Nucleic acid composition for detecting hematopoietic stem cells

Abstract

A nucleic acid composition for detecting hematopoietic stem cells includes CD45 antibody functionalized particles (such as magnetic beads) for capturing hematopoietic stem cells; the CD34 antibody functionalized P chain is used for being combined with the hematopoietic stem cells; and crRNA1, crRNA2, EA and a fluorescence signal probe, which are used for the cascade signal amplification of CRISPR / Cas mediation. Compared with a common CRISPR / Cas-based biosensing platform, the nucleic acid composition provided by the invention utilizes a CRISPR / Cas12a regulation strategy, has universality, not only provides a new scheme for inhibition / activation of a CRISPR / Cas12a system, but also increases the design flexibility of a Cas12-based biosensor, and provides a new path for development of a programmable CRISPR / Cas12a biosensing system.

Description

Technical Field

[0001] The present invention relates to a detection method, in particular to a detection method mediated by CRISPR / Cas for qualitative and quantitative detection of hematopoietic stem cells. Background Art

[0002] Hematopoietic stem cells can generate all cell lineages in the adult blood system, providing a flagship model for studying stem cell biology. Hematopoietic stem cells are also one of the few types of stem cells with a long history of clinical application, existing in the form of bone marrow transplantation, which has important guiding significance for studying various stem cells, including cancer stem cells. Hematopoietic stem cell transplantation has been widely used to treat various malignant blood diseases, genetic diseases, solid tumors, severe combined immunodeficiency diseases, etc. The sources of hematopoietic stem cells for clinical transplantation are peripheral blood, bone marrow, and umbilical cord blood. The reconstruction of hematopoietic function after transplantation mainly depends on the quantity and quality of the transplanted hematopoietic stem cells. Therefore, clinically rapid and accurate detection of the level of hematopoietic stem cells in the graft can ensure the success of transplantation and is of great significance in hematopoietic stem cell transplantation. Detecting the surface-specifically expressed CD34 molecule of hematopoietic stem cells in the test specimen can effectively count hematopoietic stem cells.

[0003] Due to its excellent flexibility at the cleavage site and rapid response, the CRISPR-Cas system has been widely used in gene editing and molecular diagnosis. Among them, Cas12a protein is one of the most well-known members of the Cas family, which can not only cleave specific double-stranded DNA in the presence of protospacer adjacent motif (PAM), but also cleave single-stranded DNA without selectivity. Cas12a protein has an extremely high enzyme turnover rate, allowing exponential signal amplification, and thus shows excellent sensitivity and specificity in molecular diagnosis. Detection methods based on CRISPR-Cas12a have achieved the detection of various markers, including viruses, proteins, and small molecule substances, etc. However, the precise control and programmable regulation of the trans-cleavage activity of Cas12a are still needed to promote the in-depth research and application expansion of the Cas12a sensing platform. In this context, it is very important to establish a new rapid and sensitive detection method for hematopoietic stem cells. Summary of the Invention

[0004] An object of the present invention is to provide a nucleic acid composition for detecting hematopoietic stem cells for efficient qualitative detection of hematopoietic stem cells.

[0005] Another object of the present invention is to provide a nucleic acid composition for detecting hematopoietic stem cells for efficient quantitative detection of hematopoietic stem cells.

[0006] A nucleic acid composition for detecting hematopoietic stem cells, comprising: CD45 antibody-functionalized particles (such as magnetic beads) for capturing hematopoietic stem cells; CD34 antibody-functionalized P strand for binding to hematopoietic stem cells; and crRNA1, crRNA2, EA, and fluorescent signal probes for CRISPR / Cas-mediated cascade signal amplification.

[0007] The nucleic acid composition of the present invention, the nucleic acid sequence contained in its P strand is as follows: 5'- AAAAAAAAAAGTCCGCCCTGAGTTAATGCTAATC-3'.

[0008] The nucleic acid composition of the present invention, the nucleic acid sequence contained in its crRNA1 is as follows: 5'-UAAUUUCUACUAAGUGUAGAUGAUUAGCAUUAACUCAGGGCGGAC-3'.

[0009] The nucleic acid composition of the present invention, the nucleic acid sequence contained in its crRNA2 is as follows: 5'- UAAUUUCUACUAAGUGUAGAUAGAUGUUUUACTCGGUUU-3'.

[0010] The nucleic acid composition of the present invention, the nucleic acid sequence contained in its EA is as follows: 5'- AAACCGAGTAAAACATCTTAATCTACAC -3'.

[0011] The nucleic acid composition of the present invention, the 5' end of its P strand is modified with a thiol group (-SH).

[0012] The nucleic acid composition of the present invention, the fluorescent signal probe includes an oligonucleotide, the 5' end of which is a fluorescent group and the 3' end is a quenching group. The oligonucleotide is 5 or more Ts, especially 5 or more and 20 or less Ts, such as: TTTTTTTTTT.

[0013] The nucleic acid composition of the present invention, the quenching group is BHQ.

[0014] The nucleic acid composition of the present invention, the fluorescent group is FAM.

[0015] Using the composition of the present invention, first use CD45 antibody-functionalized particles to capture hematopoietic stem cells, then use the CD34 antibody-functionalized P strand to bind to hematopoietic stem cells, then use CRISPR-Cas12a to mediate cascade signal amplification; finally, perform detection (such as fluorescent signal).

[0016] Specifically, the CD34 antibody-functionalized P strand recognizes crRNA1 in the first CRISPR / Cas12a and activates the trans-cleavage activity of the Cas12a protein, which can then indiscriminately cleave single-stranded DNA in the test sample, causing the fluorescence of the signal probe with a quenching group modified at one end and a fluorescent group modified at the other end to be restored, thereby generating a fluorescent signal; Meanwhile, the single-stranded fragment of the EA probe recognizes crRNA2 in the second CRISPR / Cas12a, attaches a short extended fragment at the 3' end, and cages the crRNA2 spacer / repeat junction region, thereby inhibiting the assembly of crRNA2 and Cas12a and exerting an inhibitory effect on the trans-cleavage activity of the CRISPR / Cas12a system. Due to the activation of the trans-cleavage activity of the Cas12a protein, the extended fragment single-stranded bulge fragment is chopped up, the blocked repeat region is released, activating the trans-cleavage activity of Cas12a, and the fluorescent group and quenching group of the signal probe are spatially separated from each other, generating a stronger fluorescent signal in the system.

[0017] The experimental conditions used for measuring the fluorescence emission intensity of the solution are: excitation wavelength 490 nm, emission wavelength scanning range 510 - 600 nm.

[0018] When hematopoietic stem cells are absent in the detection system, after magnetic separation of the CD34 antibody-functionalized nucleic acid P strand, it cannot remain on the magnetic beads. At this time, if CRISPR / Cas12a is added to the solution, the trans-cleavage activity of the Cas12a protein cannot be activated, and the cascade fluorescence signal amplification reaction cannot occur; finally, the fluorescent group and quenching group of the signal probe in the solution are spatially close to each other, and the fluorescence emission is weak.

[0019] By measuring the fluorescence signal intensity generated by the nucleic acid composition of the present invention in the test sample, quantitative detection of hematopoietic stem cells can be achieved.

[0020] The steps of CRISPR-Cas12a-mediated cascade signal amplification for the nucleic acid composition of the present invention include: First, add the P strand, crRNA1 (200 nM) and crRNA2 (200 nM) respectively targeting the two CRISPR / Cas systems, EA probe (400 nM), fluorescent signal probe (600 nM), and Cas12a protein (200 nM) to the centrifuge tube (in sequence); Subsequently, use DEPC water to adjust the total reaction volume to 100 μL and react at 37 °C for 40 - 60 minutes to allow Cas12a to complete the recognition and cleavage of the target sequence; Finally, incubate the reaction solution at 65 °C for 10 - 15 minutes to terminate the reaction.

[0021] After the reaction is completed, measure the final fluorescence emission intensity of the solution.

[0022] Compared with the prior art, the beneficial effects achieved by the technical solution of the present invention are as follows: The Cas12a protein has an extremely high enzyme turnover rate, allowing exponential signal amplification, and thus exhibits excellent sensitivity and specificity in the detection of various biomarkers.

[0023] Selecting sodium 4-(N-maleimidomethyl)cyclohexane-1-carboxylate sulfosuccinimide ester (Sulfo-SMCC) as the crosslinker for antibodies and activation probes has a high crosslinking efficiency, and different antibodies can be replaced according to the detection requirements to achieve the purpose of detecting different biomarkers.

[0024] A powerful and universal CRISPR / Cas12a regulation strategy was constructed. By attaching a short extended fragment to the 3'-end of the activating single strand, the assembly of crRNA and Cas12a was inhibited, and an excellent inhibitory effect on the trans-cleavage activity of CRISPR / Cas12a was achieved.

[0025] The cascading signal amplification of the combined use of two CRISPR / Cas12a systems significantly improves the cleavage efficiency of the CRISPR / Cas system, and realizes the sensitive detection of hematopoietic stem cells by combining fluorescence analysis technology.

[0026] Compared with various traditional cell routine quantification methods such as enzyme-linked immunosorbent assay and flow cytometry, the present invention provides a fluorescence detection nucleic acid composition based on the recognition and binding of hematopoietic stem cell surface markers CD34 and CD54 in combination with CRISPR / Cas for the highly sensitive detection of hematopoietic stem cells. The former not only relies on cumbersome experimental procedures and the skills and experience of operators, but also the detection results often have low accuracy, and false positive or false negative results may occur. The solution of the present invention is simple to operate, highly sensitive, and highly specific.

[0027] Compared with common CRISPR / Cas-based biosensing platforms, the composition of the present invention utilizes the CRISPR / Cas12a regulation strategy and has universality. It not only provides a new solution for the inhibition / activation of the CRISPR / Cas12a system, but also increases the design flexibility of Cas12-based biosensors, providing a new path for the development of programmable CRISPR / Cas12a biosensing systems. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is the schematic diagram for detecting hematopoietic stem cells of the present invention; Figure 2is the fluorescence spectrum; where, a represents the fluorescence emission peak of only the fluorescent probe in the system, b represents the fluorescence emission peak of the test solution without the P strand, c represents the fluorescence emission peak of a sample of a CRISPR / Cas system, and d represents the fluorescence emission peak of the sample solution when the P strand is present in the system and both CRISPR / Cas systems are present; Figure 3 is the fluorescence detection result graph of each detection system; Figure 4 is the fluorescence intensity response result graph of various cell concentrations; where, Figure A is the fluorescence detection result graph of hematopoietic stem cells at each concentration, and B is the fluorescence intensity response result graph of various cells at the same concentration. Specific implementation manners

[0029] The technical solution of the present invention will be described in detail below with reference to the accompanying drawings. The embodiments of the present invention are only used to illustrate the technical solution of the present invention and not to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solution of the invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solution of the present invention, and it should be covered by the scope of the claims of the present invention.

[0030] Figure 1 is the schematic diagram of the present invention for detecting hematopoietic stem cells. The specific method includes: (1) CD45 exists on the surface of all hematopoietic cells including hematopoietic stem cells. Therefore, carboxylated magnetic beads functionalized with CD45 antibody can specifically and efficiently enrich hematopoietic stem cells in the test sample at the magnetic bead interface.

[0031] (2) Subsequently, the nucleic acid P strand functionalized with CD34 antibody is fixed on the cell surface by recognizing the CD34 protein on the surface of hematopoietic stem cells on the magnetic beads for subsequent fluorescence signal amplification strategy.

[0032] (3) The design of the P strand is to recognize and activate the trans-cleavage activity of the Cas12a protein in the first CRISPR / Cas12a with crRNA1, thereby being able to cut the single-stranded DNA in the test sample without selection, so that the fluorescence of the signal probe modified with a quenching group BHQ at one end and a FAM fluorophore at the other end is restored, and thus a fluorescence signal is generated; at the same time, the single-stranded fragment of the EA probe in the second CRISPR / Cas12a can be cut off for the next-level fluorescence signal amplification.

[0033] (4)The design of the EA probe is to attach a short extended fragment at the 3' end based on the recognition of crRNA2 in the second CRISPR / Cas12a. In addition to the fragment complementary to crRNA2, the extended fragment also contains a single-stranded bulge fragment. This extended fragment can cage the spacer / repeat junction region of crRNA2, thereby inhibiting the assembly of crRNA2 and Cas12a, and inhibiting the trans-cleavage activity of the CRISPR / Cas12a system. However, thanks to the activation of the trans-cleavage activity of the Cas12a protein in the previous step, the single-stranded bulge fragment of the extended fragment is chopped up, and the blocked repeat region is released, activating the trans-cleavage activity of Cas12a. The fluorophore and quencher of the signal probe are spatially separated from each other, generating a stronger fluorescence signal in the system.

[0034] (5)When hematopoietic stem cells are absent in the detection system, after the nucleic acid probe P functionalized with the CD34 antibody is magnetically separated, it cannot remain on the magnetic beads. At this time, if CRISPR / Cas12a is added to the solution, the trans-cleavage activity of the Cas12a protein cannot be activated, and the cascade fluorescence signal amplification reaction cannot occur; finally, the fluorophore and quencher of the signal probe in the solution are close to each other spatially, and the fluorescence emission is weak.

[0035] (6)By measuring the fluorescence signal intensity in the test sample, quantitative detection of hematopoietic stem cells can be achieved.

[0036] Example 1 Based on the feasibility verification of the CRISPR / Cas system for cascade fluorescence signal amplification, the steps are as follows: The CRISPR-Cas12a cascade signal amplification process is as follows: Add the P strand, crRNA1 (200 nM) and crRNA2 (200 nM) required for the two CRISPR / Cas systems, 400 nM EA probe, 600 nM fluorescence signal probe, and 200 nM Cas12a to a centrifuge tube. Add DEPC water to make the final volume 100 μL. Finally, react at 37 °C for 40 - 60 minutes so that Cas12a can complete the recognition and cleavage of the target sequence, and then heat at 65 °C for 10 - 15 minutes to inactivate the enzyme. After the reaction is completed, measure the final fluorescence emission intensity of the solution.

[0037] The relevant oligonucleotide DNA strands and RNA sequences are as follows: P strand: 5'- SH-AAAAAAAAAAGTCCGCCCTGAGTTAATGCTAATC-3'.

[0038] crRNA1: 5'-UAAUUUCUACUAAGUGUAGAUGAUUAGCAUUAACUCAGGGCGG AC-3'.

[0039] crRNA2: 5'- UAAUUUCUACUAAGUGUAGAUAGAUGUUUUACTCGGUUU-3'.

[0040] EA: 5'- AAACCGAGTAAAACATCTTAATCTACAC -3'.

[0041] Fluorescent signal probe: 5'-FAM- TTTTTTTTTT -BHQ-3'.

[0042] The experimental conditions used when measuring the fluorescence emission intensity of the solution in step (d) are: excitation wavelength 490 nm, emission wavelength scanning range 510 - 600 nm.

[0043] The results are as Figure 2 shown. When there is a P strand in the system and both CRISPR / Cas systems are present, an obvious fluorescence emission peak is detected in the sample solution ( Figure 2 d); while in the blank control group, that is, when there is only the fluorescent probe and no P strand in the solution to be tested, only a very small background emission peak is detected in the sample solution ( Figure 2 a and 2b).

[0044] A control experiment with only the first CRISPR / Cas system was also carried out and it was found that in this case, there is also a fluorescence emission peak in the sample solution, but its intensity is far less than that of the combined CRISPR / Cas system ( Figure 2 c).

[0045] The above results prove that the P strand can cause a significant enhancement of the fluorescence emission of the solution, and this enhancement effect comes from the cascade CRISPR / Ca initiated by the P strand. The above results prove the feasibility of the combined CRISPR / Cas system method.

[0046] Example 2 Qualitative detection of hematopoietic stem cells is carried out as follows: (a)Preparation of antibody-functionalized magnetic beads. The specific process is as follows: Take 50 μL - 70 μL of commercially available functionalized magnetic particles and place them in a microtube. Add 100 μL - 200 μL of PBS (10 mM, pH 7.5), mix well and wash, then perform magnetic separation and discard the solution; repeat the above washing process three times. After magnetic separation to discard the supernatant, resuspend in 450 μL - 500 μL of buffer containing 77.6 mg / mL EDC and 11.5 mg / mL NHS, react at 25 °C for 30 min - 40 min, then perform magnetic separation and discard the solution. Add 100 μL - 150 μL of PBS (10 mM, pH 7.5), mix well and wash again, then perform magnetic separation. The activated carboxyl-functionalized magnetic beads obtained by magnetic separation are resuspended in 1 mL of PBS for standby. Subsequently, take 8 μL - 10 μL of CD45 antibody and 100 μL - 150 μL of the activated carboxyl-functionalized magnetic beads and mix them. React at 25 °C for 2 hours, then perform magnetic separation and discard the solution. Add 90 μL - 100 μL of 10 mM PBS (pH 7.5), mix well and wash again, then perform magnetic separation. The CD45 antibody-functionalized magnetic beads obtained by magnetic separation are resuspended in 1 mL of PBS (10 mM, pH 7.5) for standby.

[0047] (b)Preparation of CD34 antibody-functionalized P strand. The specific process is as follows: Incubate CD34 antibody (10 μL) with sulfo-SMCC (10 μL, 10 mM) in PBS (80 μL) at 30 °C for 1 hour. Meanwhile, react P strand (10 μL, 20 μM) with TCEP (10 μL, 200 μM) in PBS (80 μL - 100 μL) at 30 °C for 1 - 1.5 hours. Then, mix the activated antibody and nucleic acid P strand in a centrifuge tube and incubate at room temperature for 1.5 - 2 hours. Then transfer the mixture to a 30 kD ultrafiltration centrifuge tube and centrifuge at 14000 rpm for 10 - 15 minutes, repeat 3 times, and collect the upper filtrate as the antibody nucleic acid probe.

[0048] (c)Collect the cell suspension, centrifuge at 1000 rpm to collect the cells, wash them with PBS 2 - 3 times, and then resuspend. Mix the capture magnetic beads (100 μL) prepared in step (a) with the hematopoietic stem cell solution and incubate at room temperature for 1 - 1.5 hours, and wash twice with PBS. Then, mix the captured hematopoietic stem cells with the CD34 antibody-functionalized P strand and incubate at room temperature for 1 - 1.5 hours, and then rinse twice to remove the P strand that has not bound to the antibody.

[0049] (d) CRISPR-Cas12a cascade signal amplification process. The specific process is as follows: Add crRNA1 (200 nM) and crRNA2 (200 nM) required for the two CRISPR / Cas systems, 400 nM EA probe, 600 nM fluorescence signal probe, and 200 nM Cas12a to the above solution. Add DEPC water to make the final volume 100 μL, and react at 37 °C for 40 - 60 minutes. After Cas12a completes the recognition and cleavage of the target sequence, heat at 65 °C for 10 - 15 minutes to inactivate the enzyme. After the reaction, measure the final fluorescence emission intensity of the solution to achieve the detection of hematopoietic stem cells.

[0050] The relevant oligonucleotide DNA strands and RNA sequences are as follows: P strand: 5'-SH-AAAAAAAAAAGTCCGCCCTGAGTTAATGCTAATC-3'.

[0051] crRNA1: 5'-UAAUUUCUACUAAGUGUAGAUGAUUAGCAUUAACUCAGGGCGGAC-3'.

[0052] crRNA2: 5'-UAAUUUCUACUAAGUGUAGAUAGAUGUUUUACTCGGUUU-3'.

[0053] EA: 5'-AAACCGAGTAAAACATCTTAATCTACAC-3'.

[0054] Fluorescence signal probe: 5'-FAM-TTTTTTTTTT-BHQ-3'.

[0055] The experimental conditions used for measuring the fluorescence emission intensity of the solution in step (d) are: excitation wavelength 490 nm, emission wavelength scanning range 510 - 600 nm.

[0056] This method is used to detect the fluorescence signal intensity obtained when detecting 5×10 6 hematopoietic stem cells, as well as the fluorescence signals obtained in a series of control experiments as Figure 3 shown. When there are no hematopoietic stem cells in the system, the solution has only a very small background emission peak ( Figure 3 a), indicating that the added CD34 antibody-functionalized P strand can hardly be fixed on the magnetic beads, and the trans-cleavage activity of CRISPR / Cas is not activated.

[0057] In addition, when the reaction solution contains hematopoietic stem cells and only the first CRISPR / Cas reaction system ( Figure 3b), some fluorescence signals can be detected in the solution, indicating that the trans-cleavage activity of the first CRISPR / Cas system can be activated. Meanwhile, when the reaction solution contains hematopoietic stem cells and only the second CRISPR / Cas reaction system ( Figure 3 c), background fluorescence signals of a size comparable to that of the blank control are detected in the solution, indicating that the trans-cleavage activity of the second CRISPR / Cas reaction system is not activated. However, when both hematopoietic stem cells and the combined CRISPR / Cas system are present in the solution ( Figure 3 d) the highest fluorescence signal can be obtained, which not only proves the advantage of the combined CRISPR / Cas cascade signal amplification and can provide a new direction for detecting the number of rare hematopoietic stem cells in a complex biological environment, but also proves the excellent inhibitory effect of the EA probe on the trans-cleavage activity of CRISPR / Cas. That is to say, our method can be used for the fluorescence detection of hematopoietic stem cells.

[0058] Example 3 Verification of the fluorescence quantitative detection of hematopoietic stem cells is carried out as follows: (a) Preparation of antibody-functionalized magnetic beads. The specific process is as follows: Take 50 - 70 μL of commercial functionalized magnetic particles and place them in a microtube. Add 100 - 200 μL of PBS (10 mM, pH 7.5), mix well and wash, then perform magnetic separation and discard the solution; repeat the above washing process three times. After magnetically separating and discarding the supernatant, resuspend in 450 - 500 μL of a buffer containing 77.6 mg / mL EDC and 11.5 mg / mL NHS, react at 25 °C for 30 - 40 min, then perform magnetic separation and discard the solution. Add 100 - 150 μL of PBS (10 mM, pH 7.5), mix well and wash again, then perform magnetic separation. The activated carboxyl-functionalized magnetic beads obtained by magnetic separation are resuspended in 1 mL of PBS for later use. Subsequently, take 8 - 10 μL of CD45 antibody and 100 - 150 μL of the activated carboxyl-functionalized magnetic beads and mix them. React at 25 °C for 2 hours, then perform magnetic separation and discard the solution. Add 90 - 100 μL of 10 mM PBS (pH 7.5), mix well and wash again, then perform magnetic separation. The CD45 antibody-functionalized magnetic beads obtained by magnetic separation are resuspended in 1 mL of PBS (10 mM, pH 7.5) for later use.

[0059] (b) Preparation of CD34 antibody-functionalized P strand. The specific process is as follows: Incubate CD34 antibody (10 μL) with sulfo-SMCC (10 μL, 10 mM) in PBS (80 μL) at 30 °C for 1 hour. Meanwhile, react P strand (10 μL, 20 μM) with TCEP (10 μL, 200 μM) in PBS (80 - 100 μL) at 30 °C for 1 - 1.5 hours. Then, mix the activated antibody and nucleic acid probe P in a centrifuge tube and incubate at room temperature for 1.5 - 2 hours. After that, transfer the mixture to a 30 kD ultrafiltration centrifuge tube and centrifuge at 14000 rpm for 10 - 15 minutes. Repeat this process 3 times and collect the upper filtrate as the antibody nucleic acid probe.

[0060] (c) Collect the cell suspension, centrifuge at 1000 rpm to collect the cells, wash the cells with PBS 2 - 3 times, and resuspend the cells at different concentrations for subsequent analysis. Mix the prepared capture magnetic beads (100 μL) in step (a) with the hematopoietic stem cell solution and incubate at room temperature for 1 - 1.5 hours, and then wash twice with PBS. Then, mix the captured hematopoietic stem cells with the CD34 antibody-functionalized P strand and incubate at room temperature for 1 - 1.5 hours, and then wash twice to remove the P strands that have not bound to the antibody.

[0061] (d) CRISPR-Cas12a cascade signal amplification process. The specific process is as follows: Add crRNA1 (200 nM), crRNA2 (200 nM), 400 nM EA probe, 600 nM fluorescence signal probe, and 200 nM Cas12a required for the two CRISPR / Cas systems to the above solution. Add DEPC water to make the final volume 100 μL, and react at 37 °C for 40 - 60 minutes. After Cas12a completes the recognition and cleavage of the target sequence, heat at 65 °C for 10 - 15 minutes to inactivate the enzyme. After the reaction, measure the final fluorescence emission intensity of the solution to achieve the detection of hematopoietic stem cells.

[0062] The relevant oligonucleotide DNA strands and RNA sequences are as follows: P strand: 5'- SH-AAAAAAAAAAGTCCGCCCTGAGTTAATGCTAATC-3'.

[0063] crRNA1: 5'-UAAUUUCUACUAAGUGUAGAUGAUUAGCAUUAACUCAGGGCGG AC-3'.

[0064] crRNA2: 5'- UAAUUUCUACUAAGUGUAGAUAGAUGUUUUACTCGGUUU-3'.

[0065] EA: 5'- AAACCGAGTAAAACATCTTAATCTACAC-3'.

[0066] Fluorescent signal probe: 5'-FAM- TTTTTTTTTT -BHQ-3'.

[0067] The experimental conditions adopted for measuring the fluorescence emission intensity of the solution in step (d) are: excitation wavelength 490 nm, emission wavelength scanning range 510 - 600 nm.

[0068] Figure 4 A shows the fluorescence signal intensity obtained by detecting hematopoietic stem cells at various concentrations. It can be seen from the figure that as the concentration of hematopoietic stem cells increases, the fluorescence signal detected in the solution also gradually increases.

[0069] To verify the specificity of the combined CRISPR / Cas system in detecting hematopoietic stem cells, in this example, human normal breast cells MCF-10A cells at the same concentration were selected as the blank control (5×10 6 cells / mL) and the fluorescence intensity was detected under the same reaction conditions. The results are as Figure 4 shown in B. The fluorescence signal intensity obtained from the control cells is comparable to that of the blank control, indicating that this method has good specificity.

Claims

1. A nucleic acid composition for detecting hematopoietic stem cells, characterized in that Comprising: CD45 antibody-functionalized particles for capturing hematopoietic stem cells; CD34 antibody-functionalized P strands for binding to hematopoietic stem cells; And crRNA1, crRNA2, EA, and a fluorescent signal probe for CRISPR / Cas-mediated cascade signal amplification; The nucleic acid sequence contained in the said P strand is as follows: 5'- AAAAAAAAAAGTCCGCCCTGAGTTAATGCTAATC-3'; The nucleic acid sequence contained in the said crRNA1 is as follows: 5'-UAAUUUCUACUAAGUGUAGAUGAUUAGCAUUAACUCAGGGCGGAC-3'; The nucleic acid sequence contained in the said crRNA2 is as follows: 5'- UAAUUUCUACUAAGUGUAGAUAGAUGUUUUACTCGGUUU-3'; The nucleic acid sequence contained in the said EA is as follows: 5'- AAACCGAGTAAAACATCTTAATCTACAC-3'.

2. The nucleic acid composition according to claim 1, characterized in that The said P strand recognizes and activates the trans-cleavage activity of the Cas12a protein with crRNA1 in the first CRISPR / Cas12a, thereby being able to cleave single-stranded DNA in the test sample without selectivity, enabling the fluorescence of the signal probe with a quenching group modified at one end and a fluorescent group modified at the other end to be restored, thereby generating a fluorescent signal; Meanwhile, the single-stranded fragment of the EA probe recognizes crRNA2 in the second CRISPR / Cas12a, attaches a short extended fragment at the 3' end, and cages the crRNA2 spacer / repeat junction region, thereby inhibiting the assembly of crRNA2 and Cas12a, and having an inhibitory effect on the trans-cleavage activity of the CRISPR / Cas12a system; Due to the activation of the trans-cleavage activity of the Cas12a protein, the extended fragment single-stranded bulge fragment is chopped up, the blocked repeat region is released, activating the trans-cleavage activity of Cas12a, and the fluorescent group and quenching group of the signal probe are spatially separated from each other, generating a stronger fluorescent signal in the system.

3. The nucleic acid composition according to claim 1, characterized in that The 5' end of the P strand is modified with a thiol group.

4. The nucleic acid composition according to claim 1, wherein The fluorescent signal probe comprises an oligonucleotide with a fluorescent group at the 5' end and a quenching group at the 3' end.

5. The nucleic acid composition according to claim 4, wherein The quenching group is BHQ.

6. The nucleic acid composition according to claim 4, wherein The fluorescent group is FAM.

7. The nucleic acid composition according to claim 4, wherein The oligonucleotide is 5 or more Ts.

8. The nucleic acid composition according to claim 4, wherein The oligonucleotide is TTTTTTTTTT.

Images