Beta-galactosidase mutant E935V with enhanced activity and regulated and controlled by salt solution and application of beta-galactosidase mutant E935V

Abstract

The invention discloses a beta-galactosidase mutant E935V with enhanced activity and regulated and controlled by a salt solution and application of the beta-galactosidase mutant E935V. The amino acid sequence of the mutant is shown as SEQ ID NO. 1. When the salt is not added, the hydrolytic activity of p-nitrophenyl-beta-D-galactopyranoside (pNPG) of E935V is only 25.34% of that of the recombinant wild enzyme, while the activity of the mutant E935V in a salt adding system is obviously improved, and the maximum specific enzyme activity after improvement reaches 77.97 U / mg and is improved by 22.88% compared with that of the recombinant wild enzyme when the salt is not added. In 200 mM of KBr, the hydrolytic activity of the pNPG is improved by 3.9 times, and the hydrolytic activity of the pNPG on lactose is improved by 3.6 times. The mutant is suitable for a technical application scene in which the enzymatic reaction rate needs to be adjusted, the reaction efficiency and controllability are improved, and a better solution is provided for enzyme catalysis application in the fields of agriculture, food processing, biotechnology and the like.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and particularly relates to a β-galactosidase mutant E935V with enhanced activity and regulated by salt solution and its application. Background Art

[0002] The catalytic activity of β-galactosidase (β-galactosidase; EC 3. 2. 1. 23) has two types. One is to hydrolyze the terminal galactose residue, and the other is to transfer the galactose molecule to different nucleophiles containing hydroxyl groups to carry out galactose transglycosylation (Liu P., et al. Critical Reviews in Food Science and Nutrition, 2025, 65(7): 1306-1325.). With this bifunctional property, β-galactosidase exhibits unique application values in multiple fields. In agriculture, β-galactosidase can affect fruit softening by degrading the cell wall, providing the possibility of artificially controlling the texture of pulp (Yu Qinpei, et al. Acta Agriculturae Zhejiangensis, 2024, 36(09): 2184-2192.); in the field of food industry, the bifunctional property of β-galactosidase is particularly prominent. On the one hand, through hydrolysis, it can remove lactose in dairy products to meet the special needs of lactose-intolerant people; on the other hand, using its transglycosylation activity, it can synthesize functional galactooligosaccharides (GOS). Such prebiotic substances have been proven to have multiple physiological effects such as promoting intestinal health, enhancing immunity and regulating metabolic functions (Singh R. V., et al. Chemical Papers, 2023, 77(1): 11-31.). Therefore, it has broad application prospects in the fields of functional food development, livestock breeding, etc. In the field of biotechnology, β-galactosidase breaks through the traditional utilization of its catalytic function and is innovatively developed as the core component of a biosensor. The detection system constructed based on the enzyme-substrate specific reaction can achieve rapid detection of Escherichia coli and plays an important role in the dairy wastewater treatment process, fully reflecting its environmental-friendly biological treatment advantages (Ozarslan S, et al. International Food Research Journal, 2022, 29(4): 864-871.).

[0003] During the application of enzymes, it is difficult to avoid the presence of a certain concentration of salt solution in the production system. Most enzymes do not have salt tolerance, and the activity of enzymes is greatly affected by the salt in the system. A relatively high concentration of salt solution will inhibit enzyme activity or destroy the spatial structure of the enzyme, causing it to become inactivated (Wang B. R., et al. International Journal of Biological Macromolecules, 2024, 278). Therefore, the problem of low industrial production efficiency caused by the influence of salt solution on enzyme activity needs to be solved urgently.

[0004] In summary, developing an enzyme with enhanced activity and regulated by salt solution can be better applied to industrial production containing salt, which can improve product quality, reduce costs and increase efficiency. Summary of the Invention

[0005] The present invention aims to provide a β-galactosidase mutant with enhanced activity and regulated by salt solution, which can controllably regulate the efficiency of enzymatic reactions and is applicable to a variety of technical application scenarios that require adjusting the rate of enzymatic reactions through the concentration of salt solution.

[0006] To achieve the above invention object, the present invention provides a β-galactosidase mutant E935V with enhanced activity and regulated by salt solution, which is obtained by mutating the glutamic acid at position 942 of the recombinant wild-type β-galactosidase 1DP0 to valine, and the amino acid sequence of this mutant is shown in SEQ ID NO.1.

[0007] The present invention also provides a coding gene encoding the above-mentioned β-galactosidase mutant E935V with enhanced activity and regulated by salt solution e935v , and its nucleotide sequence is shown in SEQ ID NO.2.

[0008] The present invention also provides a recombinant expression vector carrying the above-mentioned coding gene, and this vector is preferably selected from the pET series, more preferably pET-28a(+).

[0009] The present invention also provides a host bacterium carrying the above-mentioned recombinant expression vector, and this bacterium is preferably selected from Escherichia coli, more preferably BL21(DE3).

[0010] The activity of this mutant is enhanced and regulated by salt solution, and it can be better applied to technical fields that require controlling enzyme activity through the concentration of salt solution, especially applicable to the fields of agriculture, food processing, animal husbandry and biotechnology.

[0011] The present invention also provides a method for regulating the lactose hydrolysis activity of the mutant E935V. By adding salts to the reaction system, the lactose hydrolysis activity of the mutant E935V can be enhanced. In particular, adding 200 mM of KBr to the reaction system can significantly improve the lactose hydrolysis activity.

[0012] The β-galactosidase mutant E935V with enhanced activity and regulated by salt solution provided by the present invention has the following advantages: The hydrolysis activity of p-nitrophenyl-β-D-galactopyranoside (hereinafter referred to as pNPG) of this mutant is only 25.34% of that of the recombinant wild enzyme, but it has the characteristic of being activated by salt solution. The pNPG hydrolysis activity in medium and low concentrations of KNO3, NaNO3, KBr, NaBr, KI, and NaI solutions is significantly improved, with a maximum increase of 3.9 times. The optimal temperatures of the recombinant wild enzyme and the mutant E935V are 45 °C and 30 °C respectively, and the optimal pH values are 7.5 and 7 respectively. When the concentrations of KNO3, NaNO3, KBr, and NaBr solutions are lower than 1 M and the concentrations of KI and NaI solutions are lower than 100 mM, the pNPG hydrolysis activity of the recombinant wild enzyme does not change significantly or is inhibited to a certain extent, while the mutant E935V shows different degrees of activation in the above solutions, and the activation effects of KNO3, KBr, and NaBr are the most obvious. In the KNO3 solution with a final concentration of 75 - 200 mM and the NaBr solution with a final concentration of 70 - 300 mM, the pNPG hydrolysis activity of E935V tends to increase steadily, with an average increase of about 3 times, reaching the activity level of the recombinant wild enzyme without adding salt, and the activity differences among different groups in this concentration range are not obvious; in the KBr solution with a final concentration of 70 - 300 mM, the pNPG hydrolysis activity of the mutant is increased by 5.95 - 14.52 U / mg compared with the recombinant wild enzyme without adding salt, with a maximum increase of 22.88%, a 3.9-fold increase compared with itself without adding salt, and the lactose hydrolysis activity is increased by up to 3.6 times compared with itself without adding salt, showing a significant salt-dependent activity enhancement. Description of the Drawings

[0013] Figure 1 This is the result of the activity determination of the recombinant wild enzyme 1DP0 and the mutant E935V in the present invention under different pH conditions.

[0014] Figure 2 This is the result of the activity determination of the recombinant wild enzyme 1DP0 and the mutant E935V in the present invention under different temperature conditions.

[0015] Figure 3 This is the change of the activity of the recombinant wild enzyme 1DP0 (a) and the mutant E935V (b) in the KNO3 solution with a final concentration of 20 - 500 Mm in the present invention.

[0016] Figure 4 Changes in the activity of recombinant wild enzyme 1DP0 (a) and mutant E935V (b) in the present invention in a solution with a final concentration of 20 - 1000 mM NaNO3.

[0017] Figure 5 Changes in the activity of recombinant wild enzyme 1DP0 (a) and mutant E935V (b) in the present invention in a solution with a final concentration of 20 - 1000 mM KBr.

[0018] Figure 6 Changes in the activity of recombinant wild enzyme 1DP0 (a) and mutant E935V (b) in the present invention in a solution with a final concentration of 20 - 1000 mM NaBr.

[0019] Figure 7 Changes in the activity of recombinant wild enzyme 1DP0 (a) and mutant E935V (b) in the present invention in a solution with a final concentration of 5 - 100 mM KI.

[0020] Figure 8 Changes in the activity of recombinant wild enzyme 1DP0 (a) and mutant E935V (b) in the present invention in a solution with a final concentration of 5 - 100 mM NaI.

[0021] Figure 9 Differences in the lactose hydrolysis activity of mutant E935V in the present invention without salt addition and with a final concentration of 200 mM KBr.

[0022] Figure 10 TLC analysis of the lactose hydrolysis products of mutant E935V in the present invention without salt addition and with a final concentration of 200 mM KBr. Detailed implementation manners

[0023] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0024] Some experimental materials and reagents used in the present invention: 1) Strains and vectors: The competent cells BL21(DE3) and the expression vector pET - 28a(+) used in this study were both purchased from Beijing Tsingke Biotechnology Co., Ltd.

[0025] 2) Enzymes and other biochemical reagents: p-nitrophenyl-β-D-galactopyranoside (pNPG) was purchased from Shanghai Yuanye Bio-Technology Co., Ltd.; Nickel-NTA protein purification resin was purchased from QIAGEN; Plasmid Mini Kit was purchased from Omega; QuickMutation TM Site-directed mutagenesis kit was purchased from Beyotime Biotechnology Co., Ltd.; DpnⅠ digestion enzyme was purchased from Beyotime Biotechnology Co., Ltd.; Low molecular weight standard protein Marker was purchased from Takara Biotechnology Co., Ltd.; Isopropyl-β-D-thiogalactoside (IPTG) was purchased from Solarbio Science & Technology Co., Ltd.; Lactose was purchased from Tianjin Damao Chemical Reagent Factory; Glucose detection kit was purchased from Shanghai Yuanye Bio-Technology Co., Ltd.; TLC plates were purchased from Qingdao Ocean Chemical Co., Ltd., and the rest of the reagents were of analytical grade.

[0026] 3) LB medium: Weigh accurately 10 g of Trypone, 5 g of Yeast extract, and 10 g of NaCl, dissolve them in 1000 mL of distilled water, and the pH is natural (about 7.0). 2.0% (w / v) agar is added to the solid medium.

[0027] Note: For the molecular biology experimental methods not specifically described in the following examples, they are all carried out with reference to the specific methods listed in "Molecular Cloning: A Laboratory Manual" (Third Edition) by J. Sambrook, or according to the kit and product instructions.

[0028] Experimental Example 1 Preparation of Mutant E935V, Construction and Transformation of Expression Vector 10) Download the amino acid sequence of β-galactosidase 1DP0 (see SEQ ID NO.3, accession number: AAA24053.1) and its corresponding nucleotide sequence from the GenBank database 1dp0 (see SEQ ID NO.4, accession number: J01636.1:1284-4358).

[0029] 11) Entrust Beijing Tsingke Biotechnology Co., Ltd. to 1dp0 optimize, transform, synthesize and construct recombinant plasmids for the 1dp0 sequence. First, optimize the codons and GC content of the 1dp0-opt sequence to obtain the optimized sequence 1dp0-opt (see SEQ ID NO.5). Add five nucleotides (CCATG) and the coding sequence of 6× histidine His tag before the start codon of s1dp0-opt(see SEQ ID NO.6), and synthesize it. Finally, to avoid introducing redundant nucleotide sequences into the recombinant wild enzyme gene sequence, seamless cloning was used to ligate the synthesized s1dp0-opt with the pET-28a(+) vector to construct the recombinant plasmid s1dp0-opt -pET-28a(+).

[0030] 12) The recombinant plasmid s1dp0-opt -pET-28a(+) was transformed into Escherichia coli BL21(DE3) competent cells by the conventional heat shock transformation method, and finally the recombinant expression strain BL21(DE3) / s1dp0-opt gene was obtained. This strain can express the recombinant wild enzyme, and its amino acid sequence is shown in SEQ ID NO.7. s1dp0-opt

[0031] 2) The strain BL21(DE3) / s1dp0-opt- carrying the recombinant plasmid s1dp0- opt pET-28a(+) obtained above was inoculated into LB medium containing 50 μg / mL kanamycin at a content of 0.1% and cultured overnight at 37 °C and 180 rpm. The plasmid s1dp0 - opt -pET-28a(+) was extracted using a plasmid miniprep kit.

[0032] 3) Using the recombinant expression plasmid s1dp0-opt -pET-28a(+) as a template, mutant primers were designed using the Novizan online primer design website (https: / / crm.vazyme.com / cetool / singlepoint.html). The specific sequences are shown below, and the designed primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd.

[0033] Forward primer F (SEQ ID NO.8): TGTTTCCGAGCGTGAACGGTCTGCGTTGCGGT; Reverse primer R (SEQ ID NO.9): GTTCACGCTCGGAAACACGTACGGAGTGTACA.

[0034] Using QuickMutation TMMutagenesis was performed using a site-directed mutagenesis kit. The PCR reaction parameters were as follows: pre-denaturation at 95 °C for 3 min; then denaturation at 95 °C for 30 sec, annealing at 65 °C for 3 sec, extension at 68 °C for 8 min, with 20 cycles; extension at 68 °C for 15 min for completion; and finally cooling at 4 °C for 30 min. PCR amplification yielded a recombinant plasmid containing e935v the sequence e935v -pET-28a(+), which can express the mutant E935V in the host bacterium.

[0035] 4) The PCR product was digested with DpnⅠ enzyme at 37 °C for 3 h to remove the non-mutated template DNA.

[0036] 5) Transformation and identification: The digested product was transformed into Escherichia coli BL21(DE3) competent cells by heat shock transformation to obtain the recombinant strain BL21(DE3) / e935v carrying the coding gene e935v . Subsequently, sequencing was performed by Kunming Sangon Biotech Co., Ltd. The sequencing results confirmed that the nucleotide sequence of the mutant E935V was as shown in SEQ ID NO.2, and at the same time, its amino acid sequence was as shown in SEQ ID NO.1. Compared with the amino acid sequence of the recombinant wild enzyme (SEQ ID NO.7), the glutamate at position 942 of the mutant E935V was mutated to valine, that is, the glutamate at position 935 of the wild enzyme 1DP0 was mutated to valine.

[0037] Note: E935 refers to the glutamate at position 935 of the wild-type β-galactosidase 1DP0 (SEQ ID NO.3) including the signal peptide; E935V refers to the mutation of the glutamate at position 942 of the recombinant wild enzyme 1DP0 (SEQ ID NO.7) to valine, and the mutated amino acid sequence is as shown in SEQ ID NO.1.

[0038] E935V (SEQ ID NO.1):

[0039] E935V coding gene sequence (SEQ ID NO.2):

[0040] Amino acid sequence of wild enzyme 1DP0 (SEQ ID NO.3):

[0041] Coding sequence of wild enzyme 1DP0 1dp0 (SEQ ID NO.4):

[0042] 1dp0 Optimized sequence (SEQ ID NO.5):

[0043] 1dp0 Optimized and modified sequence (SEQ ID NO.6):

[0044] Recombinant wild-type enzyme 1DP0 (SEQ ID NO.7):

[0045] Experimental Example 2 Preparation of Recombinant Wild-Type β-Galactosidase 1DP0 and Mutant E935V 1) The recombinant strains BL21(DE3) / s1dp0-opt and BL21(DE3) / e935v obtained in Experimental Example 1 were respectively inoculated into LB medium containing 50 μg / mL kanamycin at an inoculation amount of 0.1%, and cultured with shaking at 37 °C and 180 rpm in a shaker for 12 h for activation.

[0046] 2) The activated bacterial solutions were respectively inoculated into fresh LB (containing 50 μg / mL kanamycin) culture solutions at an inoculation amount of 1%, and cultured with shaking at 37 °C and 180 rpm in a shaker for about 2 - 3 h until OD 600 reached 0.6 - 0.8. Subsequently, IPTG with a final concentration of 0.7 mM was added for induction, and the culture was continued with shaking at 20 °C and 160 rpm in a shaker for about 20 h to induce the expression of recombinant proteins.

[0047] 3) After the induction culture was completed, the cells were centrifuged at 4 °C and 6000 rpm for 8 min to collect the bacterial cells. Subsequently, the bacterial cells were resuspended with an appropriate amount of 0.2 M McIlvaine buffer (pH = 7.0), and ultrasonically disrupted under low-temperature water bath conditions. After the disrupted cell homogenate was centrifuged at 12000 rpm for 30 min, the supernatant was aspirated as the crude enzyme solution. The target protein was purified using a Nickel-NTA Agarose affinity chromatography column with an imidazole gradient elution of 0 - 500 mM.

[0048] 4) The protein samples obtained above were added to the McIlvaine buffer dialysis solution with pH = 7.0 according to a volume ratio of 1:100 for dialysis. The dialysis bag (mw: 14000) was cut into small segments of appropriate length (10 - 20 cm), boiled in boiling water for 30 min, and thoroughly washed with double-distilled water. The purified recombinant wild-type enzyme 1DP0 and mutant E935V obtained in 3) were respectively loaded into the dialysis bag, and 3 - 5 cm of length was reserved at both ends of the dialysis bag and sealed with a dialysis clip. The dialysis samples were placed in the dialysis buffer and dialyzed at 4 °C. The dialysis solution was changed every 2 h, and a total of 3 changes were made.

[0049] Experimental Example 3 Characterization of Recombinant Wild-Type β-Galactosidase 1DP0 and Mutant E935V The enzyme activity was determined by the pNP method, using p-nitrophenyl-β-D-galactopyranoside (pNPG) as the substrate to measure the activities of the recombinant wild-type enzyme 1DP0 and the mutant E935V. First, a pNPG solution with a final concentration of 2 mM was prepared and adjusted to the required pH with a buffer. The reaction system included 50 μL of the enzyme solution and 200 μL of the 2 mM pNPG substrate. The substrate was preheated at the reaction temperature for 5 min, 50 μL of appropriately diluted enzyme solution was added, and the reaction was terminated after 10 min by adding 750 μL of 1 M Na2CO3. After the reaction mixture was cooled to room temperature, the amount of released pNP was measured at a wavelength of 405 nm. At the same time, a control was set for each group, that is, 750 μL of 1 M Na2CO3 was added first and then the enzyme solution was added.

[0050] One enzyme activity unit (U) is defined as the amount of enzyme required to decompose the substrate to produce 1 μmol of pNP per minute.

[0051] Method for determining enzyme activity: The calculation formula for enzyme activity is as follows: Enzyme activity (U / mL) = c×n / (t×V) Where: c is the amount of p-nitrophenol after the enzyme reaction calculated from the p-nitrophenol standard equation (μmol); n is the dilution factor of the enzyme solution; t is the reaction time of the enzyme and the substrate (min); V is the volume of the enzyme solution participating in the reaction (mL).

[0052] 1) Determination of the activities of the recombinant wild-type enzyme 1DP0 and the mutant E935V under different pH conditions by the pNP method At 37 °C, using 0.2 M McIlvaine buffer (pH = 4.0, 5.0, 6.0, 6.5, 7.0, 7.5, 8.0) and 0.2 mM glycine–NaOH (pH = 9.0) buffer, with pNPG as the substrate, the reaction was carried out for 10 min, and the enzyme activities of the recombinant wild-type enzyme 1DP0 and the mutant E935V were measured. The obtained results are as Figure 1 shown. The optimal pH values of the wild-type enzyme 1DP0 and the mutant E935V are 7.5 and 7, respectively.

[0053] 2) Determination of the thermal activities of the recombinant wild-type enzyme 1DP0 and the mutant E935V by the pNP method In a buffer with pH = 7.0, with pNPG as the substrate, the reaction temperature range was 10 - 60 °C, the reaction was carried out for 10 min, and the enzyme activities of the purified recombinant wild-type enzyme 1DP0 and the mutant E935V were measured. The obtained results are as Figure 2 shown. The optimal temperature values of the wild-type enzyme 1DP0 and the mutant E935V are 45 °C and 30 °C, respectively. Compared with the recombinant wild-type enzyme 1DP0, the optimal temperature of the mutant E935V decreased by 15 °C.

[0054] 3) Activity measurement of recombinant wild enzyme 1DP0 and mutant E935V in KNO3 by pNP method Under the conditions of the optimal pH and 37 °C, using p-nitrophenyl-β-D-galactopyranoside (pNPG) as the substrate, add KNO3 with final concentrations of 0, 20, 50, 75, 100, 120, 150, 200, 300, 400, 500 mM, and then add appropriately diluted enzyme solution and react for 10 minutes. Subsequently, measure the enzyme activities of wild enzyme 1DP0 and mutant E935V in KNO3 with different concentrations.

[0055] The obtained results are as Figure 3 shown, where a is the measurement result of recombinant wild enzyme 1DP0, and b is the measurement result of mutant E935V. The results show that when the final concentration range of KNO3 is 0 - 500 mM, the activity of recombinant wild enzyme 1DP0 does not change significantly. On the contrary, the activity of E935V mutant shows an obvious activation phenomenon. When the final concentration of KNO3 is 75 - 200 mM, compared with the condition without adding salt, the enzyme activity of E935V tends to increase steadily, with an average increase of about 3 times, reaching the enzyme activity level of wild enzyme 1DP0 without adding salt, and the activity differences among different groups in this concentration range are not obvious.

[0056] 4) Activity measurement of recombinant wild enzyme 1DP0 and mutant E935V in NaNO3 by pNP method Under the conditions of the optimal pH and 37 °C, using p-nitrophenyl-β-D-galactopyranoside (pNPG) as the substrate, add NaNO3 with final concentrations of 0, 20, 50, 100, 120, 150, 200, 300, 500, 1000 mM, and then add appropriately diluted enzyme solution and react for 10 minutes. Subsequently, measure the enzyme activities of wild enzyme 1DP0 and mutant E935V in NaNO3 with different concentrations.

[0057] The obtained results are as Figure 4 shown, where a is the measurement result of recombinant wild enzyme 1DP0, and b is the measurement result of mutant E935V. The results show that when the final concentration range of NaNO3 is 0 - 1000 mM, the enzyme activity of recombinant wild enzyme 1DP0 does not change significantly with the increase of NaNO3 concentration. While for E935V, when the final concentration of NaNO3 is 50 - 200 mM, its specific activity is increased by more than 1 time compared with the environment without adding salt.

[0058] 5) Activity measurement of recombinant wild enzyme 1DP0 and mutant E935V in KBr by pNP method Under the optimal pH and 37 °C conditions, using p-nitrophenyl-β-D-galactopyranoside (pNPG) as the substrate, add KBr with final concentrations of 0, 20, 50, 70, 100, 120, 150, 200, 300, 500, 800, 1000 mM, then add appropriately diluted enzyme solution and react for 10 minutes. Subsequently, measure the enzyme activities of wild-type enzyme 1DP0 and mutant E935V in KBr with different concentrations.

[0059] The results obtained are as Figure 5 shown. Among them, a is the measurement result of recombinant wild-type enzyme 1DP0, and b is the measurement result of mutant E935V. The results show that when the final concentration range of KBr is 0 - 1000 mM, the enzyme activity of recombinant wild-type enzyme 1DP0 remains basically unchanged. On the contrary, the specific activity of mutant E935V in the KBr solution with a final concentration of 70 - 300 mM exceeds the enzyme activity of the wild-type enzyme in the salt-free system, with an increase of 5.95 - 14.52 U / mg, and the maximum increase is 22.88%.

[0060] 6) Measuring the activities of recombinant wild-type enzyme 1DP0 and mutant E935V in NaBr by the pNP method Under the optimal pH and 37 °C conditions, using p-nitrophenyl-β-D-galactopyranoside (pNPG) as the substrate, add NaBr with final concentrations of 0, 20, 50, 70, 100, 120, 150, 200, 300, 500, 800, 1000 mM, then add appropriately diluted enzyme solution and react for 10 minutes. Subsequently, measure the enzyme activities of wild-type enzyme 1DP0 and mutant E935V in NaBr with different concentrations.

[0061] The results obtained are as Figure 6 shown. Among them, a is the measurement result of recombinant wild-type enzyme 1DP0, and b is the measurement result of mutant E935V. The results show that in the KBr reaction system with a final concentration of 0 - 1000 mM, the activity of recombinant wild-type enzyme 1DP0 does not change significantly. The E935V mutant shows a phenomenon of NaBr concentration-dependent change in enzyme activity. When the final concentration of NaBr in the system is 150 mM - 300 mM, its specific activity is increased by about 3 times compared with the salt-free condition and is close to the activity of wild-type 1DP0 in the salt-free system.

[0062] 7) Measuring the activities of recombinant wild-type enzyme 1DP0 and mutant E935V in KI by the pNP method Under the conditions of the optimal pH and 37 °C respectively, using p-nitrophenyl-β-D-galactopyranoside (pNPG) as the substrate, add KI with final concentrations of 0, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 mM, then add an appropriately diluted enzyme solution and react for 10 minutes. Subsequently, measure the enzyme activities of the wild-type enzyme 1DP0 and the mutant E935V in KI with different concentrations.

[0063] The results obtained are as Figure 7 shown. Among them, a is the measurement result of the recombinant wild-type enzyme 1DP0, and b is the measurement result of the mutant E935V. The results show that when KI is added to the reaction system, the enzyme activity of the recombinant wild-type enzyme 1DP0 decreases to a certain extent. For the mutant E935V, when the KI concentration is lower than 80 mM, the enzyme activity increases with the increase of the KI concentration, and it has the highest specific activity in KI with a final concentration of 80 mM, which is 1.96 times higher than that without adding salt. When the KI concentration is greater than 80 mM, the enzyme activity of the mutant gradually decreases, indicating that high-concentration KI will inhibit E935V.

[0064] 8) Activity measurement of recombinant wild-type enzyme 1DP0 and mutant E935V in NaI by pNP method Under the conditions of the optimal pH and 37 °C respectively, using p-nitrophenyl-β-D-galactopyranoside (pNPG) as the substrate, add NaI with final concentrations of 0, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 mM, then add an appropriately diluted enzyme solution and react for 10 minutes. Subsequently, measure the enzyme activities of the wild-type enzyme 1DP0 and the mutant E935V in NaI with different concentrations.

[0065] The results obtained are as Figure 8 shown. Among them, a is the measurement result of the recombinant wild-type enzyme 1DP0, and b is the measurement result of the mutant E935V. The results show that when NaI with a final concentration of 0 - 100 mM is added to the reaction system, the enzyme activity of the recombinant wild-type enzyme 1DP0 is inhibited to a certain extent. For the mutant E935V, its enzyme activity is activated to a certain extent in NaI with a final concentration of 5 - 90 mM, and when the final concentration of NaI is 100 mM, the enzyme activity starts to be lower than that in the salt-free environment.

[0066] Experimental Example 4 Effect of KBr on the lactose hydrolysis activity of mutant E935V and product analysis 1) Measurement of the lactose hydrolysis activity of mutant E935V without adding salt and in KBr The lactose hydrolysis activity was detected by the glucose oxidase-peroxidase (GOD-POD) method. In the reaction system, a salt-free group and a 200 mM KBr treatment group were respectively set up, and the constant temperature reaction was carried out at 37 °C for 70 min. After terminating the reaction by boiling water bath treatment for 5 min, 20 μL of the reaction solution was taken, and a GOD-POD kit was used for quantitative detection of glucose. The experiment was set up with three replicates, and an enzyme-free reaction system was set as a blank control to exclude non-specific degradation. The enzyme activity unit was defined as the amount of enzyme required to catalyze the hydrolysis of lactose to produce 1 μmol of glucose per minute.

[0067] The results obtained were as Figure 9 shown. In 200 mM KBr, the hydrolysis activity of the mutant E935V towards lactose was significantly increased by 3.6 times compared to that without adding salt, and this activation effect was consistent with the results using pNPG as the substrate.

[0068] 2) Analysis of the hydrolysis products of lactose by the mutant E935V in the absence of salt and KBr The above reaction products were taken for thin-layer chromatography analysis. A silica gel G plate was used, and 2 μL of the sample was spotted. The developing agent was n-butanol:ethanol:ultrapure water = 5:3:2 (v / v). The color development was carried out using a diphenylamine system (1 g of diphenylamine, 50 mL of acetone, 1 mL of aniline, 5 mL of 85% phosphoric acid). After uniform soaking and drying, it was placed in an oven at 90 °C for color development for 15 min.

[0069] The results obtained were as Figure 10 shown. In the 200 mM KBr reaction system, the color development of the lactose characteristic spot was significantly weakened, while the color development intensities of the glucose and galactose characteristic spots were significantly increased. In the salt-free reaction system, the lactose characteristic spot maintained a high color development intensity, while the color development in the galactose and glucose regions was weak. It was indicated that 200 mM KBr significantly promoted the hydrolysis activity of E935V towards lactose.

[0070] In summary, the β-galactosidase mutant E935V with enhanced and regulated activity by salt solution provided by the present invention has an optimal temperature of 30 °C and an optimal pH of 7.0. Without adding salt, the hydrolysis activity of the mutant towards pNPG is only 25.34% of that of the wild-type enzyme 1DP0. When the concentrations of KNO3, NaNO3, KBr, and NaBr solutions are lower than 1 M and the concentrations of KI and NaI solutions are lower than 100 mM, the pNPG hydrolysis activity of the wild-type enzyme 1DP0 does not change significantly or is inhibited to a certain extent, while the mutant E935V shows activation to varying degrees. Among them, the activation effects of KNO3, KBr, and NaBr are the most obvious. In a KNO3 solution with a final concentration of 75 - 200 mM and a NaBr solution with a final concentration of 70 - 300 mM, compared with no salt addition, the pNPG hydrolysis activity of E935V tends to increase steadily, with an average increase of about 3 times, reaching the activity level of the wild-type enzyme 1DP0 without salt addition, and the activity differences among different groups in this concentration range are not significant. In a KBr solution with a final concentration of 70 - 300 mM, the pNPG hydrolysis activity of the mutant is increased by 5.95 - 14.52 U / mg compared with the recombinant wild-type enzyme in a salt-free system, the maximum increase in enzyme activity is 22.88%, and it is increased by 3.9 times compared with itself without salt addition. The hydrolysis activity towards lactose is increased by up to 3.6 times compared with itself without salt addition.

[0071] In view of the significant salt activation characteristics exhibited by the E935V mutant, in practical applications, the rate of enzymatic reactions can be enhanced and regulated by adjusting the concentration of the salt solution in its reaction environment. This characteristic shows broad application prospects in fields such as agriculture, food processing, animal husbandry, and biotechnology.

[0072] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be recognized that the above description should not be considered as a limitation of the present invention. After those skilled in the art have read the above content, various modifications and substitutions to the present invention will be obvious. Therefore, the protection scope of the present invention should be defined by the appended claims.

Claims

1. A β-galactosidase mutant E935V with enhanced activity and regulated by salt solution, characterized in that, The amino acid sequence of the mutant E935V is shown in SEQ ID NO.

1.

2. The coding gene of the β-galactosidase mutant E935V as described in claim 1 e935v , characterized in that The said e935v The nucleotide sequence of the encoding gene is shown in SEQ ID NO.

2.

3. A recombinant expression vector comprising the coding gene according to claim 2 e935v .

4. The recombinant expression vector according to claim 3, characterized in that, The vector is selected from pET-28a(+).

5. An expression bacterium containing the coding gene as described in claim 2 e935v .

6. The expression bacterium according to claim 5, wherein The bacterium is selected from Escherichia coli BL21(DE3).

7. Use of the mutant E935V according to claim 1 or the encoding gene according to claim 2 e935v in the field of industrial technologies.

8. The application according to claim 7, wherein The fields include agriculture, food processing, animal husbandry or / and the field of biotechnology.

9. A method for regulating the lactose hydrolysis activity of the mutant E935V as described in claim 1, characterized in that, Adding salt to the reaction system is used to improve the activity of the mutant E935V in hydrolyzing lactose.

10. The method according to claim 9, characterized in that, The salt is 200 mM KBr.

Images