6.67 ng / μl eGFP fragment (9 ng per 1 kb insert), and 1 μl of 3x ZY Cloning Premix Reagent (ZyCloning, Woburn, MA, USA). The PCR instrument (T100, Biorad) is set at 4°C indefinitely. After reaching the temperature of 4°C, the PCR tube containing the reaction mixture is loaded into the instrument. As shown in Table 2, the 4°C setpoint is reset to a higher reaction temperature for 30 seconds, then reset to 4°C and maintained indefinitely. 50 μl of competent cells DH10BC (ZyCloning, Woburn, MA, USA) is added to the reaction mixture, and the temperature is reset to 42°C again to heat shock the sample for 1 minute. The sample is kept at 4°C for 15 minutes and then stored long-term at 4°C. Then all the transformed mixtures are plated on agar plates containing kanamycin (50 μg / ml) and incubated overnight at 37°C. The results are shown in Table 1.

[0052] Table 1: Comparison of reaction temperatures

[0053]

[0054] The results show that the number of colonies changes at reaction temperatures below 57°C. However, once the reaction time is maintained at 58°C and above, the number of colonies increases significantly. As the reaction temperature rises to 100°C, an increase in the number of colonies is observed. In theory, double-stranded DNA begins to denature at temperatures above 90°C. However, the PCR instrument has a function of controlling the heating and cooling rate, and its temperature transition time is sufficient to ensure full progress of the reaction. When compared with other currently available cloning methods using a single reaction step, this high reaction temperature used in the present invention is novel and creative.

[0055] After multiple rounds of comparison and standardization, 67°C is selected as the standard reaction temperature. The results show that there is no obvious reaction when the temperature is below 50°C. In addition, no obvious difference is observed when the reaction is carried out at room temperature. Moreover, it is observed that the order of adding the sample, vector, insert, and 3x ZY Cloning Premix Reagent is not important because most of the reaction occurs at high temperatures.

[0056] In this example, as described above, 3 ng of vector is used per kb of plasmid vector and 9 ng of gene insert is used per kb of gene insert, which is significantly lower than most other currently known methods (50 - 100 ng / kb). Commercial kits available usually recommend higher concentrations than those in published papers. However, in practice, the protocol of this method requires much higher amounts. Although the recommended amount may be 0.5 ng of vector plasmid, in fact, no more than 50 colonies require 100 ng (DH5alpha-mediated assembly).

[0057] The reaction time was standardized to 30 seconds, which is faster than most existing methods.

[0058] Example 2

[0059] Comparison of reaction time

[0060] The vector and insert used in the experiment were the same as those previously standardized (Example 1). The competent cells used were from different batches. The procedure employed a PCR instrument, including the heating and cooling times. The PCR instrument was set at 67 °C, and the PCR tubes contained the same reaction mixture as used in Example 1. The exact incubation time of the samples at each temperature may be slightly shorter than the tested time. The number of colonies obtained in this procedure is shown in Table 2. For correct frame insertion, eGFP emits green fluorescence to show the correct insertion ratio.

[0061] Table 2

[0062]

[0063] When the reaction time was 30 seconds, the number of colonies obtained / observed was 312, which is sufficient for most molecular biology applications. A reaction time of 15 seconds resulted in a number of colonies significantly higher than the background. However, as shown in the table, increasing the reaction time by another 15 seconds increased the colonies by about 10-fold. When further considering the correct insertion ratio, the correct ratio for a 15-second reaction time (71.0%) was significantly lower than 97.1% for a 30-second reaction time. The 30-second reaction condition showed excellent performance in both the number of colonies and the insertion ratio. Therefore, the 30-second reaction was established as the standard reaction time.

[0064] Example 3

[0065] Comparison of static recovery time on kanamycin plates

[0066] The vector used in this example is the pKL positive vector, a 2328-bp kanamycin vector, as shown in SEQ ID NO:3:

[0067] SEQ ID NO:3: pKL positive vector:

[0068] GTTCATCTGCACGA xxxxxxxxxxxx ACGACCAATAGCGT GCTGAGCAAAGATCCGCAGGAACGCCGTGATCACATGGTCCTGGTGGAATTTGTGACCGCTGCGGGCTTGAGCCTGGGTATGGACGAGCTGTATAAGAGCTAAGTGACTAGTGCTGTGACTAGTGCTAGCGGCGCGCCCTCGAGGGTACCGAATTCGCGGCCGC

[0069] GTTCATCTGCACGA (SEQ ID NO. 9) xxxxxxxxxxxx ACGACCAATAGCGT (SEQ ID NO. 10) Contains a homologous region, which contains a part of fuGFP(40). The remaining fuGFP is the insert in SEQ ID NO:4.

[0070] The remaining 483bp fuGFP insert of SEQ ID NO:4:

[0071] GTTCATCTGCACGA CCGGTCGCCTGCCGGTGCCTTGGCCGACCTTGGTGACGACCTTGTCGTATGGCGTGCAGTGTTTTGCGAAGTATCCGGAGCACATGCGCCAAAACGATTTCTTTAAAAGTGCGATGCCGGACGGTTACGTCCAGGAGCGTACCATTTCCTTCAAGGAAGATGGCACGTACAAAACTCGCGCAGAGGTTAAGTTTGAAGGTGAAGCGCTGGTCAATCGTATCGATTTGAAGGGTTTGGAGTTTAAAGAGGATGGTAACATTCTGGGCCATAAACTGGAGTATAGCTTCAACAGCCATTATGTTTACATTACGGCAGACAAGAATCGTAACGGCTTGGAGGCCCAATTCCGTATTCGCCACAATGTTGATGACGGTAGCGTCCAACTGGCCGACCATTACCAACAGAACACCCCAATTGGTGAGGGTCCGGTGTTGCTGCCGGAACAACACTATCTG ACGACCAATAGCGT

[0072] A mixture of 6.984 ng / μl pKL positive vector and 1.449 ng / μl fuGFP insert was used as the ZY cloning positive control of the vector. To achieve a 1:1 molar ratio, 2 μl of the ZY cloning positive control (ZyCloning, Woburn, Massachusetts, USA) and 1.449 ng / μl fuGFP insert were mixed with 1 μl of 3x ZY cloning premix reagent (ZyCloning, Woburn, Massachusetts, USA) and reacted at 67 °C for 30 seconds. 50 μl of chemically competent cells DH10BC (ZyCloning, Woburn, Massachusetts, USA) were added to the reaction mixture. The cells were exposed to a heat shock at 42 °C, and the individual cell transformation mixtures were incubated at 37 °C for a set time without adding any medium and without shaking, and then incubated on ice for 15 minutes as a control. After the incubation time, the cells were spread on kanamycin plates and incubated overnight at 37 °C. The results are shown in Table 3:

[0073] Table 3: Comparison of the effects of static incubation time

[0074] Static incubation time Colony count 30 seconds at 37°C 10 1 minute at 37°C 13 2 minutes at 37°C 57 4 minutes at 37°C 50 8 minutes at 37°C 103 15 minutes at 0°C 139

[0075] Incubation at 37 °C did not accelerate the reaction process. The data showed that the number of colonies obtained by incubating at 37 °C for 8 minutes was even lower than the result of incubating at 0 °C for 15 minutes. Within 1 minute or less, the number of colonies was even lower. When incubated at 37 °C for 2 minutes, the number of colonies obtained was only 41% of that obtained by incubating at 0 °C for 15 minutes. At 8 minutes, the number of colonies increased to 74% of that obtained at 0 °C for 15 minutes. Therefore, the standard operating procedure was finally determined to be a 15-minute treatment at low temperature. Since the lowest temperature that can be set on the PCR instrument is 4 °C, static incubation at 4 °C for 15 minutes was established as the standard parameter. In this transformation process, there is no need to wait after the competent cells are mixed with the reaction sample for subsequent operations.

[0076] Compared with the conventional methods using kanamycin, chloramphenicol, tetracycline and other antibiotics as selective markers, this method has obvious advantages. The method of the present invention has a shorter recovery time than the conventional methods using medium addition and oscillation procedures, which is crucial for the conventional methods of direct transformation. From reaction to spreading, this method is one of the fastest molecular cloning methods.

[0077] Example 4

[0078] Comparison of different competent cells

[0079] A total of seven commercially available competent cells from different suppliers were compared with DH10B (ZyCloning, Woburn, MA, USA). Among them, in one batch, a rapid recovery step of 15 minutes was carried out at 4 °C, while in another batch, a conventional step of adding 9x recovery medium (New England Biolabs, Ipswich, MA, USA) and incubating with shaking at 37 °C for 1 hour was adopted. All cells were centrifuged. All cells were spread on kanamycin (50 μg / ml) plates and incubated at 37 °C. The results are shown in Table 4.

[0080] Table 4: Comparison of DH10B from different sources under different recovery modes

[0081]

[0082] When using the static recovery mode, the competent cells produced by ZyCloning performed better than all other brand cells in Table 4. The E.cloni 10G cells (BioSearch Technologies) reached 55% of the colony number of the reference cell DH10B (ZyCloning), and the DH10B cells (Gaode Biology) reached 15% of the colony number of the reference cell. When using the recovery medium from New England Biolabs, the competent cells from BioSearch Technologies and New England Biolabs worked better. The DH10B cells from ZyCloning increased by about 2.4 times after incubation and shaking with the recovery medium.

[0083] In the case of complex nucleotide assembly with more than three polynucleotide fragments assembled, the colony yield can be increased by additional shaking with the recovery medium. It must be noted that maximum efficiency can be standardized with different media to recover the maximum number of colonies with other competent cells. In the comparison carried out in Table 4, when using the conventional recovery method, the DH10B competent cells from the method of the present invention had a competence of approximately 1×10 8 and when applying the static recovery method, had a competence of approximately 4×10 7 . The competent cells of the present invention can be named "rapid recovery" competent cells.

[0084] If using the competent cells with the optimal performance under the condition of shaking culture with the recovery medium, in order to achieve the goal of 100 colonies, the reaction vector and the insert fragment can be as low as 0.070 ng and 0.014 ng, which is lower than the minimum claimed by all conventional methods.

[0085] Example 5

[0086] Homologous length check

[0087] In the examples, the length of the homologous bases was 12 / 12 bp (Examples 1 and 2) and 14 / 14 bp (Examples 3 and 4), which is already below the conventionally used 15 bp limit. The vector used in this example was pKLShv, a plasmid with kanamycin resistance and a part of sfGFP(48), as shown in SEQ ID NO:5.

[0088] SEQ ID NO:5: Sequence of pKLShv

[0089]

[0090] The xxxxxxxxxxxx in SEQ ID NO:5 is part of the plasmid vector into which the gene insertion fragment is inserted. The gene insertion fragment is the remaining part of superfolder green fluorescent protein (sfGFP), as shown in SEQ ID NO:6, plus the additional sequences at both ends of the vector region.

[0091] SEQ ID NO:6: Remaining part of sfGFP (gene insertion fragment):

[0092] ACCTACGGTGTACAATGCTTCTCGCGTTACCCCGATCACATGAAGCAACACGATTTCTTCAAGTCAGCAATGCCTGAAGGTTACGTCCAAGAACGTACTATATCATTCAAAGACGACGGTACCTACAAGACTCGGGCGGAAGTTAAGTTCGAAGGTGACACTTTAGTCAATCGTATCGAGTTAAAGGGTATCGATTTCAAAGAGGATGGCAACATTTTAGGACACAAGCTGGAGTACAACTTTAACAGCCACAATGTATACATTACTGCCGACAAGCAAAAGAACGGCATCAAGGCAAATTTCAAGATTAGACATAACGTCGAAGACGGCTCCGTGCAATTAGCAGATCATTATCAACAGAACACGCCGATCGGCGACGGCCCCGTGTTATTACCCGACAAT

[0093] The additional homologous sequences at the 5’ and 3’ ends are shown in Table 6.

[0094] The Tm (melting temperature of DNA denaturation) is calculated by the given formula.

[0095] For short sequences less than 13 bp, Tm = (wA + xT)*2 + (yG + zC)*4, and the Tm of sequences longer than 14 bp is calculated by the given formula

[0096] Tm = 64.9 + 41*(yG + zC - 16.4) / (wA + xT + yG + zC)(49),

[0097] where w, x, y, z are the numbers of A, T, G, and C in the sequence.

[0098] Table 6: Homologous sequence length and cloning efficiency

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106] Mix 1 μl of linearized pKLshv at 7.2 ng / μl, 1 μl of the insert at a length x 0.009 ng / μl (as shown in Table 7), and 1 μl of 3x ZY Cloning Premix (ZyCloning, Woburn, MA, USA), and heat at 67°C for 30 seconds. Add 50 μl of DH10BC (ZyCloning, Woburn, MA, USA) to the reaction mixture, heat-shock the cells at 42°C for 1 minute on a PCR machine, and then incubate at 4°C for 15 minutes. Spread the cells on plates containing kanamycin (50 μg / ml), and incubate the plates overnight at 37°C. Count the green fluorescent colonies with the correct eGFP protein orientation and calculate the ratio. The results are shown in Table 7.

[0107] Table 7: Homologous sequence length and cloning efficiency

[0108]

[0109]

[0110]

[0111] For DNA fragments with a length of 8 base pairs (bp) or less and a melting temperature (Tm) of less than or equal to 22 / 22, no gene insertion fragments with the correct orientation were observed. For fragments between 9 and 13 bp, with Tm values of 24 / 24 and 36 / 34 respectively, the number of colonies produced was significant but relatively low. Using a short calculation method to increase the Tm to 36 / 36 led to a significant increase in the number of colonies, and for base pairs up to 40 bp, the positive rate was generally stable above 90%. Based on experimental evidence, the Tm values at both ends were finally standardized to at least 36°C.

[0112] Sequences with high repeat rates, self-complementarity, very high or very low GC percentages, or two highly similar homologous sequences are generally not suitable for selecting homologous sequences in this method. Experimental verification shows that DNA fragments obtained from restriction enzyme digestion, gene synthesis, PCR, high-performance liquid chromatography (HPLC), or gel-purified primers, especially 12-bp fragments with a Tm of 36°C, produced ideal results. However, when using unpurified PCR primers, since the reliability of the 3'-end synthesized primer at the 5'-end is usually less than 100%, longer homologous sequences are generally required to compensate for its inherent reliability defect.

[0113] In summary, the new ZY cloning system method includes homologous sequence design, vector and insert preparation. The standard reaction system contains 1 μl of vector, 1 μl of insert, and 1 μl of 3x ZY cloning premix reagent. After reacting at 67°C for 30 seconds, 50 μl of competent cells are added for transformation. For resistance screening other than ampicillin, the rapid static incubation recovery method is used after heat shock.

[0114] The above description of the specific embodiments has fully revealed the general principles of the technical solution. Based on existing knowledge, those skilled in the art can modify and / or adjust the described embodiments to adapt to different application scenarios. As long as they do not depart from the core concept of the technology, such modifications and adjustments should be regarded as belonging to the equivalent scope of the disclosed embodiments. It should be noted that the terms used herein are for descriptive purposes only and not for limitation. Therefore, although the technology has been described through preferred embodiments, those skilled in the art should understand that the technical solution can be implemented by modification within the spirit and scope defined by the claims.

[0115] Reference materials:

[0116] 1.https: / / eng.bioneer.com / 20-k-7110-cfg.html

[0117] 2.https: / / www.mclab.com / Choo-Choo-Cloning-Kits.html

[0118] 3.https: / / www.tamar.co.il / rna-dna-magnetic-clean-beads-4 /

[0119] 4.https: / / www.lubio.ch / applications / molecular-cloning / ultra-rapid-cloning

[0120] 5.https: / / web.archive.org / web / 20170711224046 / https: / / www.systembio.com / molecular-tools / cold-fusion-cloning / overview /

[0121] 6.Sun,S.et al.(2015)Biotechnol Biotechnol Equip.29(1):105-110.

[0122] 7.Jing,P.et al.(2016)ACS Synth.Biol.2016,5,9,1028-1032

[0123] 8.Kostylev,M.et al.,(2015)PLOS ONE,https: / / doi.org / 10.1371 / journal.pone.0137466

[0124] 9.Li,C.et al.(2011),BMC Biotechnology,11,Article number,92

[0125] 10.https: / / www.genecopoeia.com / product / fast-fusion-cloning-kit /

[0126] 11.http: / / www.abdesignlabs.com / technical-resources / licase-protocol /

[0127] 12.https: / / www.realgenelabs.com / fusion-seamless-cloning-kit-514000

[0128] 13.https: / / www.genscript.com / genbuilder-dna-assembly.html

[0129] 14.https: / / www.thermofisher.com / us / en / home / life-science / cloning / seamless-cloning-and-genetic-assembly / geneart-seamless-cloning-and-assembly.html

[0130] 15. Gibson, D. G., et al. (2009) Nat. Methods 6, 343 - 345.

[0131] 16. Gibson, D. G., et al. (2010) Science 329, 52 - 56.

[0132] 17. Chen, C. et al. (2018) Biotechniques. 60, NO.3S

[0133] 18. Tan, L., et al. (2018), PeerJ 6: e5146; DOI 10.7717 / peerj.5146

[0134] 19. Fu, C. et al. (2014) PLOS ONE, https: / / doi.org / 10.1371 / journal.pone.0115318

[0135] 20. https: / / www.apexbt.com / hyperfusiontm - high - fidelity - dna - polymerase.html

[0136] 21. https: / / intactgenomics.com / product / ig - fusion - cloning - kit /

[0137] 22. Jeong, JY. et al. (2012) Applied and Environmental Microbiology Vol.78, No.15

[0138] 23. https: / / www.takarabio.com / products / cloning / in - fusion - seamless - cloning / in - fusion - snap - assembly - for - high - throughput - workflows? gclid=CjwKCAiA2fmdBhBpEiwA4CcHzTGdii1MdqvXqQwwS7aW8dTtWAjfdXMHCGDA0VIrDdPWn7ZxXaaJuhoClSkQAvD_BwE

[0139] 24. Nozaki, S., et al. (2019) J Bacteriol. 2019 Mar 1; 201(5): e00660-18.

[0140] 25. https: / / www.lifesct.com / Cloning-Kits

[0141] 26. https: / / www.neb.com / applications / cloning-and-synthetic-biology / dna-assembly-and-cloning / nebuilder-hifi-dna-assembly

[0142] 27. https: / / www.cwbiosciences.com / goods / index / id / 63

[0143] 28. https: / / www.civicbio.com / product / peasy-uni-seamless-cloning-and-assembly-kit /

[0144] 29. Thieme, F., et al., (2014) Methods Mol Biol, 1116: 37-48. doi:10.1007 / 978-1-62703-764-8_3.

[0145] 30. https: / / bpsbioscience.com / fast-simple-and-efficient-cloning-kit-without-competent-cells

[0146] 31. https: / / lifeome.com / seamless-cloning-by-healtrade-p-584453.html?osCsid=6898fe79621bbf9c59fcbd73d694c2bd

[0147] 32. https: / / www.biobasic.com / seamless-cloning-master-mix-kit-4108

[0148] 33. Zhang, Y., (2014), Methods Mol Biol. 2014; 1116: 235-244.

[0149] 34. Li, M. et al. (2007) Nature Methods volume 4, pages 251 - 256

[0150] 35. Rabe, B. (2020) https: / / www.biorxiv.org / content / 10.1101 / 2020.06.14.150979v1

[0151] 36. Ding, W. (2017) Bioengineered. 2017;8(3):296 - 301.

[0152] 37. Dao, V. L. et al. (2022) Scientific Reports volume 12, Article number: 400420

[0153] 38. Xia, Y. et al. (2018) Nucleic Acids Research, Volume 47, Issue 3, e15

[0154] 39. Motohashi. K., (2015) BMC Biotechnology, 15, Article number 47

Claims

1. A cloning method, wherein, The method includes: assembling two or more polynucleotides in a single step, wherein the assembly reaction is carried out at 58°C to 100°C; and transforming the assembled product into competent cells for covalent ligation of the polynucleotides.

2. The cloning method according to claim 1, wherein The assembly reaction temperature is equal to or higher than a specific one of the following temperatures: 58°C, 59°C, 60°C, 61°C, 62°C, 63°C, 64°C, 65°C, 66°C, 67°C, 68°C, 69°C, 70°C, 71°C, 72°C, 73°C, 74°C, 75°C, 76°C, 77°C, 78°C, 79°C, 80°C, 84°C, 88°C, 92°C, 96°C, and 100°C.

3. The cloning method according to claim 1, wherein At least one of the polynucleotides is a plasmid vector.

4. The cloning method according to claim 1, wherein The transformation step includes a static recovery period.

5. The cloning method according to claim 4, wherein, The static recovery period includes incubating the transformed competent cells at a temperature of 0°C to 37°C for 15 minutes.

6. The cloning method according to claim 1, wherein The competent cells are selected from the group consisting of DH10BC and DH10B.

7. The cloning method according to claim 1, wherein, The single-step assembly reaction includes: a. providing single-stranded overhang regions of polynucleotides capable of annealing; b. providing a linearized plasmid vector, wherein the plasmid vector and the overhangs of the polynucleotides are capable of hybridizing; and c. annealing the linearized vector with the polynucleotide having a single-stranded overhang region.

8. The cloning method according to claim 3, wherein, The plasmid vector and the polynucleotide contain homologous base pairs with a length of 10-40 base pairs at the 3'- and 5'-ends.

9. The cloning method according to claim 3, wherein, The melting temperature (T m ) of the linearized plasmid vector and the two ends where the polynucleotides are annealed is in the range of 30-50 °C.

10. The cloning method according to claim 1, wherein The generation of the single-stranded overhang region of the polynucleotide is carried out by a unidirectional 3' to 5' or 5' to 3' exonuclease.

11. The cloning method according to claim 3, wherein, The concentration range of the plasmid vector is 0.07 - 3 ng / kb plasmid vector.

12. The cloning method according to claim 1, wherein, The concentration range of the polynucleotide is 0.014 - 9 ng / kb polynucleotide.

13. The cloning method according to claim 3, wherein, The plasmid vector contains a selectable marker gene that confers resistance to an antibiotic that inhibits protein synthesis.

14. The cloning method according to claim 13, wherein, The antibiotic is selected from the group consisting of kanamycin, chloramphenicol, and tetracycline.

15. The cloning method according to claim 3, wherein The plasmid vector contains a selectable marker gene other than the ampicillin resistance gene.

16. The cloning method according to claim 3, wherein, The plasmid vector sequences are selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3, and SEQ ID NO:

5.

17. The cloning method according to claim 5, further comprising incubating at a temperature of 0 - 4°C.

Images