Construction method of inducible uterus specific gene knockout mouse

Abstract

The invention belongs to the technical field of gene editing, and discloses a construction method and application of a uterus specific conditional gene knockout mouse based on a Tet-On system. By integrating a CRISPR-Cas9 gene editing technology, a Cre-LoxP recombinase system and a Tet-on induction system, a gene knockout mouse with double controllable time and space is constructed. Compared with a single technical system, the combined application of the three systems not only inherits the high efficiency of CRISPR / Cas9 and the tissue specificity of Cre-LoxP, but also realizes the time controllability of gene knockout through a Tet-on system. The time and space dual-controllable gene knockout system provides an available tool for mechanism research of related genes in a mammal female reproductive system. In addition, the system also provides a replicable technical framework for the construction of other organ specific gene knockout models.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and more specifically, relates to a method for constructing an inducible uterus-specific gene knockout mouse. Background Art

[0002] In the field of biomedical research, the gene engineering mouse model has become an indispensable and important tool. This model system not only provides an ideal experimental platform for in vivo verification of gene functions, but also opens up a unique perspective for in-depth exploration of the functions of cells and their response mechanisms under physiological homeostasis conditions. In recent years, with the continuous deepening of research, the engineered mouse models constructed by simulating human disease-related gene mutations have shown significant application value in preclinical translational research such as revealing the complex mechanisms of disease occurrence and development and evaluating the effectiveness of new treatment strategies. Notably, disease models constructed based on precise gene editing technology are gradually expanding from the basic research field to practical application fields such as drug development. This trend not only highlights the core position of precise gene editing technology in reproductive and genetic research, but also indicates its great potential in promoting the development of veterinary medicine and related fields. By using these models, researchers can more accurately simulate human disease states, thereby accelerating the research and development process of new therapies and drugs, and providing more powerful support for veterinary clinical practice.

[0003] The Cre-LoxP system core consists of Cre recombinase and LoxP sequences. Among them, the LoxP site, full name "Locus of crossover (x) P1", is a specific DNA sequence structure, containing two 13bp inverted repeat sequences and an 8bp core spacer sequence between them. Cre recombinase, as a member of the tyrosine-type site-specific recombinases (T-SSRs) family, can precisely recognize specific DNA fragments in the LoxP site and catalyze the specific deletion process of the DNA sequence between two LoxP sites. The main application of the Cre-LoxP system is to achieve precise excision of genes, but this system also has the ability to induce DNA sequence inversion and translocation according to the direction and position of the LoxP site, further expanding its versatility in gene editing.

[0004] In the CRISPR / Cas9 system, the Cas9 protein and single-guide RNA (sgRNA) together constitute the key components of gene editing: the sgRNA is responsible for precisely locating the DNA target site, while Cas9 is responsible for performing the DNA cleavage task at the target site. Its operating mechanism is that the 5' end of the sgRNA recognizes a specific DNA target sequence through base pairing, and the Cas9 nuclease binds to the 3' end of the sgRNA. Subsequently, guided by the sgRNA, Cas9 cleaves the DNA double strand at a position approximately 3 base pairs upstream of the protospacer adjacent motif (PAM), forming a double-strand break (DSB). Through in-depth studies of the structure of Streptococcus pyogenes Cas9, scientists have found that the formation of DSBs may be related to conformational changes that occur after the RNA binds to the target DNA. It is worth noting that the site-specific cleavage of the CRISPR / Cas9 system is jointly determined by the base pairing complementarity between the crRNA (i.e., sgRNA) and the target DNA, and the short motif PAM adjacent to the complementary region in the target DNA. Without the PAM sequence, even if the target sequence is completely complementary to the crRNA, Cas9 cannot recognize and cleave. After the formation of DSBs, the cell will initiate one of the following three DNA repair pathways for repair: non-homologous end joining (NHEJ), homology-directed repair (HDR), or microhomology-mediated end joining (MMEJ).

[0005] In the study of mammalian reproductive biology, the analysis of the molecular regulatory mechanisms of embryo implantation and uterine decidualization relies on precise gene editing models. Currently, most studies use the Cre-loxP recombinase system to construct uterine-specific gene knockout models: for example, through tools such as Cre driven by the progesterone receptor promoter (Pgr-Cre) or Cre driven by the lactoferrin promoter (Ltf-Cre) to achieve spatial-specific knockout of target genes. Although this model has promoted research to a certain extent, there are still some problems: firstly, the expression of Pgr-Cre begins in the early postnatal stage of mice, when the uterus is in a critical period of cell differentiation, which may lead to the loss of function of the target gene in the early stage of uterine development; secondly, traditional construction strategies require multiple generations of breeding of Cre tool mice and Floxed target gene mice, with a breeding cycle of up to 1-2 years; thirdly, the time-uncontrolled gene knockout is difficult to analyze the dynamic functions of genes at specific developmental stages. Summary of the Invention

[0006] To overcome the deficiencies of the prior art, the purpose of the present invention is to provide a method for constructing TG sgNSUN2 mice.

[0007] The second purpose of the present invention is to provide a method for constructing a time-controllable uterine-specific gene knockout mouse.

[0008] The purpose of the present invention is achieved by the following technical solutions:

[0009] A method for constructing TG sgNSUN2 mice, comprising the following steps: integrating the fragment of U6-sgRNA(Nsun2)-egfpon1 into the mouse genome by using the PiggyBAC transposase system, and then obtaining the mice by screening through genotype identification.

[0010] Preferably, the present invention also provides sgRNA sequences targeting Nsun2, as shown in SEQ ID NO:1 and SEQ ID NO:2.

[0011] The present invention also provides the application of the TG sgNSUN2 mice in constructing gene knockout mice.

[0012] The present invention also provides a method for constructing a temporally controllable uterus-specific gene knockout mouse, comprising the following steps:

[0013] S1. Caging female mice of Col1a1 TetO-Cas9 / TetO-Cas9 Rosa26 M2-rtTA / M2-rtTA with male mice of Pgr ires-Cre / + and screening and retaining mice with the F1 genotype of Col1a1 TetO-Cas9 / + Rosa26 M2-rtTA / + Pgr ires-Cre / + ;

[0014] S2. Caging female mice of Rosa26 LSL-rtTA3 / LSL-rtTA3 with male mice of Pgr ires-Cre / + and screening and retaining mice with the F1 genotype of Rosa26 LSL-rtTA3 / + Pgr ires-Cre / + ;

[0015] S3. Caging the mice with the genotype of Col1a1 TetO-Cas9 / + Rosa26 M2-rtTA / + Pgr ires-Cre / + obtained in S1 and the mice with the genotype of Rosa26 LSL-rtTA3 / + Pgr ires-Cre / + obtained in S2 according to the sex ratio, and retaining the F2 generation mice with the genotype of Col1a1 TetO-Cas9 / + Rosa26 LSL-rtTA3 / + Pgr ires-Cre / + and the mice with the genotype of Col1a1 TetO-Cas9 / + Rosa26 LSL-rtTA3 / + Pgr ires -Cre / ires-Cre ;

[0016] S4. Caging the two types of F2 generation mice obtained in S3 according to the sex ratio, and screening and retaining Col1a1 TetO-Cas9 / TetO- Cas9Rosa26 LSL-rtTA3 / LSL-rtTA3 Pgr ires-Cre / ires-Cre Genetically edited mouse.

[0017] The present invention also provides Col1a1 obtained by the above method TetO-Cas9 / TetO-Cas9 Rosa26 LSL-rtTA3 / LSL- rtTA3 Pgr ires-Cre / ires-Cre Use of the genetically edited mouse in the development and / or screening of drugs for uterine-targeted gene therapy.

[0018] The present invention also provides the TG sgNSUN2 Mouse in constructing a tool mouse for verifying the obtained Col1a1 TetO-Cas9 / TetO- Cas9 Rosa26 LSL-rtTA3 / LSL-rtTA3 Pgr ires-Cre / ires-Cre Use in a tool mouse for gene knockout efficiency of the genetically edited mouse.

[0019] Preferably, the use is to mate the Col1a1 TetO-Cas9 / TetO-Cas9 Rosa26 LSL-rtTA3 / LSL-rtTA3 Pgr ires -Cre / ires-Cre Mouse with the TG sgNSUN2 Mouse to obtain a female mouse with the genotype Col1a1 TetO-Cas9 / + Rosa26 LSL-rtTA3 / + Pgr ires -Cre / + TG sgNSUN2 which can be used as a tool mouse for verifying the gene knockout efficiency of the Col1a1 TetO-Cas9 / TetO-Cas9 Rosa26 LSL-rtTA3 / LSL-rtTA3 Pgr ires -Cre / ires-Cre Genetically edited mouse.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] In this study, by integrating the CRISPR-Cas9 gene editing technology, the Cre-LoxP recombinase system, and the Tet-on induction system, a gene knockout mouse with dual temporal and spatial control was constructed. The advantages of this gene knockout mouse are mainly reflected in three aspects: First, through Dox induction, the expression window of the CAS9 protein can be precisely controlled, avoiding unexpected editing during embryonic or larval development stages, and fundamentally circumventing the uterine development defects that may be caused by the traditional Pgr-Cre model. Second, the Cre recombinase driven by the Pgr promoter ensures that the editing activity is limited to the uterine tissue, and the introduction of the LoxP-Stop-LoxP element further blocks the leakage expression of rtTA3 in non-target organs. Finally, through the single-generation mating strategy of the gene knockout mouse and the target gene sgRNA transgenic mouse, the 1-2-year cycle required for traditional multi-strain hybridization is shortened to 3-4 months, improving the efficiency of model construction.

[0022] Compared with a single technical system, the combined application of the three systems described in the present invention not only inherits the high efficiency of CRISPR / Cas9 and the tissue specificity of Cre-LoxP, but also realizes the temporal controllability of gene knockout through the Tet-on system. This gene knockout system with dual temporal and spatial control provides a useful tool for the mechanism study of related genes in the mammalian female reproductive system. In addition, this system also provides a replicable technical framework for the construction of other organ-specific gene knockout models. Brief Description of the Drawings

[0023] Figure 1 It is the linear map of the U6-sgRNA(Nsun2)-egfpon1 expression cassette;

[0024] Figure 2 It is the identification result of the targeting vector digested with ScaI alone. Theoretically, it is 8264bp, 2536bp, 1021bp, 359bp (the 359bp band is not shown due to low quantity); M: 1kb DNA ladder;

[0025] Figure 3 It is the electrophoresis diagram of PCR identification. The numbered ones are positive mice, and M is 1kb DNA Marker;

[0026] Figure 4 It is the breeding roadmap of the mouse;

[0027] Figure 5For the genotyping of breeding mice, (a) Genotyping of mouse Col1a1-TetO-Cas9; (b) Genotyping of mouse Rosa26-LSL-rtTA3; (c) Genotyping of mouse Pgrires-Cre; (d) Genotyping of mouse TGsgNSUN2; (e) DL2000 DNA Marker;

[0028] Figure 6 For the expression of CAS9 and NSUN2 in the uterus of NSUN2-cKO mice without induction, where (a) Immunohistochemical analysis of the expression levels of CAS9 and NSUN2 in the uterus of NSUN2-cKO mice without drug administration, the scale bar is 100 μm; (b) Immunoblot analysis of the expression levels of CAS9 and NSUN2 in the uterus of NSUN2-cKO mice without drug administration;

[0029] Figure 7 For the expression of uterine structure-related proteins in NSUN2-cKO mice and wild-type mice, where (a) Representative pictures of the expression levels of VIMENTIN, FOXA2, and KI67 in the mouse uterus, the scale bar length is 100 μm; (b) Representative pictures of the expression levels of TACSTD2, α-SMA, and CD31 in the mouse uterus, the scale bar length is 100 μm;

[0030] Figure 8 For the expression of CAS9 and NSUN2 at different induction concentrations;

[0031] Figure 9 For the expression of CAS9 and NSUN2 at different induction times;

[0032] Figure 10 For the expression levels of CAS9 and NSUN2 in the heart and liver of NSUN2-cKO mice;

[0033] Figure 11 For the expression levels of CAS9 and NSUN2 in the spleen and kidney of NSUN2-cKO mice;

[0034] Figure 12 For the expression levels of CAS9 and NSUN2 in the lung and brain of NSUN2-cKO mice;

[0035] Figure 13 For the expression levels of CAS9 and NSUN2 in the stomach and skeletal muscle of NSUN2-cKO mice;

[0036] Figure 14 For the expression levels of CAS9 and NSUN2 in the intestine and ovary of NSUN2-cKO mice;

[0037] Figure 15Expression levels of CAS9 and NSUN2 in the uterus of NSUN2-cKO mice

[0038] Figure 16 For the implantation of embryos on the 5th day of pregnancy in wild-type mice, (a) Representative pictures of the uterus of mice on the 5th day of pregnancy, the scale bar is 1 cm; (b) Statistical analysis of the number of embryos in mice on the 5th day of pregnancy, n = 3, Mean±SEM, p<0.05

[0039] Figure 17 For the embryonic development of wild-type mice on the 8th day of pregnancy, (a) Representative pictures of the uterus of mice on the 8th day of pregnancy, the scale bar is 1 cm; (b) Statistical analysis of the number of embryos in mice on the 8th day of pregnancy, n = 3, Mean±SEM, p<0.05; (c) Statistical analysis of the weight of embryos in mice on the 8th day of pregnancy, n = 3, Mean±SEM, p<0.05; (d) Endogenous alkaline phosphatase level in embryos of mice on the 8th day of pregnancy, the scale bar is 200 μm Detailed implementation methods

[0040] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific drawings and embodiments. In the embodiments, unless otherwise specified, the experimental methods used are all conventional methods, and the materials, reagents, etc. used, unless otherwise specified, can all be obtained from commercial channels

[0041] In this study, all research data were statistically analyzed using the T-Test with Graphad Prism 9.5 software, and each index was expressed as mean ± standard error (Mean±SEM). A p<0.05 was considered significantly different and indicated by "*". All experiments were independently repeated at least 3 times

[0042] Experimental mice

[0043] Col1a1 TetO-Cas9 / TetO-Cas9 Rosa26 M2-rtTA / M2-rtTA Mice (strain catalog number: #029415, RRID: IMSR_JAX: 029415) were purchased from The Jackson Laboratory in the United States

[0044] Rosa26 LSL-rtTA3 / LSL-rtTA3 Mice (strain catalog number: #029633, RRID: IMSR_JAX: 029633) were purchased from The Jackson Laboratory in the United States

[0045] Pgr ires-Cre / ires-Cre Mice were purchased from Shanghai Model Organisms Center, Inc

[0046] TG sgNSUN2The design plan of the mice was provided by our laboratory, and the construction was entrusted to Shanghai Model Organisms Center, Inc.

[0047] Example 1 TG sgNSUN2 Construction of Mice

[0048] First, retrieve the Nsun2 genomic sequence and transcriptome information of C57BL / 6J mice from the NCBI database. Use the online CRISPR-Cas9 target sequence design software CRISPR Design to select sgRNA sequences (sgRNA1 and sgRNA2), analyze to ensure no off-target binding sites, and add the U6 promoter sequence to initiate the sgRNA sequence. To better observe sgRNA expression and subsequent gene knockout, design and add fluorescent genes mCherry and EGFP. The fluorescent genes are controlled by the CMV promoter, and transcription is terminated by the polyA signal. Finally, the target sequence is synthesized and denoted as U6-sgRNA(Nsun2)-egfpon1.

[0049] Among them, sgRNA1: 5’-TGGTACGCTACCTTATGGTG-3’.

[0050] sgRNA2: 5’-CAAGGGAAACATCAGCCGCC-3’.

[0051] sgEGFP-ON: 5’-CGAAGTTATATTAAGGGTTC-3’.

[0052] Using the PiggyBAC transposase system and the method of fertilized egg injection, insert U6-sgRNA(Nsun2)-egfpon1 randomly into the mouse genome to obtain overexpressing transgenic mice.

[0053] The brief process is as follows: First, obtain PiggyBAC mRNA by in vitro transcription; microinject PiggyBAC mRNA and a vector containing the target insertion fragment (as shown in Figure 1 ) into the fertilized eggs of C57BL / 6J mice to obtain transgenic positive founder mice.

[0054] Plasmid digestion and identification: According to the design, construct a targeting PiggyBAC vector containing U6-sgNsun2. After digestion with Scal alone and linearization of the targeting vector, bands of approximately 8264bp, 2536bp, 1021bp, and 359bp should appear. The results are as shown in Figure 2 , which meet the expectations and prove the successful construction of the targeting vector.

[0055] The fertilized eggs after injection are transplanted into pseudopregnant female mice, and the mice born about 20 days later are the founder mice (F0 generation mice). Genotyping is performed on them by PCR method.

[0056] The identification primers, reaction system and reaction conditions are shown in Table 1, Table 2 and Table 3.

[0057] Table 1 PCR Primers

[0058] Primer Sequence 5'-->3' Primer Type I ACAAGCTGGAGTACAACTACAACA Forward II CGGTAAGTGTCACTGATTTTGAACT Reverse

[0059] Table 2 Reaction System

[0060]

[0061]

[0062] *2xRapid Taq Master Mix (Vazyme, Code No: P222)

[0063] Table 3 Reaction Conditions

[0064] Step# Temp(℃) Time Note 1 95 3min - 2 95 15sec - 3 60 15sec - 4 72 2min repeat steps 2-4 for 34 cycles 5 72 5min - 6 12 - hold

[0065] After designing primers for PCR, the positive mouse numbers identified are 1, 2, 4, 5, 6, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 20, 22, 24. The positive PCR band is 791 bp. The electrophoresis result of PCR identification is as Figure 3 shown.

[0066] Example 2 Breeding and Genotyping of Gene Knockout Mice

[0067] I. Genotyping

[0068] 1. DNA Extraction

[0069] Use the One Step Mouse Genotyping Kit of Vazyme company to extract DNA from mouse ear tissue. Add 50 μL of lysis buffer to each mouse ear, and prepare mouse ear tissue lysis buffer by mixing Proteinase K: Mouse tissue Lysis Buffer at a ratio of 1:50 according to the number of mouse ears. After mixing, add 50 μL of lysis buffer to each EP tube. Vortex for 10 seconds to ensure that each mouse ear tissue is immersed in the lysis buffer. Then place it in a PCR instrument and use the program in Table 2.2 for lysis. After the program ends, take it out, centrifuge at 12000 rpm for 5 min, and transfer the supernatant to a new 200 μL EP tube, which is the crude DNA extraction sample.

[0070] 2. PCR Amplification

[0071] The primers used for mouse genotype identification in this study are shown in Table 4, and the primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd. The PCR amplification systems and PCR amplification programs for different genotypes are as shown in Tables 5 - 11 below.

[0072] Table 4 PCR primer sequences for genotype identification

[0073]

[0074] Table 5 PCR reaction system for genotype identification of Col1a1 - TetO - Cas9 mice

[0075]

[0076] Table 6 PCR reaction system for genotype identification of Rosa26 - LSL - rtTA3 mice

[0077]

[0078]

[0079] Table 7 PCR reaction system for genotype identification of Pgr - ires - Cre mice

[0080]

[0081] Table 8 PCR reaction system for genotype identification of SgNSUN2 transgenic mice

[0082]

[0083] Table 9 PCR program for genotype identification of Col1a1 - TetO - Cas9 and Rosa26 - LSL - rtTA3

[0084]

[0085]

[0086] Table 10 PCR program for genotype identification of Pgr - ires - Cre mice

[0087]

[0088] Table 11 PCR program for genotype identification of sgNSUN2 transgenic mice

[0089]

[0090] 3. Agarose gel electrophoresis

[0091] Select a suitable gel casting tank and gel plate according to the number of PCR products and assemble them. First, prepare a 2% agarose suspension according to the size of the gel plate. Measure 1×TAE and add agarose powder, then mix well. Heat the agarose suspension in the microwave oven at high power until it becomes clear, add nucleic acid dye at a ratio of 1:10000, shake well, pour it into the gel plate, remove the bubbles, insert the gel comb, and let it stand and cool for 30 minutes until completely solidified. Pull out the gel comb, take out the agarose gel and put it into the horizontal electrophoresis tank, add 8 μL of PCR product to each well, and add 5 μL of DL2000 DNA Marker to each row of gel wells. Electrophorese at 140 V for 25 minutes, and finally carefully take out the agarose gel, take a picture in the gel imager, and observe and record the band size.

[0092] The breeding route of the mice constructed in this study is as Figure 4 shown. The breeding route is divided into two directions. First, Col1a1 TetO-Cas9 / TetO-Cas9 Rosa26 M2-rtTA / M2-rtTA female mice are mated with Pgr ires-Cre / + male mice, and the F1 generation mice with the genotype of Col1a1 TetO-Cas9 / + Rosa26 M2-rtTA / + Pgr ires-Cre / + are screened and retained; on the other hand, Rosa26 LSL -rtTA3 / LSL-rtTA3 female mice are mated with Pgr ires-Cre / + male mice, and the F1 generation mice with the genotype of Rosa26 LSL-rtTA3 / + Pgr ires-Cre / + are screened and retained. After the two F1 generation mice develop to sexual maturity, the female mice and male mice are cross-mated at a ratio of 2:1, and the mice with Rosa26 M2-rtTA / + in their genotypes are screened out, and the F2 generation mice with the genotypes of Col1a1 TetO-Cas9 / + Rosa26 LSL-rtTA3 / + Pgr ires-Cre / + and Col1a1 TetO-Cas9 / + Rosa26 LSL-rtTA3 / + Pgr ires-Cre / ires-Cre are retained. Then, the F2 generation mice are mated with each other after adulthood, and the Col1a1 TetO-Cas9 / TetO-Cas9 Rosa26 LSL-rtTA3 / LSL- rtTA3 Pgr ires-Cre / ires-Cre gene-edited mice are screened.

[0093] The genotype of the mice used to verify the gene knockout efficiency of the gene-edited mice in this study is Col1a1 TetO-Cas9 / + Rosa26 LSL-rtTA3 / + Pgr ires-Cre / + TG sgNSUN2 . The specific breeding route is as follows: Col1a1TetO-Cas9 / TetO-Cas9 Rosa26 LSL -rtTA3 / LSL-rtTA3 Pgr ires-Cre / ires-Cre Mice and TG sgNSUN2 Transgenic mice were mated, and the resulting genotype was Col1a1 TetO -Cas9 / + Rosa26 LSL-rtTA3 / + Pgr ires-Cre / + TG sgNSUN2 Female mice, that is, NSUN2 knockout mice, are hereinafter written as NSUN2-cKO mice.

[0094] During the breeding process, genomic DNA was extracted from the ears of newborn mice about 21 days old for genotype identification, and the results are as Figure 5 shown.

[0095] Genotype identification of Col1a1-TetO-Cas9 is as Figure 1 .a shows that P1 / P2 is a wild-type gene primer pair with an amplified band size of 199 bp, and wild-type gene bands appear in lanes 1, 2, 3, and 4; P3 / P4 is a mutant gene primer pair with an amplified band size of 160 bp, and mutant gene bands appear in lanes 1 and 2, indicating that the genotypes of the mice in lanes 1 and 2 are Col1a1 TetO-Cas9 / + , and the genotypes of the mice in lanes 3 and 4 are wild-type.

[0096] Genotype identification of Rosa26-LSL-rtTA3 is as Figure 1 .b shows that P1 / P2 is a wild-type gene primer pair with an amplified band size of 607 bp, and wild-type gene bands appear in lanes 1, 2, 3, and 4; P3 / P4 is a mutant gene primer pair with an amplified band size of 174 bp, and mutant gene bands appear in lanes 1 and 2, indicating that the genotypes of the mice in lanes 1 and 2 are Rosa26 LSL-rtTA3 / + , and the genotypes of the mice in lanes 3 and 4 are wild-type.

[0097] Genotype identification of Pgr-ires-Cre is as Figure 1 .c shows that P1 / P2 is a wild-type gene primer pair with an amplified band size of 396 bp, and wild-type gene bands appear in lanes 1, 2, 3, and 4; P3 / P4 is a mutant gene primer pair with an amplified band size of 619 bp, and mutant gene bands appear in lanes 1 and 2, indicating that the genotypes of the mice in lanes 1 and 2 are Pgr ires-Cre / + , and the genotypes of the mice in lanes 3 and 4 are wild-type.

[0098] Genotype identification of TGsgNSUN2 is as Figure 1As shown in.d, P1 / P2 is the primer pair of the target gene, and the amplified band size is 381bp. Mutant gene bands appear in lanes 1 and 3, indicating that the mice in lanes 1 and 3 carry the sgNSUN2 gene.

[0099] Observe and analyze the amplified band size, and finally identify that the genotype of the mouse in lane 1 is Col1a1 TetO-Cas9 / + Rosa26 LSL-rtTA3 / + Pgr ires-Cre / + TG sgNSUN2 , the genotype of the mouse in lane 2 is Col1a1 TetO-Cas9 / + Rosa26 LSL-rtTA3 / + Pgr ires-Cre / + , the genotype of the mouse in lane 3 is TG sgNSUN2 , the genotype of the mouse in lane 4 is wild type, and lane 5 is a blank control.

[0100] Example 3 System Leakage Verification and Uterine Development Structure Analysis

[0101] I. Immunohistochemistry

[0102] 1. Reagent Preparation

[0103] 4% Paraformaldehyde Fixative: Measure 4g of paraformaldehyde and dissolve it in 10mL of 1×PBS and 90mL of distilled water. 10×PBS: Weigh 14.2g of Na2HPO4, 14.2g of KH2PO4, 2g of KCL, and 81.8g of NaCl, and add deionized water to make up to 1L. 1×PBS: Measure 100mL and add distilled water to make up to 1000mL. Sodium Citrate Antigen Retrieval Solution: Weigh 1.47g of trisodium citrate dihydrate and 0.18g of anhydrous sodium citrate, dissolve in 300mL of distilled water, then add distilled water to make up to 500mL, and adjust the pH value to 6.0. EDTA Antigen Retrieval Solution: Measure 50mL of 50×Tris-EDTA Antigen Retrieval Solution, add 490mL of distilled water, and adjust the pH value to 8.0. 3% Hydrogen Peroxide Solution: 20mL of hydrogen peroxide (30%) + 180mL of methanol. Blocking Solution (10% Goat Serum): 100μL of blocking goat serum + 900μL of 1×PBS. Ammonia Water for Blue Return: 1mL of ammonia water + 200mL of distilled water. Hydrochloric Acid for Color Separation: 20μL of hydrochloric acid + 20mL of distilled water. Weak Hematoxylin Staining Agent: 1mL of hematoxylin staining solution + 3mL of 1×PBS. DAB Chromogenic Solution: 60μL of DAB chromogen + 1200μL of DAB chromogenic solution B.

[0104] 2. Immunohistochemistry Procedure

[0105] Place the paraffin sections on a slide warmer at 55 °C for 1 hour to melt the paraffin and firmly attach the tissue. Subsequently, perform gradient dewaxing and rehydration in the order shown in Table 2.22, and finally transfer to distilled water. Select the retrieval solution (sodium citrate buffer at pH 6.0 or EDTA retrieval solution at pH 8.0 - 9.0) according to the characteristics of the target protein. Prepare the acid-base retrieval solution in a beaker, vortex it on a vortex mixer to fully dissolve it, and heat it to boiling in a microwave oven at high power (about 5 minutes). Immerse the sections in the retrieval solution and perform retrieval at low power in the microwave oven for 10 minutes, then let it cool naturally to room temperature. Place the sections in an immunohistochemistry jar containing 1×PBS and rinse them 3 times on a shaker, 5 minutes each time. Immerse the sections in 3% hydrogen peroxide solution and incubate them in the dark for 10 minutes to block endogenous enzyme activity. Then place them in an immunohistochemistry jar containing 1×PBS and rinse them 3 times on a shaker, 5 minutes each time. After blotting dry the moisture from each section, use an immunohistochemistry pen to draw a circle around the tissue to mark the staining area. Prepare enough blocking solution (10% goat serum), add it to the wax circle to completely cover the tissue, and incubate it in a wet box in an oven at 37 °C for 1 hour. Dilute the primary antibody with the blocking solution according to the instructions, add it and completely cover the tissue. Incubate it overnight (12 - 16 hours) in a wet box in a 4 °C refrigerator. Recover the primary antibody, place it in an immunohistochemistry jar containing 1×PBS and rinse it 3 times on a shaker, 5 minutes each time. Add biotinylated goat anti-rabbit IgG (H+L) diluted with the blocking solution (1:200 dilution), and incubate it in a wet box in an oven at 37 °C for 1 hour. Drain the secondary antibody, place it in an immunohistochemistry jar containing 1×PBS and rinse it 3 times on a shaker, 5 minutes each time. Add horseradish peroxidase-labeled streptavidin (Invitrogen, diluted 1:1000 in PBS), and incubate it in a wet box at 37 °C for 30 minutes. Drain the tertiary antibody, place it in an immunohistochemistry jar containing 1×PBS and rinse it 3 times on a shaker, 5 minutes each time. Prepare the DAB chromogenic solution freshly according to the instructions, add it to the tissue surface, and develop the color at room temperature in the dark. Observe the color development under a microscope (usually 30 - 180 seconds), and immediately immerse it in distilled water to terminate the reaction after color development is completed. Stain with hematoxylin for 75 seconds, wash it in an immunohistochemistry jar containing pure water for 5 seconds. Then put it into ammonia water for blueing for 2 minutes, wash it with pure water for 5 seconds, put it into hydrochloric acid for differentiation for 3 seconds, wash it with pure water for 5 seconds, and finally blue it with ammonia water for 4 minutes. Subsequently, perform gradient dehydration in the order shown in the table. Add neutral balsam, cover with a coverslip for mounting, avoiding air bubbles.

[0106] II. Immunoblotting

[0107] 1. Reagent Preparation

[0108] RIPA Protein Lysis Buffer: 1 mL of RIPA, 10 μL of protease inhibitor; 1× SDS-PAGE Protein Loading Buffer: 1 mL of 5× SDS-PAGE Protein Loading Buffer, 4 mL of RIPA Protein Lysis Buffer; 1× Electrophoresis Buffer: 100 mL of SDS-PAGE Electrophoresis Solution (10×), made up to 1 L with distilled water; 1× Transfer Buffer: 100 mL of Western Blot Transfer Solution (10×), 200 mL of methanol, made up to 1 L with distilled water; 10% Upper Gel: 0.75 mL of upper gel solution, 0.75 mL of upper gel buffer, 15 μL of modified coagulant; 10% Lower Gel: 2.7 mL of lower gel solution, 2.7 mL of lower gel buffer, 60 μL of modified coagulant; 1× TBST Buffer: 100 mL of TBST Membrane Washing Solution (10×), made up to 1 L with distilled water; 5% Skim Milk Blocking Solution: 5 g of skim milk, 100 mL of 1× TBST Buffer.

[0109] 2. Immunoblotting Procedure

[0110] 2.1 Protein Extraction

[0111] Protein extraction from mouse tissues: Transfer the frozen sample to a 1.5 mL grinding tube and add 200 μL of RIPA Protein Lysis Buffer (containing protease inhibitor). Add 3 magnetic beads to each grinding tube, homogenize using a shaker, remove the magnetic beads after homogenization, let it stand in a 4°C refrigerator for 15 minutes, then centrifuge at 13,000 rpm for 15 minutes at 4°C, and pipette the supernatant into a 1.5 mL EP tube, which is the protein sample.

[0112] Protein extraction from cell tissues: Discard the medium in the 12-well plate, wash it three times with 1× PBS for 1 minute each time, add 50 μL of RIPA Protein Lysis Buffer (containing protease inhibitor), repeatedly scrape each well of the 12-well plate with a 200 μL pipette tip, then pipette the liquid in the pipette tip and the well plate into a 1.5 mL EP tube according to the label, centrifuge at 13,000 rpm for 15 minutes at 4°C, and pipette the supernatant into a 1.5 mL EP tube, which is the protein sample.

[0113] 2.2 Protein Concentration Measurement by BCA Method

[0114] In this study, a BCA protein quantification kit (Pierce BCA Protein Assay Kit) was used to determine the protein concentration. First, the BCA standard product (2 mg / mL) in the kit was serially diluted with normal saline to prepare standard solutions with concentration gradients of 0, 250, 500, 1000, and 2000 ng / μL. After thorough vortex mixing, the samples were centrifuged at 3,000 rpm for 3 min and stored at 4 °C for later use. Subsequently, the BCA working solution was prepared according to the ratio system of solution A to solution B at 100:2. After vortex mixing, the solution was centrifuged at 3000 rpm for 3 min and set aside for use.

[0115] Take 5 μL of each standard product and sample to be tested and add them to 200 μL EP tubes respectively. Add 100 μL of the pre-prepared BCA working solution according to a ratio of 1:20. After thorough mixing, centrifuge at 3000 rpm for 3 min, and then transfer to an incubator at 37 °C for 60 min. After the reaction is terminated, accurately add 80 μL of the reaction mixture to each well of the 96-well plate, and carefully record the sample loading position and order. The absorbance value of each well was measured at a wavelength of 560 nm using an enzyme-linked immunosorbent assay (ELISA) analysis system. A standard curve was constructed based on the standard product concentration and the corresponding OD value, and the correlation coefficient R2 of the linear regression equation was required to be ≥0.999. The protein concentration of each sample was calculated through the regression equation. After adjusting the sample concentration to 1000 ng / μL with RIPA lysis buffer, add 5×SDS-PAGE protein loading buffer according to a ratio of 1:4. After thorough vortex mixing of the diluted sample, centrifuge at 3000 rpm for 3 min, perform heat denaturation treatment in a boiling water bath for 7 min, and store at 4 °C in a refrigerator after natural cooling for subsequent experiments.

[0116] 2.3, SDS polyacrylamide gel electrophoresis

[0117] Clean the glass plates and the gel comb for making gels, assemble the glass plates according to the experimental requirements, add distilled water into the glass plates, place them on a horizontal table, and let them stand for 10 minutes to observe whether there is liquid leakage. Prepare the upper and lower gels, pour them into the glass plates, insert the gel comb, place them on a horizontal table, and wait for 30 minutes until the gel solidifies. Assemble the gel into a vertical electrophoresis tank, pour in the electrophoresis buffer, and vertically pull out the gel comb to ensure the integrity of the gel wells. Use a 1 mL syringe to aspirate the electrophoresis buffer and gently rinse the gel wells to flush out the impurities in the gel wells. According to the experimental arrangement, add 10 μL of the diluted protein sample to the gel wells, and add 5 μL of protein Marker. Add 1×loadbuffer to the empty wells. Set the voltage to 100 V. After the bromophenol blue band runs out of the upper gel, change the voltage to 150 V. Stop electrophoresis when the bromophenol blue band runs to the bottom of the gel.

[0118] 2.4, Transfer

[0119] Remove the gel plate from the electrophoresis tank, rinse the air bubbles on the glass plate surface clean, pry open the upper glass plate, cut off the upper gel part, the 1×loadbuffer channel, and the position below the bromophenol blue band with a gel cutter, and transfer it to the transfer buffer. Place the pre-cut 5 cm × 8 cm PVDF membrane in methanol solution for activation for 3 minutes, and then transfer it to the chilled transfer buffer. Install the clamping plate in the order of the black bottom plate, filter paper, gel, PVDF membrane, filter paper, and white bottom plate. After clamping, place it in the transfer tank, pour in the pre-chilled transfer buffer, set it to 150 mA, and transfer for 120 minutes.

[0120] 2.5. Antibody Incubation and Development

[0121] After the transfer is completed, take out the PVDF membrane, place it in Ponceau S solution for staining for 3 minutes, then rinse it with methanol, and observe the band position on the PVDF membrane. Wrap the PVDF membrane with plastic film, cut the PVDF membrane according to the molecular weight size of the reference protein Marker band and the target protein. Classify the cut PVDF membranes and put them into the incubation box, add 1×PBST and shake them on a room temperature shaker for 3 times, 5 minutes each time. Then block them with 5% skim milk on a room temperature shaker for 1 hour. After the blocking is completed, pour out the skim milk, add 1×PBST and shake them on a room temperature shaker for 3 times, 5 minutes each time. Add the corresponding antibody and incubate overnight on a 4°C shaker. Recover the antibody the next day, add 1×PBST and shake them on a room temperature shaker for 3 times, 5 minutes each time. Add the secondary antibody dilution solution prepared as per the question, and incubate on a room temperature shaker for 1 hour. After the incubation is completed, add 1×TBST and shake them on a room temperature shaker for 3 times, 5 minutes each time. Add 1×TBS and shake them on a room temperature shaker for 3 times, 5 minutes each time. In the darkroom, drop the developing solution on the PVDF membrane for development and take a photo for preservation.

[0122] The present invention found that under the condition of no drug induction, the results of immunohistochemistry and immunoblotting experiments showed that: neither in NSUN2-cKO mice nor in wild-type mice was the expression of CAS9 protein detected, and there was no significant difference in the expression level and distribution position of NSUN2 protein between the two, thus confirming that there was no systemic leakage expression in NSUN2-cKO mice.

[0123] Through immunohistochemistry experiments, the myometrium (labeled with α-SMA), glandular epithelium (labeled with FOXA2), vascular endothelium (labeled with CD31), luminal epithelium (labeled with TACSTD2), stromal cells (labeled with VIMENTIN), and cell proliferation (labeled with KI67) were detected and analyzed. It was found that there was no obvious difference in the signal expression of the above-mentioned markers between NSUN2-cKO mice and wild-type mice. This experimental result proved that the gene editing operation had no adverse effect on the uterine development and its structure of NSUN2-cKO mice.

[0124] Example 4 Verification of Gene Knockout Efficiency by In Vitro Induction

[0125] I. Isolation of Uterine Stromal Cells

[0126] After sacrificing the mouse by cervical dislocation, the uterus was removed and the mesentery and fat were removed. The uterus was cut open at the uterine horn and placed in HBSS washing solution, then transferred to the laminar flow hood. In the laminar flow hood, the uterine cervix was clamped with forceps and rinsed repeatedly in HBSS washing solution for 3 minutes, and then placed in System I. First, it was left standing at 4°C for 90 minutes, then at room temperature for 30 minutes, and finally digested at 37°C for 5 minutes. After digestion, the uterus was clamped out with forceps and rinsed repeatedly in HBSS washing solution for 3 minutes, and then placed in System II. It was left standing at room temperature for 20 minutes, and then placed in a 37°C water bath for digestion for 30 minutes. After digestion, it was shaken vigorously up and down 50 times, filtered through a 200-mesh sieve, and then centrifuged at 1200 rmp for 5 minutes. The supernatant was discarded, and the cells were resuspended with 10% FBS. According to the experimental needs, the cells were seeded into a cell culture plate, and the medium was changed after 6 hours.

[0127] Table 12 Preparation of Digestion System I

[0128]

[0129] Table 13 Preparation of Digestion System II

[0130]

[0131] II. In Vitro Culture of Mouse Uterine Stromal Cells

[0132] The extracted mouse uterine stromal cells were cultured in an incubator at 37°C. When the growth density reached 40%-50%, Dox induction was carried out. First, 1 mg of Dox powder was weighed and added to a 1.5 mL Eppendorf tube, and 1 mL of HBSS was added thereto. It was vortexed to dissolve it completely to obtain a Dox solution with a concentration of 1 mg / mL. Subsequently, induction media containing different concentrations of Dox were prepared with 2% FBS medium. The cells were washed twice with HBSS and added to the corresponding cell well plates in turn, shaken well by the cross method, and cultured in an incubator at 37°C. The medium was changed every two days.

[0133] After isolating the uterine stromal cells of NSUN2-cKO mice, the cells were induced with Dox at seven concentrations of 0, 1, 2, 4, 6, 8, and 10 μg / ml for 6 days. The results of immunoblotting experiments showed that Dox at each concentration could effectively induce the expression of CAS9 protein, and when the Dox concentration reached or exceeded 2 μg / ml, its induction effect was the most significant, and the knockout efficiency of NSUN2 also reached the highest level ( Figure 8 ).

[0134] On the other hand, cells were induced with a Dox concentration of 2 μg / mL, and cell proteins were extracted at three time points, namely the second, fourth, and sixth days after induction, for immunoblotting experiments. The experimental results showed that the expression of CAS9 protein could be detected on the second day after induction, and at the same time, the expression level of NSUN2 protein decreased slightly. By the fourth and sixth days, the expression level of CAS9 protein further increased, while the expression level of NSUN2 protein decreased significantly( Figure 9 ).

[0135] Example 5 Gene knockout effects induced by different methods

[0136] We used three induction strategies, namely gavage, intraperitoneal injection, and gavage combined with intrauterine injection, to verify the gene knockout effect of NSUN2-cKO mice. For each administration strategy, we selected 6 8-week-old NSUN2-cKO mice with similar body weights and randomly divided them into an experimental group and a control group. In the gavage group, the mice in the experimental group were continuously gavaged with 10 mg / mL Dox at a dose of 0.2 mL per day for 7 days, while the control group was gavaged with an equal volume of normal saline. In the intraperitoneal injection group, the mice in the experimental group were continuously intraperitoneally injected with 10 mg / mL Dox at a dose of 0.1 mL per day for 7 days, while the control group was intraperitoneally injected with the same volume of normal saline every day. In the gavage combined with intrauterine injection group, the mice in the experimental group were gavaged with 10 mg / mL Dox at a dose of 0.2 mL per day for 7 days. In addition, on the third and sixth days of the gavage combined with intrauterine injection group, the mice in the experimental group were also intrauterinely injected with 10 mg / mL Dox at a dose of 10 μL, while the mice in the control group were treated with normal saline in the same manner.

[0137] As Figures 10 - 15 shown, immunohistochemical experiments were used to explore the expression of CAS9 and NSUN2 proteins. The experimental results showed that the expression of CAS9 protein was not detected in the heart, liver, spleen, lung, kidney, brain, stomach, intestine, skeletal muscle, and ovary by gavage and intraperitoneal injection methods. The expression of CAS9 protein was observed in uterine stromal cells, accompanied by a downregulation of the expression level of NSUN2 protein. In uterine luminal epithelium and glandular epithelium, the expression of CAS9 protein was negative, and there was no significant difference in the NSUN2 protein level compared with the control group.

[0138] In the induction protocol of intragastric administration combined with intrauterine injection, the expression of CAS9 protein was not detected in the heart, liver, spleen, lungs, kidneys, brain, stomach, intestines, and skeletal muscles. The expression of CAS9 protein was observed in the ovarian corpus luteum, and the expression level of NSUN2 protein decreased slightly. The expression of CAS9 protein was observed in the uterine stromal cells, accompanied by a downregulation of the expression level of NSUN2 protein. At the same time, the expression of CAS9 protein was detected in the epithelial cells, and the knockout effect of the NSUN2 gene was good.

[0139] Example 6 Detection of the Safety of Tetracycline Induction during Pregnancy in Mice

[0140] Steps for detecting endogenous alkaline phosphatase: Place the prepared frozen sections on a slide warmer at 55 °C and bake for 3 minutes. Then transfer them to 4% paraformaldehyde and fix at room temperature for 30 minutes. After fixation, place them in 1×PBS and wash on a shaker at room temperature 3 times, 5 minutes each time. Then transfer them to 0.1% Triton-X100 for 20 minutes of perforation. After perforation, place them in 1×PBS and wash on a shaker at room temperature 3 times, 5 minutes each time. After washing, draw a wax circle on the slide according to the tissue position to surround the tissue, add the chromogenic solution, and develop color in the dark at room temperature for 7 minutes. After color development is completed, stop the color development by placing them in pure water, then add methyl green and counterstain for 10 minutes. Finally, mount the slides and take pictures.

[0141] We selected wild-type female mice as the research subjects and randomly divided 6 wild-type female mice into two groups. The treatment group received the induction treatment of intragastric administration combined with intrauterine injection of Dox; the untreated group was not given any treatment and served as the control group. After the induction, on the fifth day of pregnancy, we collected uterine samples from the two groups of mice and focused on observing and recording the number of embryo implantations. It was found that there was no difference in the number of embryo implantations between the treatment group and the untreated group, which preliminarily indicated that this induction method had no adverse effect on the process of embryo implantation ( Figure 16 ).

[0142] On the eighth day of pregnancy, the uteri of the two groups of mice were sampled. We not only observed and recorded the number of embryo implantations and the embryo weight, but also conducted a comparative analysis of these two indicators. It was found that there were no significant differences in the number of embryo implantations and the embryo weight between the treatment group and the untreated group. In addition, uterine tissues were collected, frozen sections were prepared for the embryo implantation sites, and alkaline phosphatase staining analysis was performed. The results showed that the staining intensity of endogenous alkaline phosphatase was the same between the treatment group and the untreated group, and no significant difference was observed, which further confirmed that this induction method had no significant effect on the process of uterine decidualization ( Figure 17 ).

[0143] In summary, the results of this part of the study demonstrated that the induction method of combining intragastric administration with intrauterine injection of Dox achieved uterine-specific gene editing without adverse effects on the fertility and pregnancy process of female mice, including embryo implantation and decidualization.

[0144] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A method for constructing TG sgNSUN2 mice, characterized in that Including the following steps: The fragment of U6-sgRNA(Nsun2)-egfpon1 was integrated into the mouse genome using the PiggyBAC transposase system, and then obtained by screening through genotype identification.

2. The method for constructing a TG sgNSUN2 mouse according to claim 1, characterized in that The sgRNA sequences targeting Nsun2 are shown in SEQ ID NO:1 and SEQ ID NO:

2.

3. Use of the TG according to claim 1 or 2 sgNSUN2 in the construction of knockout mice.

4. A method for constructing a time-controllable uterus-specific gene knockout mouse, characterized in that, Including the following steps: S1. Cross the Col1a1 TetO-Cas9 / TetO-Cas9 Rosa26 M2-rtTA / M2-rtTA female mice with Pgr ires-Cre / + male mice, and select and retain the F1 mice with the genotype of Col1a1 TetO-Cas9 / + Rosa26 M2-rtTA / + Pgr ires-Cre / + ; S2. Cross Rosa26 LSL-rtTA3 / LSL-rtTA3 female mice with Pgr ires-Cre / + male mice, and select and retain F1 mice with the genotype of Rosa26 LSL-rtTA3 / + Pgr ires-Cre / + ; S3. Mate the mice with the genotype of Col1a1 obtained in S1 TetO-Cas9 / + Rosa26 M2-rtTA / + Pgr ires-Cre / + and the mice with the genotype of Rosa26 obtained in S2 LSL-rtTA3 / + Pgr ires-Cre / + in a cage according to the sex ratio, and retain the F2-generation mice with the genotype of Col1a1 TetO-Cas9 / + Rosa26 LSL-rtTA3 / + Pgr ires-Cre / + and the mice with the genotype of Col1a1 TetO-Cas9 / + Rosa26 LSL-rtTA3 / + Pgr ires -Cre / ires-Cre ; S4. Cohabit the two types of F2 mice obtained in S3 according to the sex ratio, and screen and retain Col1a1 TetO-Cas9 / TetO- Cas9 Rosa26 LSL-rtTA3 / LSL-rtTA3 Pgr ires-Cre / ires-Cre gene-edited mice. Col1a1 obtained by the method according to claim 4 TetO-Cas9 / TetO-Cas9 Rosa26 LSL-rtTA3 / LSL-rtTA3 Pgr ires -Cre / ires-Cre Use of the gene-edited mouse in the development and / or screening of drugs for uterine-targeted gene therapy 6. The TG according to claim 1 or 2 sgNSUN2 The mouse is used in constructing Col1a1 obtained for verifying claim 4 TetO -Cas9 / TetO-Cas9 Rosa26 LSL-rtTA3 / LSL-rtTA3 Pgr ires-Cre / ires-Cre Application in a tool mouse for gene knockout efficiency of a gene-edited mouse 7. The application according to claim 5, wherein Col1a1 TetO-Cas9 / TetO-Cas9 Rosa26 LSL -rtTA3 / LSL-rtTA3 Pgr ires-Cre / ires-Cre Mice were mated with TG sgNSUN2 mice to obtain female mice with the genotype Col1a1 TetO-Cas9 / + Rosa26 LSL-rtTA3 / + Pgr ires-Cre / + TG sgNSUN2 These female mice can be used as tool mice to verify the gene knockout efficiency of Col1a1 TetO-Cas9 / TetO- Cas9 Rosa26 LSL-rtTA3 / LSL-rtTA3 Pgr ires-Cre / ires-Cre gene-edited mice.

Images