Anti-acid element as well as coding gene and application thereof

By overexpressing the screened acid antacid elements and their encoding genes in microorganisms, the problem of slow growth of industrial microorganisms in acidic environments is solved, and an efficient and low-energy-consuming biological manufacturing process is achieved.

CN120424902APending Publication Date: 2025-08-05XINJIANG UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510572279.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-30
Publication Date
2025-08-05

AI Technical Summary

Technical Problem

In the prior art, industrial microorganisms grow slowly in acidic environments, resulting in low production efficiency, high energy consumption, and frequent use of neutralizers to adjust pH, increasing production costs and pollutant emissions.

Method used

10 potential antacid-anti-acid elements and their encoding genes were screened through metagenomic technology and overexpressed in microorganisms to improve the host cell's resistance to inorganic acids and organic acids.

Benefits of technology

It significantly improves the growth capacity of microorganisms in an acidic environment, reduces production energy consumption, reduces the use of neutralizing agents, and improves the production efficiency and environmental friendliness of biomanufacturing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005387459790000041
    Figure BDA0005387459790000041
  • Figure BDA0005387459790000051
    Figure BDA0005387459790000051
  • Figure BDA0005387459790000061
    Figure BDA0005387459790000061
Patent Text Reader

Abstract

The invention provides an anti-acid element as well as a coding gene and application thereof, and particularly discloses 10 anti-acid elements capable of improving the acid stress resistance of chassis microorganisms as well as coding genes and application of the anti-acid elements. The anti-acid element disclosed by the invention is beneficial to improving the production efficiency of a microbial cell factory in industrial application, reducing the fermentation energy consumption and the production cost, and laying a foundation for realizing an efficient and sustainable biological manufacturing system.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering and more particularly relates to an acid-resistant element and its encoding gene and application. Background Art

[0002] Industrial microorganisms often face many physiological or non-physiological stresses during the production process. In order to maintain a production environment that is suitable for microbial fermentation, they are often adjusted by adding neutralizers, cooling, etc., which leads to problems such as reduced production efficiency and increased energy consumption. For example, amino acids and organic acids can cause an acidic environment that is not conducive to cell growth and maintaining normal metabolic activity during the production process. In order to maintain the stability of production conditions, it is usually necessary to use exogenous neutralizers such as ammonia water and liquid ammonia to implement pH intervention and control the pH within an appropriate range. After fermentation is completed, strong acids such as sulfuric acid are added to lower the pH of the fermentation broth to facilitate the extraction of amino acid and organic acid products. If the acid stress resistance of amino acid or organic acid production strains is improved, it will not only improve production efficiency, reduce energy consumption, reduce pollutant emissions, and inhibit contamination by miscellaneous bacteria, but also lay the foundation for achieving the goal of building a resource-saving and environmentally friendly industry.

[0003] Green biomanufacturing is a new industrial model. During its fermentation process, the efficiency of bioconversion is often limited by a series of adverse stresses caused by environmental changes or metabolic imbalances. This leads to slow growth of cell factories, decreased production, and a significant increase in production energy consumption, which seriously restricts the development of the industry. The construction of intelligent stress-resistant microbial cell factories has brought new opportunities for green biomanufacturing. The current transformation of industrial strains has evolved from traditional mutagenesis-screening technology to the construction of various biological standard component libraries and industrial strain libraries by establishing regulatory mechanisms of biosynthetic metabolic networks. At the same time, modern biotechnology with synthetic biology and high-throughput automated screening and evolution as its core is also becoming an emerging method for strain improvement. Among them, the expression of exogenous genes in microbial strains can effectively improve the tolerance of microorganisms under different stresses. The construction of powerful and robust strains can not only help environmental protection and pollution control, but also promote the development and application of new biomass energy technologies. Summary of the Invention

[0004] In order to solve the problem of the lack of acid-resistant elements in the prior art, the inventors screened 10 potential acid-resistant elements and their encoding genes through metagenomic technology, overexpressed these 10 genes in microorganisms using overexpression technology, and explored the resistance ability of the genes based on the growth performance of the microorganisms under different types of acid conditions.

[0005] Therefore, in one aspect, the present invention provides an acid-resistant element (protein) selected from the group consisting of:

[0006] (1) A protein with an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10;

[0007] (2) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acids in the amino acid sequence of the protein of (1); and

[0008] (3) A protein having an amino acid sequence that is at least 80% (e.g., 85%, 90%, 95%, 98% or 99%) identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10 and having the same function.

[0009] In a specific embodiment, the acid-resistant element is selected from a protein having an amino acid sequence as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10, preferably a protein having an amino acid sequence as shown in SEQ ID NO:1.

[0010] In a specific embodiment, the acid-resistant element, when expressed in a host cell, can confer or enhance the host cell's acid resistance to inorganic and / or organic acids, preferably wherein the inorganic acid is selected from hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid or carbonic acid; and / or the organic acid is selected from acetic acid, formic acid, propionic acid, citric acid, lactic acid, malic acid, tartaric acid, succinic acid, oxalic acid, acidic amino acids such as glutamic acid and threonine.

[0011] In one embodiment, the host cell is a prokaryotic or eukaryotic microbial cell, preferably a Gram-positive or Gram-negative bacterium, more preferably an Escherichia or Bacillus bacterium of the Enterobacteriaceae family, and even more preferably Escherichia coli or Bacillus subtilis.

[0012] Another aspect of the present invention provides a gene encoding the acid-resistant element of the present invention.

[0013] In one embodiment, the gene is selected from:

[0014] (1) a DNA having a nucleotide sequence as shown in SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20 or SEQ ID NO:21, preferably a DNA as shown in SEQ ID NO:11 or SEQ ID NO:21;

[0015] (2) a DNA molecule that hybridizes with the DNA described in (1) under stringent conditions; and

[0016] (3) A DNA molecule having at least 80% (e.g., 85%, 90%, 95%, 98% or 99%) homology with the DNA described in (1).

[0017] In a specific embodiment, the acid-resistant element is an mBOAT family protein shown in SEQ ID NO: 1, and the gene is the DNA shown in SEQ ID NO: 11, or the DNA shown in SEQ ID NO: 21 after codon optimization based on Bacillus subtilis.

[0018] Another aspect of the present invention also provides a recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria containing the gene according to the present invention.

[0019] In a specific embodiment, the cell is a prokaryotic or eukaryotic microbial cell, preferably a Gram-positive or Gram-negative bacterium, more preferably an Escherichia or Bacillus bacterium of the Enterobacteriaceae family, and even more preferably Escherichia coli or Bacillus subtilis.

[0020] Another aspect of the present invention also provides the use of the acid-resistant element, gene, recombinant expression vector or expression cassette according to the present invention in conferring or improving the acid resistance of a host cell. Again, the cell can be a prokaryotic or eukaryotic microbial cell, preferably a Gram-positive or Gram-negative bacterium, more preferably an Escherichia or Bacillus bacterium of the Enterobacteriaceae family, and even more preferably Escherichia coli or Bacillus subtilis.

[0021] Another aspect of the present invention also provides a method for imparting or improving the acid stress resistance of a host cell, the method comprising expressing or overexpressing an acid-resistant element, gene, or recombinant expression vector or expression cassette according to the present invention in the host cell. Again, the cell can be a prokaryotic or eukaryotic microbial cell, preferably a Gram-positive or Gram-negative bacterium, more preferably an Enterobacteriaceae Escherichia or Bacillus bacteria, even more preferably Escherichia coli or Bacillus subtilis.

[0022] In one embodiment, the host cell of the present invention is a bacterial strain used in biomanufacturing, for example, the bacterial strain is used in the preparation of food, medicine, feed, and chemicals.

[0023] In one embodiment, the host cell of the present invention is used for industrial wastewater treatment.

[0024] The present invention not only expands the existing resistance gene library and provides great potential for discovering new acid-resistant elements, but will also promote the industrial application of industrial microorganisms. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] The above features and advantages of the present invention will become more apparent from the following detailed description taken in conjunction with the accompanying drawings, in which:

[0026] Figure 1 PCR verification of the recombinant plasmid for the E. coli chassis;

[0027] Figure 2 Determined as the growth limit of wild-type Escherichia coli under sulfuric acid conditions;

[0028] Figure 3 Determined as the growth limit of wild-type Escherichia coli under acetic acid conditions;

[0029] Figure 4 Determination of the growth limit of wild-type Bacillus subtilis under hydrochloric acid conditions;

[0030] Figure 5 To test the growth ability of engineered E. coli in hydrochloric acid pH = 4.3;

[0031] Figure 6 To test the growth ability of engineered E. coli in hydrochloric acid pH = 4.1;

[0032] Figure 7 To test the growth ability of engineered E. coli in sulfuric acid pH = 4.1;

[0033] Figure 8A To test the growth ability of engineered E. coli in acetic acid pH = 4.9;

[0034] Figure 8B To test the growth ability of engineered E. coli in acetic acid pH = 4.9;

[0035] Figure 9 PCR verification of the recombinant plasmid of Bacillus subtilis;

[0036] Figure 10 To test the growth ability of engineered Bacillus subtilis in hydrochloric acid pH = 4.2;

[0037] Figure 11 Testing the growth ability of engineered Bacillus subtilis in sulfuric acid pH = 4.2; and

[0038] Figure 12 Schematic diagram of the recombinant plasmid structure of the present invention.

[0039] Description of Sequence Listing

[0040]

[0041]

[0042] DETAILED DESCRIPTION

[0043] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0044] Unless otherwise specified, the experimental methods used in the examples are conventional methods.

[0045] Unless otherwise specified, all reagents involved in the embodiments of the present invention are commercially available products and can be purchased through commercial channels.

[0046] Unless otherwise indicated, the terms used herein have their ordinary technical meanings as understood by those skilled in the art. For definitions and terms in the art, the skilled artisan is particularly referred to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Plainsview, New York (1989); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999).

[0047] The terms “include” or “comprising” described in the present invention are open-ended descriptions, encompassing all the specified components or steps described, as well as other specified components or steps that will not substantially affect the description. When used to describe a protein or nucleic acid sequence, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, while still having the activity described in the present invention.

[0048] The term "and / or" as used herein includes all combinations of the items connected by the term, and each combination should be deemed to have been listed separately herein. For example, "A and / or B" includes "A," "A and B," and "B." For another example, "A, B, and / or C" includes "A," "B," "C," "A and B," "A and C," "B and C," and "A and B and C."

[0049] As used herein, the term "amino acid substitution" refers to the replacement of one amino acid with another amino acid having similar or dissimilar properties, including conservative substitutions (i.e., having a minor effect on the structure or function of the protein) or non-conservative substitutions (i.e., having a major effect on the structure or function of the protein). In the present invention, it is preferred that the amino acid substitution be a conservative substitution.

[0050] As used herein, the term "protein having the same function" refers to proteins having the same or similar ability to resist acid stress.

[0051] As used herein, the term "hybridize under stringent conditions" refers to hybridization and membrane washing at 65°C in a DNA or RNA hybridization experiment using a 0.1×SSPE (or 0.1×SSC), 0.1% SDS solution.

[0052] As used herein, the term "acid resistance element" refers to a protein, polypeptide, or functional domain that, when expressed in a host cell, can confer or enhance the host cell's acid resistance to inorganic and / or organic acids. Acid resistance can be manifested as survival rate and / or growth rate under acid stress.

[0053] As used herein, term " overexpression " refers to when the strict control of gene / protein expression (transcription) is upset, and gene may not be " turned off ", or transcribes at a high speed.High-speed transcription causes a large amount of mRNA to produce. For the overexpression of " acid-resistant element " of the present invention, refer to that its DNA or RNA or protein expression level in host cell of the present invention is at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 200% or 300% higher than control (not expressing acid-resistant element according to the present invention), or even 4, 5, 6, 7, 8, 9, 10 times or more of the DNA or RNA or protein expression level of acid-resistant element in the control.Techniques and reagents for detecting gene / protein expression level are well known to those skilled in the art.

[0054] The present invention provides 10 acid-resistant elements and their encoding genes and applications for use in the field of biomanufacturing, laying the foundation for the construction of intelligent stress-resistant microbial cell factories.

[0055] In order to achieve the above-mentioned purpose of the invention, the technical solution adopted by the present invention is as follows:

[0056] By screening 10 potential acid-resistant element encoding genes from metagenomic data, the 10 genes were overexpressed in microorganisms using overexpression technology, and the resistance ability of the genes was explored based on the growth performance of the microorganisms under different types of acid conditions.

[0057] First, the target gene sequence was codon-optimized according to the base strain, and the corresponding vector was constructed and introduced into the base strains Escherichia coli and Bacillus subtilis. The growth of the base strains was then tested in different acid environments to confirm the acid resistance of the sequence, ultimately obtaining a biological element that can improve the growth of the strains under acid stress.

[0058] Compared with the prior art, the present invention has the following advantages:

[0059] The 10 sequences of the present invention were aligned by NCBI and were not nearly similar to the existing published acid-resistant elements. Among them, the sequence similarity of the mBOAT family protein encoding gene sequence of the present invention and the previously reported gene dltB related to other related genes in this family that have been verified to be related to acid stress is less than 20%. The dlt operon in Gram-positive bacteria previously reported belongs to this family and encodes the enzyme necessary for D-alanylation modification of teichoic acid in the cell wall. D-alanylation generates a positive charge on the cell surface, thereby repelling positively charged molecules to confer resistance to the host. It is known that the ability of acetic acid to damage bacterial strains mainly depends on weak acid anions. In the present invention, not only a new gene related to acid stress was discovered, but also the tolerance to organic and inorganic acids was verified.

[0060] Therefore, the present invention provides, on the one hand, an acid-resistant element and an encoding gene, and on the other hand, provides a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the gene according to the present invention.

[0061] In one embodiment, the cell line is a eukaryotic or prokaryotic cell line, and / or the recombinant bacteria is a bacterium or a fungus.

[0062] In one embodiment, the recombinant bacteria are Escherichia coli and Bacillus subtilis.

[0063] Another aspect of the present invention also provides the use of the gene according to the present invention or the recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria according to the present invention in improving the acid resistance of microorganisms.

[0064] In a specific embodiment, the acid-resistant element can be applied in the fields of industrial wastewater and biomanufacturing.

[0065] All patents and publications mentioned in this application are incorporated herein by reference in their entirety. Those skilled in the art will recognize that certain modifications may be made to the present invention without departing from the spirit or scope of the present invention. The following examples further illustrate the present invention and are not to be construed as limiting the scope of the present invention or the specific methods described herein.

[0066] Example 1

[0067] Construction and verification of recombinant engineering strains

[0068] Ten target gene sequences were screened using metagenomics technology. The screened sequences were codon-optimized according to the base strain to obtain target sequences encoding mature proteins (SEQ ID NOs: 11-21). After being submitted to the company for chemical synthesis, the sequences were cloned into the pET-28a(+) vector and transformed into Escherichia coli. Amplification primers were set at both ends of the target gene sequence to verify whether the gene fragment was successfully constructed.

[0069] The primer sequences are shown in the table below (5'→3'):

[0070]

[0071]

[0072] PCR was performed using pfu polymerase under the following conditions: 94°C for 3 minutes, 94°C for 30 seconds, 55-65°C for 30 seconds, and 72°C for 30 seconds for 24 cycles, followed by 72°C for 5 minutes. After completion of the reaction, the PCR product was analyzed by 1% agarose gel electrophoresis. Successful transformation was confirmed by the appearance of a single bright band at the target gene size. Culture medium from successfully transformed clones was expanded and mixed with glycerol in equal proportions and stored at -80°C until use. Figure 1 This is PCR verification of the recombinant plasmid. Lanes 1-10 represent mBOAT, TIGR, HTH, oligo, metall, pcfJ, poly, typeI, p-loop, and pept, respectively. The image shows that the PCR amplified the correct bands as expected, indicating that the target gene was successfully constructed into the pET28a(+) vector.

[0073] Example 2

[0074] Testing the growth of engineered strains under different types of acid conditions

[0075] 1. Determination of the acid limit value of the chassis strain

[0076] E. coli BL21 (DE3) or B. subtilis MATE01 stored at -80°C were removed from an ultra-low temperature freezer and inoculated with 200 μL of each into 30 mL of LB liquid culture medium. The strains were activated and cultured at 37°C and 200 rpm. Three biological replicates were performed for each condition, using a 1% (v / v) inoculum. Blank LB liquid culture medium was used as a control, and the cultures were incubated at 37°C and 150 rpm to measure the biomass of E. coli and B. subtilis over 24 hours. Since hydrochloric acid and sulfuric acid have the same hydrogen ion, sulfuric acid or sulfuric acid and acetic acid were selected for the acid limit test.

[0077] Depend on Figure 2 It can be seen that under sulfuric acid stress, the growth of wild-type E. coli at pH = 4.24 was significantly lower than that at pH = 5.98, and no biomass accumulation was detected in the chassis strains after pH = 3.98, indicating that the growth limit of wild-type E. coli under sulfuric acid conditions is between pH = 4.24 and 3.98. Figure 3 It can be seen that under acetic acid stress, the growth of wild-type E. coli at pH = 5 was significantly lower than that at pH = 6.05, and no biomass accumulation was detected in the chassis strains after pH = 4.64. This indicates that the growth limit of E. coli under acetic acid conditions is between pH = 5 and 4.64. Figure 4 As can be seen, no biomass accumulation was detected in wild-type Bacillus subtilis under sulfuric acid pH = 4.26, indicating that the growth limit of the wild-type strain under these conditions is below pH = 4.2. Therefore, the subsequent functional verification phase of the acid-fast element encoding gene will be based on these experimental results to test the performance of the acid-fast element encoding gene on the acid tolerance of Escherichia coli and Bacillus subtilis.

[0078] 2. Growth of engineered strains in different types of acids

[0079] In summary, wild-type E. coli and empty vector E. coli were set as the control group, and recombinant engineered bacteria were used as the experimental group. Freshly cultured wild-type bacterial solution, bacterial solution carrying empty vector, and engineered strain were inoculated at a 1% inoculation rate in stress culture medium with hydrochloric acid pH = 4.3, hydrochloric acid / sulfuric acid pH = 4.1, and acetic acid = 4.9. The strength of the acid was calibrated by whether it could inhibit the growth of the control strain. Under weak hydrochloric acid pH = 4.3, the strain was measured at OD every 2 hours. 600 The absorbance value at nm was measured every 12 h under the conditions of sulfuric acid pH = 4.1 and acetic acid = 4.9. 600The growth of wild-type and recombinant strains in acid environment for 72 hours was tested to determine their tolerance. The growth performance of strains was evaluated based on the absorbance value at OD 600 It was determined by the absorbance at nm.

[0080] Depend on Figure 5 It can be seen that under the condition of hydrochloric acid pH = 4.3, the growth of the pcfJ and TIGR overexpressing engineered strains showed a significant upward trend compared with the control strain, indicating that this gene can improve the acid tolerance of the chassis strain.

[0081] Depend on Figure 6 It can be seen that under the condition of hydrochloric acid pH = 4.1, the OD of the mBOAT family protein overexpressing strain at 72h was 600 The value was increased by 5.85 times compared with the control strain; Figure 7 It can be seen that under the condition of sulfuric acid with pH=4.1, the OD of the engineered strain at 48h 600 The value was increased by 7.01 times compared with the control strain, indicating that the engineered strain can significantly improve the tolerance of the chassis strain to inorganic acids such as hydrochloric acid and sulfuric acid.

[0082] At the same time, the organic acid tolerance test was carried out. Figure 8A and Figure 8B It can be seen that under the acetic acid condition of pH=4.9, the growth of the 10 overexpression strains showed a good growth trend compared with the control strain; at 72h, the OD of the overexpression metall engineering strain was higher than that of the control strain. 600 The value increased by 2.35-fold, the pcfJ-overexpressing strain increased by 2.50-fold, the TIGR-overexpressing strain increased by 2.30-fold, the HTH-overexpressing strain increased by 2.53-fold, the P-loop-overexpressing strain increased by 2.35-fold, the pept-overexpressing strain increased by 2.56-fold, the typeI-overexpressing strain increased by 2.24-fold, the poly-overexpressing strain increased by 2.42-fold, the oligo-overexpressing strain increased by 2.32-fold, and the mBOAT-overexpressing strain increased by 2.17-fold. Wild-type E. coli and an empty vector-carrying E. coli served as controls, while the recombinant engineered strains served as experimental groups. Freshly cultured wild-type, empty vector-carrying, and engineered strains were inoculated at 1% in a stress medium containing hydrochloric acid (pH 4.3), hydrochloric acid / sulfuric acid (pH 4.1), and acetic acid (pH 4.9), respectively. The strength of the acid was determined by whether it inhibited the growth of the control strain. When the pH value of the weak hydrochloric acid is 4.3, the strain OD is measured every 2 hours. 600The absorbance value at nm was measured every 12 h under the conditions of sulfuric acid pH = 4.1 and acetic acid = 4.9. 600 The growth of wild-type and recombinant strains in acid environment for 72 hours was tested to determine their tolerance. The growth performance of strains was evaluated based on the absorbance value at OD 600 It was determined by the absorbance at nm.

[0083] Depend on Figure 5 It can be seen that under the condition of hydrochloric acid pH = 4.3, the growth of the pcfJ and TIGR overexpressing engineered strains showed a significant upward trend compared with the control strain, indicating that this gene can improve the acid tolerance of the chassis strain.

[0084] Depend on Figure 6 It can be seen that under the condition of hydrochloric acid pH = 4.1, the OD of the mBOAT family protein overexpressing strain at 72h was 600 The value was increased by 5.85 times compared with the control strain; Figure 7 It can be seen that under the condition of sulfuric acid with pH=4.1, the OD of the engineered strain at 48h 600 The value was increased by 7.01 times compared with the control strain, indicating that the engineered strain can significantly improve the tolerance of the chassis strain to inorganic acids such as hydrochloric acid and sulfuric acid.

[0085] At the same time, the organic acid tolerance test was carried out. Figure 8A and Figure 8B It can be seen that under the acetic acid condition of pH=4.9, the growth of the 10 overexpression strains showed a good growth trend compared with the control strain; at 72h, the OD of the overexpression metall engineering strain was higher than that of the control strain. 600 The value increased by 2.35 times, the pcfJ overexpression engineering strain increased by 2.50 times, the TIGR overexpression engineering strain increased by 2.30 times, the HTH overexpression engineering strain increased by 2.53 times, the P-loop overexpression engineering strain increased by 2.35 times, the pept overexpression engineering strain increased by 2.56 times, the typeI overexpression engineering strain increased by 2.24 times, the poly overexpression engineering strain increased by 2.42 times, the oligo overexpression engineering strain increased by 2.32 times, and the mBOAT overexpression engineering strain increased by 2.17 times.

[0086] Example 3

[0087] Acid tolerance performance of the replaced chassis strain

[0088] The mBOAT family protein-encoding gene, which performs well in hydrochloric, sulfuric, and acetic acid conditions, was codon-optimized in Bacillus subtilis to obtain the target sequence encoding the mature protein (SEQ ID NO: 21). After chemical synthesis, the sequence was cloned into the pMATE01 vector (purchased from Tianjin Chunyao Biotechnology Co., Ltd.) and transformed into Bacillus subtilis. Amplification primers were set at both ends of the target gene sequence to verify the successful construction of the gene fragment.

[0089] Primer sequence: mBOAT-F (5'→3'): ATGAGCTATGCGTCAATTG (SEQ ID NO: 42)

[0090] mBOAT-R(5'→3'):AAAGCCTCCATAGATGAATG(SEQ ID NO:43)

[0091] The PCR reaction procedure is similar to that for E. coli. After the reaction, the PCR product is electrophoresed on a 1% agarose gel. If a single bright band appears at the target gene size, transformation is successful. Mix the culture medium of the successfully transformed positive clones with glycerol in equal proportions and store at -80°C until use. Figure 9 This is PCR verification of the recombinant plasmid. As shown in the figure, the PCR amplified the correct band that was consistent with the expectation, and the target gene was successfully constructed into the vector pMATE06.

[0092] Freshly cultured wild-type Bacillus subtilis and engineered strains were inoculated at 1% in hydrochloric acid pH = 4.2 and sulfuric acid pH = 4.2 stress media, respectively. OD was measured every 12 hours during the growth process. 600 The growth of wild-type and recombinant strains in acid environment for 72 hours was tested to determine their tolerance. The growth performance of strains was evaluated based on the absorbance value at OD 600 It was determined by the absorbance at nm.

[0093] Depend on Figure 10 It can be seen that under the condition of hydrochloric acid pH = 4.2, the OD of the engineered strain overexpressing mBOAT family protein was 600 The value increased by 4.9 times; Figure 11 It can be seen that under the condition of sulfuric acid pH = 4.2, the OD of the engineered strain overexpressing mBOAT family proteins was higher than that of the control strain. 600 The value increased by 5.17 times. The results show that the gene has good resistance in different chassis, which will help to continuously optimize the fermentation process, improve production efficiency, and promote the industrialization of biomanufacturing.

[0094] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0095] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0096] In addition, the various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. An acid-resistant element selected from the group consisting of: (1) A protein with an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10; (2) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acids in the amino acid sequence of the protein of (1); and (3) A protein whose amino acid sequence has at least 80% homology with SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10 and has the same function.

2. The acid-resistant element according to claim 1, which is selected from the protein having an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10, preferably the protein having an amino acid sequence as shown in SEQ ID NO:

1.

3. The acid-resistant element according to claim 1 or 2, wherein the acid-resistant element, when expressed in a host cell, can confer or enhance the host cell's acid resistance to inorganic and / or organic acids, preferably wherein the inorganic acid is selected from hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid or carbonic acid; and / or the organic acid is selected from acetic acid, formic acid, propionic acid, citric acid, lactic acid, malic acid, tartaric acid, succinic acid, oxalic acid, glutamic acid and threonine.

4. The acid-resistant element according to claim 3, wherein the host cell is a prokaryotic or eukaryotic microbial cell, preferably a Gram-positive bacterium or a Gram-negative bacterium, more preferably an Escherichia or Bacillus bacterium of the Enterobacteriaceae family, and even more preferably Escherichia coli or Bacillus subtilis.

5. A gene encoding the acid-resistant element according to any one of claims 1 to 4.

6. The gene according to claim 5, which is selected from: (1) a DNA having a nucleotide sequence as shown in SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20 or SEQ ID NO:21, preferably a DNA as shown in SEQ ID NO:11 or SEQ ID NO:21; (2) a DNA molecule that hybridizes with the DNA described in (1) under stringent conditions; and (3) A DNA molecule having at least 80% homology with the DNA described in (1).

7. A recombinant expression vector, expression cassette, transgenic cell line or recombinant bacterium containing the gene according to claim 5 or 6.

8. The recombinant expression vector, expression cassette, transgenic cell line or recombinant bacterium according to claim 7, wherein the cell is a prokaryotic or eukaryotic microbial cell, preferably a Gram-positive bacterium or a Gram-negative bacterium, more preferably an Escherichia or Bacillus bacterium of the Enterobacteriaceae family, and even more preferably Escherichia coli or Bacillus subtilis.

9. Use of the acid-resistant element according to any one of claims 1 to 4, the gene according to claim 5 or 6, or the recombinant expression vector or expression cassette according to claim 7 or 8 in conferring or improving the acid-resistant ability of a host cell.

10. A method for conferring or improving the acid stress resistance of a host cell, the method comprising expressing or overexpressing the acid-resistant element according to any one of claims 1 to 4, the gene according to claim 5 or 6, or the recombinant expression vector or expression cassette according to claim 7 or 8 in the host cell.