Application of OsETR2 gene in regulating salt tolerance in rice

Abstract

The present invention relates to OsETR2 The application of genes in regulating salt tolerance in rice. Our research has found OsETR2 Gene regulation of rice salt tolerance OsETR2 Gene editing can significantly improve the salt tolerance of rice. The invention provides ideas for breeding new salt-tolerant rice varieties.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, specifically to OsETR2 Application of genes in regulating salt tolerance in rice. Background Art

[0002] Salt stress is one of the major abiotic stresses that limits plant growth and crop yield. The global area of ​​saline-alkali land is approximately 800 million hectares. Rice Rice (L.) is an important food crop in my country and is highly sensitive to salt stress. Therefore, improving rice salt tolerance is of great practical significance for fully utilizing salinized land for rice production, unleashing rice productivity, and further increasing rice yields.

[0003] CRISPR / Cas9 technology is a highly efficient and rapid site-specific gene editing technique that has been widely used in the study of gene function in plants and animals. Within the CRISPR / Cas9 gene editing system, sgRNA accurately identifies the target gene sequence. Its effectiveness can influence editing efficiency, the occurrence of off-target effects, and even have a decisive influence on the ultimate outcome of gene editing. Therefore, the design of a rational and effective sgRNA is crucial for achieving successful gene editing.

[0004] Currently about OsETR2 There are no reports on the application of genes in regulating rice salt tolerance. OsETR2 The intrinsic connection between genes and rice salt resistance, and the precise editing of genes with the help of CRISPR / Cas9 technology, is expected to become a key breakthrough in tapping the salt tolerance potential of rice and breaking through the bottleneck of rice yield. Summary of the Invention

[0005] In view of the shortcomings of the existing technology, the present invention discovered the rice salt tolerance gene OsETR2 It has the potential to be used in gene editing to breed new salt-tolerant varieties, and is of great significance for the directed genetic improvement of rice salt tolerance.

[0006] The technical solutions of the present invention are as follows:

[0007] OsETR2 Application of genes in regulating rice salt tolerance, the OsETR2 The genomic sequence of the gene is shown in SEQ ID NO.1, the CDS sequence is shown in SEQ ID NO.2, and the protein sequence is shown in SEQ ID NO.3.

[0008] Preferably, in practical applications, gene editing technology such as CRISPR / Cas9 can be used to OsETR2 The gene was knocked out to obtain highly salt-tolerant rice.

[0009] Preferably, gene editing technology is used to OsETR2 The gene inserts base T between bases 17 and 18 of the sequence shown in SEQ ID NO. 5 or deletes 24 bases starting from base 18 of the sequence shown in SEQ ID NO. 5, thereby improving the salt tolerance of rice.

[0010] Further preferably, the application is: using the sequence shown in SEQ ID NO. 4 as target sequence 1 and the sequence shown in SEQ ID NO. 5 as target sequence 2, designing primer sequences for amplifying the target sequences; using the pCBC-MT1T2 plasmid as a template, performing PCR amplification to obtain a PCR product; purifying the PCR product, and then using enzyme digestion-ligation to reconstruct the CRISPR / Cas9-OsETR2 expression vector; and transforming the correctly sequenced CRISPR / Cas9-OsETR2 expression vector into rice by Agrobacterium-mediated transformation to obtain transformed seedlings.

[0011] The Agrobacterium-mediated transformation method specifically comprises the following steps: the sequenced recombinant vector CRISPR / Cas9-OsETR2 is transformed into a competent Agrobacterium strain by electroporation; a correctly identified single Agrobacterium colony is inoculated into a liquid culture medium containing kanamycin and rifampicin, cultured overnight at 28°C with shaking, and the cells are collected after several transfers and resuspended to an OD of 600 The recombinant bacteria are inoculated into rice embryos to obtain resistant callus tissue, which is then regenerated into seedlings to obtain transformed seedlings.

[0012] Commonly used Agrobacterium include Agrobacterium tumefaciens EHA105, LBA4404, GV3101, and AGL1. Agrobacterium tumefaciens GV3101 is preferably used in the present invention.

[0013] Preferably, the primer sequences are shown as SEQ ID NO.6 and SEQ ID NO.7.

[0014] Preferably, the enzyme digestion-ligation system contains 2 μL of PCR product, 2 μL of pHUE411 vector, 1.5 μL of 10×NEB T4 buffer, 1.5 μL of 10×BSA, 1 μL of BsaI enzyme, 1 μL of T4 DNA ligase, and 6 μL of ddH2O. The reaction conditions for the enzyme digestion-ligation system are 37°C for 5 hours, 50°C for 5 minutes, and 80°C for 10 minutes.

[0015] Preferably, the rice variety includes Zhonghua 11.

[0016] Furthermore, the present invention relates to a CRISPR vector, which expresses target sequence 1 shown in SEQ ID NO.4 and target sequence 2 shown in SEQ ID NO.5.

[0017] It also relates to the use of the CRISPR vector, specifically for gene editing OsETR2 Gene.

[0018] Compared with the prior art, the present invention has the following advantages:

[0019] Our research found OsETR2 Gene regulation of rice salt tolerance OsETR2 Gene editing can significantly improve the salt tolerance of rice and obtain highly salt-tolerant rice. This invention provides a simple and effective technical means for quickly creating new salt-tolerant rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 : OsETR2 Gene structure and knockout target information.

[0021] Figure 2 : OsETR2 Results of salt tolerance test. DETAILED DESCRIPTION

[0022] In order to better understand the technical content of the present invention, the present invention is further described below in conjunction with specific embodiments and drawings.

[0023] Example 1: Construction of CRISPR / Cas9-OsETR2 expression vector and acquisition OsETR2 mutants

[0024] from OsETR2 Two 20bp target sites were selected from the CDS sequence region of the gene for double target knockout by CRISPR / Cas9. The target sequence was connected to the CRISPR / Cas9 vector by PCR, and then the CRISPR / Cas9-OsETR2 vector was transformed into rice Zhonghua 11 by Agrobacterium-mediated transformation. OsETR2 Deletion mutant rice.

[0025] 1. The steps for constructing the CRISPR / Cas9-OsETR2 expression vector are as follows:

[0026] For gene editing OsETR2 The CRISPR vector for this gene expresses two sgRNAs: sgRNA1 and sgRNA2. The coding sequence of the sgRNA1 recognition region is from positions 141 to 160 of sequence 2 (SEQ ID NO. 2), and the coding sequence of the sgRNA2 recognition region is from positions 925 to 944 of sequence 2 (SEQ ID NO. 2). The two designed target sequences are as follows:

[0027] Target 1 (sgRNA1): CAACATCCTGCAATGCCAGA (SEQ ID NO. 4)

[0028] Target 2 (sgRNA2): GTCTTGGTACTACCCGAGGA (SEQ ID NO.5)

[0029] The primer sequences designed according to the target site are as follows:

[0030] BsF:ATATATGGTCTCTGGCG CAACATCCTGCAATGCCAGA GTTTTAGAGCTAGAAATAGC (SEQ IDNO.6)

[0031] BsR:ATTATTGGTCTCTAAAC TCCTCGGGTAGTACCAAGAC CGCTTCTTGGTGCC (SEQ ID NO.7)

[0032] PCR amplification was performed using a 100-fold dilution of pCBC-MT1T2 as a template and primers BsF and BsR to generate a PCR product. The PCR product was purified and then reconstructed using the following restriction enzyme digestion and ligation method to generate the CRISPR / Cas9-OsETR2 expression vector. Vector construction methods were based on Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14:327.

[0033] Enzyme digestion-ligation system:

[0034]

[0035] 2. Identification

[0036] A 5 μl sample of the ligation product was transformed into competent E. coli. The cells were screened on LB plates containing 50 μg / mL kanamycin. Single clones were identified by colony PCR. Positive clones were selected, and plasmids were extracted and sent for sequencing. Sequencing results showed that the plasmid of the positive clones was the recombinant CRISPR vector CRISPR / Cas9-OsETR2.

[0037] II. CRISPR / Cas9-OsETR2-transformed rice callus and positive seedling identification

[0038] 1. Agrobacterium Transformation

[0039] The correctly sequenced recombinant vector CRISPR / Cas9-OsETR2 was transformed into the competent Agrobacterium GV3101 strain by electroporation, and the bacteria were preserved for future use after colony PCR identification and verification.

[0040] A single colony of correctly identified Agrobacterium GV3101 / CRISPR / Cas9-OsETR2 was inoculated into 2-3 mL of liquid culture medium containing 100 μg / mL kanamycin and 50 μg / mL rifampicin, and cultured overnight at 28°C. The next day, the culture was transferred to a large amount of liquid culture medium containing antibiotics and cultured with shaking. After several transfers, the cells were collected and resuspended to an OD of 600 Between 0.8 and 1.0. The recombinant bacteria GV3101 / CRISPR / Cas9-OsETR2 was transformed into Zhonghua 11 using the Agrobacterium-mediated method. The immature embryos were infected with Agrobacterium tumefaciens GV3101. The immature embryos infected by Agrobacterium tumefaciens GV3101 were placed on a selective medium for multiple screening to obtain resistant callus tissue. The resistant callus tissue was regenerated into seedlings to obtain T0 generation transformed seedlings. The rice Agrobacterium transformation method is referred to

[0041] Zhao, W., Zheng, S.&Ling, HQ. An efficient regeneration system andAgrobacterium-mediated transformation of Chinese upland rice cultivarHandao297. Plant Cell Tiss Organ Cult 106, 475–483 (2011).

[0042] 2. OsETR2 Identification of mutant T0 generation plants

[0043] DNA was extracted from leaves of T0 transgenic rice plants, and PCR amplification and sequencing were performed using genomic DNA as a template, with Zhonghua 11 as a control. The amplified products were sequenced and compared with the Zhonghua 11 sequence, and the effective mutant lines identified were named Osetr2-ko-1 and Osetr2-ko-2 .in:

[0044] Osetr2-ko-1 The first target site remains unchanged, and a base "T" is inserted into the second target site (i.e., a base "T" is inserted between positions 17 and 18 of SEQ ID NO.5, such as Figure 1 ), causing the translation to terminate prematurely, thus OsETR2 The mutant strains obtained by gene knockout were OsETR2 Gene mutants.

[0045] Osetr2-ko-2 The first target site remains unchanged, while the second target site is missing 24 bp starting from position 18, resulting in an incomplete GAF functional domain. OsETR2 The mutant strains obtained by gene knockout were OsETR2 Gene mutants.

[0046] Example 2, different strains OsETR2 Functional verification of salt tolerance in gene-edited plants

[0047] Select wild-type Zhonghua 11 (WT), osetr2-ko strain( ko-1 、 ko-2 ) Use greenhouse hydroponic method. The seeds were sterilized with 10% H2O2 for 10 minutes, and then the H2O2 on the surface of the seeds was rinsed with distilled water. The seeds were evenly placed in a culture dish with sterilized filter paper, and germinated in the dark at 37°C in a constant temperature incubator for 2 days, and germinated for one day at 28°C. The germinated seeds were placed in a hydroponic box with a filter and grown for 7 days. The nutrient solution in the hydroponic box was replaced every 2 days. The growth conditions were 28 / 25°C (day / night, about 70% relative humidity), the photoperiod was 14h / 10h (day / night), and the light intensity was 400μmol·m -2 ·s -1 Rice seedlings with good growth and 3-leaf stage were selected and treated with 120mM NaCl for 7 days and then recovered for 6 days. osetr2-ko The growth condition of the strain is obviously better. osetr2-ko The survival rate of the strain was significantly higher than that of WT (the survival rate of WT was about 3.33%, while the knockout mutant Osetr2-ko-1 and Osetr2-ko-2 The survival rates of OsETR2 The gene can significantly improve rice's tolerance to salt stress.

[0048] Nutrient solution formula table:

[0049]

[0050] The working solution should be prepared and used immediately. 1.25 mL of each mother solution is required for each liter of working solution, and the pH should be 5.5.

[0051] The above descriptions are only some embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall fall within the scope of protection of the present invention.

Claims

1. OsETR2 The application of the gene in regulating rice salt tolerance is characterized by: The following steps are involved: CRISPR / Cas9 gene editing technology was used to modify the sgRNA1 and sgRNA2 OsETR2 Gene knockout to improve salt tolerance in rice, the OsETR2 The CDS sequence of the gene is shown in SEQ ID NO.2, the nucleotide sequence of the sgRNA1 is shown in SEQ ID NO.4, and the nucleotide sequence of the sgRNA2 is shown in SEQ ID NO.

5.

2. The use according to claim 1, characterized in that The sequence shown in SEQ ID NO. 4 was used as target sequence 1, and the sequence shown in SEQ ID NO. 5 was used as target sequence 2. Primer sequences were designed based on the target sequences, and PCR amplification was performed using the pCBC-MT1T2 plasmid as a template using the designed primer sequences to obtain a PCR product. The PCR product was purified and then recombined using enzyme digestion-ligation to obtain the CRISPR / Cas9-OsETR2 expression vector. The correctly sequenced CRISPR / Cas9-OsETR2 expression vector was transformed into rice through Agrobacterium-mediated transformation to obtain transformed seedlings.

3. The use according to claim 2, characterized in that The primer sequences are shown in SEQ ID NO.6 and SEQ ID NO.

7.

4. The use according to claim 2, characterized in that The enzyme digestion-ligation system contained 2 μL of PCR product, 2 μL of pHUE411 vector, 1.5 μL of 10×NEB T4 buffer, 1.5 μL of 10×BSA, 1 μL of BsaI enzyme, 1 μL of T4 DNA ligase, and 6 μL of ddH2O; the reaction conditions of the enzyme digestion-ligation system were 37°C for 5 h, 50°C for 5 min, and 80°C for 10 min.

5. The use according to any one of claims 1 to 4, characterized in that The rice varieties include Zhonghua 11.

Images