A colorimetric-fluorescence dual-signal detection method for Salmonella based on Ag-MoS2 nanozyme

Through the colorimetric-fluorescence dual-signal detection method of Ag-MoS2 nanozyme, combined with multivalent aptamer competitive probes and catalytic hairpin self-assembly technology, the problems of low sensitivity and contamination risk of Salmonella detection are solved, and real-time detection and inactivation are achieved, which is suitable for food safety and clinical diagnosis.

CN120427903BActive Publication Date: 2025-09-26NINGBO UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510929580.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-07
Publication Date
2025-09-26
Estimated Expiration
2045-07-07

AI Technical Summary

Technical Problem

Existing Salmonella detection methods have problems such as low sensitivity, complex operation, easy contamination, and the need for additional equipment, and lack real-time inactivation capabilities.

Method used

A colorimetric-fluorescence dual-signal detection method based on Ag-MoS2 nanozyme was adopted. Through multivalent aptamer competitive probe and catalytic hairpin self-assembly technology, the fluorescence quenching properties and peroxidase activity of Ag-MoS2 nanozyme were combined to achieve the detection and inactivation of Salmonella.

Benefits of technology

It achieves high-sensitivity and strong specificity in Salmonella detection, can inactivate Salmonella after real-time detection to avoid secondary contamination, and is suitable for food safety monitoring and clinical diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120427903B_ABST
    Figure CN120427903B_ABST
Patent Text Reader

Abstract

The invention discloses a method for colorimetric-fluorescent dual-signal detection of Salmonella based on Ag-MoS2 nanozyme. The method is characterized by comprising the steps of mixing single-strand S1, single-strand S2, single-strand S3, single-strand S4, a Salmonella aptamer and cDNA to prepare a multivalent aptamer competitive probe solution; dissolving a hairpin probe H1 and a hairpin probe H2 in PBS respectively; preparing an Ag-MoS2 nanozyme composite material; mixing and incubating a Salmonella solution to be tested with the multivalent aptamer competitive probe, adding the Ag-MoS2 nanozyme composite material to perform a CHA amplification reaction, then adding an H2O2 solution and a TMB solution to perform a peroxidase-catalyzed reaction, performing colorimetric and fluorescence detection respectively, and calculating the concentration of Salmonella in the solution to be tested. The method has the advantages of being simple and rapid, having high sensitivity, strong specificity, high accuracy and achieving real-time sterilization after detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a method for detecting Salmonella, and in particular to a method for detecting Salmonella based on colorimetric-fluorescent dual signals of Ag-MoS2 nanozyme. Background Art

[0002] Salmonella foodborne pathogens are one of the main causes of foodborne illness. Developing efficient, sensitive, and cost-effective methods for detecting Salmonella is crucial for ensuring food safety. Traditional bacterial detection techniques primarily include standard culture methods, polymerase chain reaction (PCR), and enzyme-linked immunosorbent assay (ELISA). Plate colony counts, while highly specific, are complex and time-consuming. PCR methods, while highly sensitive, are complex and prone to contamination. While ELISAs are highly specific, they can be difficult to perform under resource-constrained conditions, and the cost of specific antibodies is relatively high.

[0003] Nanozymes are a class of nanomaterials with enzyme-like catalytic activity. Due to their low cost, high catalytic stability, ease of large-scale preparation, and strong tolerance to extreme conditions, nanozymes have important applications in food safety monitoring, biomedical applications, and environmental remediation. Among the many enzyme-like nanomaterials, molybdenum disulfide (MoS2) has attracted particular attention in sensor applications due to its high specific surface area, good biocompatibility, ease of functionalization, and excellent surface interaction capabilities. However, in biosensing applications, single-mode nanozyme sensors often face challenges such as high false positive / false negative results, insufficient anti-interference capabilities, and reduced detection accuracy in complex environments. To address this, researchers have proposed dual-mode sensing strategies to enhance sensor reliability through complementary signaling pathways such as electrochemical / colorimetric and fluorescence / colorimetric. However, many dual-mode systems rely on independent signal indicators and complex operational strategies, increasing the complexity of the detection process.

[0004] In practice, in addition to achieving sensitive and accurate bacterial detection, the risk of secondary contamination due to incomplete bacterial elimination after positive sample detection remains a key concern. Consequently, extensive research efforts have been devoted to developing integrated systems capable of simultaneous pathogen detection and disinfection. Among these, nanomaterial-based platforms have attracted significant attention due to their versatility, combining potent antimicrobial activity with effective sensing capabilities. Typically, such platforms utilize photoactivated materials that generate localized heat, reactive oxygen species (ROS), or other antimicrobial factors in response to external stimuli such as light. However, current detection-inactivation strategies often require auxiliary irradiation equipment, magnetic field generators, or complex post-processing procedures, limiting their practicality in real-time field applications. Therefore, the development of integrated detection-inactivation platforms that require no additional manipulation or specialized equipment is urgently needed to facilitate streamlined and efficient pathogen management in various practical scenarios.

[0005] Colorimetry has the advantages of simplicity, low cost, and easy observation, and has been widely used for rapid detection of pathogens. Furthermore, fluorescence is another commonly used optical detection method, characterized by its high sensitivity. Therefore, the development of a fluorescence / colorimetric dual-signal detection method can effectively improve detection sensitivity and, through self-calibration between the two methods, make the results more reliable. Currently, there are no published reports on colorimetric-fluorescence dual-signal detection of Salmonella based on Ag-MoS2 nanozymes, either domestically or internationally. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a method for detecting Salmonella by colorimetric-fluorescent dual signals based on Ag-MoS2 nanozymes with high sensitivity, strong specificity, high accuracy and real-time bacterial inactivation.

[0007] The technical solution adopted by the present invention to solve the above technical problems is: a method for detecting Salmonella based on colorimetric and fluorescent dual signals of Ag-MoS2 nanozymes. This method is not for the purpose of diagnosis or treatment, and includes the following steps:

[0008] Step 1: Preparation of TDN probe:

[0009] 25 µM single-stranded S1 solution, 25 µM single-stranded S2 solution, 25 µM single-stranded S3 solution, 25 µM single-stranded S4 solution, 10 µM Salmonella aptamer solution, 10 µM cDNA solution and TM buffer were mixed in a volume ratio of 1:1:1:1:10:10:26 and then annealed to obtain a multivalent aptamer competitive probe solution;

[0010] The nucleotide sequence of the single-stranded S1 is shown in SEQ ID NO. 1: 5'-TCGATGACCCACTCTCACTTTATCACCAGGTCAGTCTGACAGTGTAGCAGAGCTGTAGATAGATGCTGAGGAGTCCAATAC-3';

[0011] The nucleotide sequence of the single-stranded S2 is shown in SEQ ID NO. 2: 5'-TCGATGACCCACTCTCACTTTCAGACTGACCTGGTGATAAAACGACACTGACGTGGTGAATCTACTATGTGCGTGCATCTC-3';

[0012] The nucleotide sequence of the single-stranded S3 is shown in SEQ ID NO. 3: 5'-TCGATGACCCACTCTCACTTTTCAGACTGTAGGAAGTGTGCTTCACCACGTCAGTGTCGTTTGTATTGGACTCCTCAGCAT-3';

[0013] The nucleotide sequence of the single-stranded S4 is shown in SEQ ID NO. 4: 5'-GTGAGAGTGGGTCATCGAAAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTCTGATGTCGGTAGT-3';

[0014] The nucleotide sequence of the Salmonella aptamer is shown in SEQ ID NO. 5: 5'-GTGAGAGTGGGTCATCGAAAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTCTGATGTCGGTAGT-3';

[0015] The nucleotide sequence of the cDNA is shown in SEQ ID NO.6: 5'-CAAACCACCGTGGTTACAGT-3';

[0016] Step 2: Preparation of hairpin probes:

[0017] The hairpin probe H1 was dissolved in PBS buffer and then annealed to obtain a 1.5 μM H1 solution; the hairpin probe H2 was dissolved in PBS buffer and then annealed to obtain a 1 μM H2 solution, wherein the nucleotide sequence of the hairpin probe H1 is shown in SEQ ID NO. 7: 5'-FAM-ACCGTGGTTACAGTCCATGTGTAGAACTGTAACCACGGTGGTT-BHQ-3', and the nucleotide sequence of the hairpin probe H2 is shown in SEQ ID NO. 8: 5'-TGGTTACAGTTCTACACATGGACTGTAACCACGGTAGTCCATGTGTAGA-3';

[0018] Step 3: Preparation of Ag-MoS2 nanozyme composite material:

[0019] A 2 mg / mL MoS2 solution was mixed with a 5 mM AgNO3 solution in a volume ratio of 1:1, and trisodium citrate (0.05-0.2% by mass of MoS2) was added and stirred. The precipitate was separated by centrifugation, and the precipitate was repeatedly washed with ethanol and deionized water and dried to obtain Ag-MoS2 nanomaterials. H1 solution, H2 solution and 1 mg / mL Ag-MoS2 nanomaterial solution were mixed and incubated to obtain Ag-MoS2 nanoenzyme composite materials.

[0020] Step 4: Fluorescence detection of Salmonella:

[0021] The sample to be tested was added to the multivalent aptamer competitive probe solution prepared in step 1, and incubated at room temperature for 1 hour. Then, the Ag-MoS2 nanozyme composite material prepared in step 3 was added and incubated at room temperature for 30 minutes to perform a CHA reaction to obtain a CHA reaction product. The fluorescence signal generated was recorded using a microplate reader at an excitation wavelength of 492 nm and an emission wavelength of 518 nm. The concentration of Salmonella in the sample to be tested was calculated based on the quantitative relationship between the fluorescence intensity and the Salmonella concentration.

[0022] Step 5: Colorimetric detection of Salmonella:

[0023] 50 mM H2O2 solution and 50 mM TMB solution were further added to the CHA reaction product obtained in step 4 for a peroxidase-catalyzed reaction. The absorbance was measured at 635 nm using a microplate reader. The concentration of Salmonella in the sample to be tested was calculated based on the quantitative relationship between the absorbance value and the Salmonella concentration.

[0024] Furthermore, the annealing process in step 1 is heating at 95° C. for 10 minutes and then rapidly cooling to 4° C. and holding for 1 minute.

[0025] Furthermore, the stirring conditions in step 3 are a temperature of 90° C. and a time of 6 hours; and the incubation conditions are a temperature of 37° C. and a time of 2 hours.

[0026] Furthermore, the volume ratio of the H1 solution, the H2 solution and the Ag-MoS2 nanomaterial solution in step 3 is 1:1:8.

[0027] Furthermore, the volume ratio of the test sample, the multivalent aptamer competitive probe solution, the Ag-MoS2 nanozyme composite material, the H2O2 solution and the TMB solution in steps 4 and 5 is 10:1:1:1:1.

[0028] Principle of the invention: The mechanism of the fluorescence-colorimetric dual-mode method for detecting Salmonella based on multivalent aptamer competitive probes and Ag-MoS2 nanozymes is as follows: Figure 1 As shown in the figure, four carefully designed single DNA strands self-assemble to form a tetrahedral DNA scaffold, onto which specific aptamers that bind to the target Salmonella bacteria are attached, forming a tetrahedral DNA nanostructure bound to the multivalent aptamers. Subsequently, complementary DNA fragments (cDNA) of the Salmonella aptamers are further hybridized to generate multivalent aptamer competitive probes. Single-stranded probes H1 and H2 are adsorbed to the surface of the Ag-MoS2 nanozyme through van der Waals forces and electrostatic interactions, quenching fluorescence and blocking the catalytic site. In the presence of Salmonella, the multivalent aptamer competitive probes specifically bind to the bacterial surface, competitively releasing cDNA. The released cDNA triggers the CHA reaction, prompting H1 and H2 to form a duplex and detach from the nanozyme surface, restoring the fluorescence signal. This, in turn, exposes the peroxidase active site of Ag-MoS2, which catalyzes the oxidation of TMB by H2O2 to produce a blue product. Ultimately, Ag-MoS2 catalyzes the generation of reactive oxygen species and the slow release of silver ions through H2O2, achieving synergistic sterilization.

[0029] Compared with the existing technology, the advantages of the present invention are: the present invention is a method for colorimetric and fluorescent dual-signal detection of Salmonella based on Ag-MoS2 nanozymes, which combines nanozymes with catalytic hairpin self-assembly and utilizes the activity and fluorescence quenching properties of molybdenum disulfide peroxidases to develop a simple, rapid, and enzyme-free dual-signal detection method, realizing colorimetric and fluorescent dual-signal output for detection of Salmonella. Because the Ag-MoS2 nanozyme generates a detection signal by catalyzing a substrate reaction, its colorimetric signal is more intuitive and obvious, with a significant color change that is clearly discernible to the naked eye; the fluorescence detection exhibits higher sensitivity and resistance to external interference. Therefore, the dual signals complement each other to improve the sensitivity, stability, and accuracy of the detection. At the same time, it can also catalyze H2O2 to produce reactive oxygen and slowly release silver ions, achieving real-time sterilization after detection and avoiding secondary contamination.

[0030] In summary, the present invention uses a fluorescence-colorimetric dual-signal detection method based on Ag-MoS nanozymes. This method utilizes a multivalent aptamer competitive probe to specifically bind to Salmonella. The released cDNA triggers the CHA system, generating a fluorescent signal, which then catalyzes the substrate TMB to produce a colorimetric signal. This method enables rapid detection of Salmonella in milk, meat, fish, and lake water, while also providing real-time post-detection sterilization. Therefore, this method has broad prospects in food safety monitoring and clinical diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Schematic diagram of the colorimetric-fluorescence dual signal detection of Salmonella based on Ag-MoS2 nanozyme in specific embodiment 1;

[0032] Figure 2 This is an agarose gel electrophoresis diagram of the multivalent aptamer competitive probe in the second specific embodiment, wherein M is Maker, 1 is S1, 2 is S1+S2, 3 is S1+S2+S3, 4 is a tetrahedron, 5 is cDNA, 6 is a Salmonella aptamer, 7 is a Salmonella aptamer-cDNA, and 8 is a multivalent aptamer competitive probe;

[0033] Figure 3 The fluorescence detection result of the feasibility of catalytic hairpin self-assembly in specific embodiment 3;

[0034] Figure 4 The colorimetric test results of the feasibility of catalytic hairpin self-assembly in specific embodiment 3;

[0035] Figure 5 The colorimetric test results comparing the peroxidase activity of Ag-MoS2 and MoS2 in Specific Example 4 are as follows;

[0036] Figure 6 is the linear relationship between fluorescence intensity and Salmonella concentration in specific embodiment 5;

[0037] Figure 7 is the linear relationship between the colorimetric signal and the Salmonella concentration in the specific embodiment 5;

[0038] Figure 8 The experimental results of the inhibition zone of Salmonella at different Ag-MoS2 concentrations in specific example 6 are as follows;

[0039] Figure 9 The antibacterial property of Ag-MoS2 was evaluated by the coating method in the specific embodiment 7;

[0040] Figure 10 This is a quantitative assessment of the survival rate of Salmonella in specific example 7;

[0041] Figure 11The results of the Salmonella fluorescence microscope experiment in specific example 8 are as follows;

[0042] Figure 12 The experimental results of the Salmonella protein release test in specific embodiment 9 are as follows;

[0043] Figure 13 The specific experimental results of the fluorescence method for detecting Salmonella based on Ag-MoS2 nanozyme in Example 10;

[0044] Figure 14 The specific experimental results of the colorimetric method for detecting Salmonella based on Ag-MoS2 nanozyme in Example 10;

[0045] Figure 15 The results of the fluorescence method based on Ag-MoS2 nanozyme for detecting Salmonella in milk, meat, fish and lake water in Example 11 are as follows;

[0046] Figure 16 These are the results of the colorimetric method based on Ag-MoS2 nanozyme for detecting Salmonella in milk, meat, fish and lake water in the specific embodiment 11. DETAILED DESCRIPTION

[0047] The present invention will be described in further detail below with reference to the accompanying drawings and embodiments.

[0048] Specific Example 1: Method for detecting Salmonella using colorimetric-fluorescent dual signals of Ag-MoS2 nanozyme, such as Figure 1 The specific steps are as follows:

[0049] Step 1: Synthesis of multivalent aptamer competitive probes

[0050] 0.4 µL of 25 µM solution of four single-stranded DNAs (ss-S1, Ss-S2, Ss-S3, Ss-S4), 4 µL of 10 µM Salmonella aptamer solution, and 4 µL of 10 µM cDNA solution were mixed in 10.4 µL TM buffer (50 mM MgCl2 and 20 mM Tris-HCl, pH 8.0). The solution was then annealed to obtain a multivalent aptamer competitive probe solution. The annealing process was heating at 95°C for 4 minutes and then rapidly cooling to 4°C for 1 minute. The sequences of the four single-stranded DNAs are as follows:

[0051] The nucleotide sequence of single-stranded S1 is shown in SEQ ID NO. 1: 5′-TCGATGACCCACTCTCACTTTATCACCAGGTCAGTCTGACAGTGTAGCAGAGCTGTAGATAGATGCTGAGGAGTCCAATAC-3′;

[0052] The nucleotide sequence of single-stranded S2 is shown in SEQ ID NO. 2: 5′-TCGATGACCCACTCTCACTTTCAGACTGACCTGGTGATAAAACGACACTGACGTGGTGAATCTACTATGTGCGTGCATCTC-3′;

[0053] The nucleotide sequence of single-stranded S3 is shown in SEQ ID NO. 3: 5′-TCGATGACCCACTCTCACTTTTCAGACTGTAGGAAGTGTGCTTCACCACGTCAGTGTCGTTTGTATTGGACTCCTCAGCAT-3′;

[0054] The nucleotide sequence of single-stranded S4 is shown in SEQ ID NO. 4: 5′-GTGAGAGTGGGTCATCGAAAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTCTGATGTCGGTAGT-3′;

[0055] The nucleotide sequence of the Salmonella aptamer is shown in SEQ ID NO. 5: 5′-GTGAGAGTGGGTCATCGAAAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTCTGATGTCGGTAGT-3′;

[0056] The nucleotide sequence of the cDNA is shown in SEQ ID NO. 6: 5'-CAAACCACCGTGGTTACAGT-3'.

[0057] Step 2: Preparation of hairpin probes

[0058] The hairpin probe H1 was dissolved in PBS buffer and annealed (denatured at 95°C for 10 minutes, then gradually cooled to room temperature within 4 hours) to obtain a 1.5 μM H1 solution. The hairpin probe H2 was dissolved in PBS buffer and annealed (denatured at 95°C for 10 minutes, then gradually cooled to room temperature within 4 hours) to obtain a 1 μM H2 solution. The nucleotide sequence of the hairpin probe H1 is shown in SEQ ID NO.7: 5'-FAM-ACCGTGGTTACAGTCCATGTGTAGAACTGTAACCACGGTGGTT-BHQ-3', and the nucleotide sequence of the hairpin probe H2 is shown in SEQ ID NO.8: TGGTTACAGTTCTACACATGGACTGTAACCACGGTAGTCCATGTGTAGA.

[0059] Step 3: Preparation of Ag-MoS2 nanozyme composite material:

[0060] 100 mg of MoS2 powder was dispersed in 50 mL of deionized water and mixed with 50 mL of 5 mM AgNO3 solution. 0.1% trisodium citrate by mass of MoS2 powder was added as a reducing agent and stabilizer. The mixture was stirred at 90 °C for 6 h to allow silver nanoparticles to grow in situ on the MoS2 surface. Ag-MoS2 nanomaterials were obtained by centrifugal separation, washed repeatedly with ethanol and deionized water twice, and then dried at 90 °C. H1 solution, H2 solution and 1 mg / mL Ag-MoS2 nanomaterial solution were mixed in a volume ratio of 1:1:8 and incubated at 37 °C for 2 h to form a nanoenzyme composite material.

[0061] Step 4: Fluorescence detection of Salmonella:

[0062] Take 200 μL of the sample to be tested and add it to 20 μL of the multivalent aptamer competitive probe solution prepared in step 1. Incubate at room temperature for 1 hour, then add 20 μL of the Ag-MoS2 nanozyme composite material prepared in step 3 and incubate at room temperature for 30 minutes for CHA reaction to obtain a CHA reaction product. Use a microplate reader to record the generated fluorescence signal at an excitation wavelength of 492 nm and an emission wavelength of 518 nm. Based on the quantitative relationship between fluorescence intensity and Salmonella concentration, the concentration of Salmonella in the sample to be tested is calculated. The detection principle is the fluorescence quenching property of the Ag-MoS2 nanozyme complex. When Salmonella is present, the CHA reaction is triggered to release cDNA, causing H1 and H2 to detach from the nanozyme and restore the fluorescence signal of H1. The change in fluorescence intensity is related to the bacterial concentration.

[0063] Step 5: Colorimetric detection of Salmonella:

[0064] To the CHA reaction product obtained in step 4, 20 µL of a 50 mM H₂O₂ solution and 20 µL of a 50 mM TMB solution were added for a peroxidase-catalyzed reaction. The absorbance was measured at 635 nm using a microplate reader. The concentration of Salmonella in the sample was calculated based on the quantitative relationship between the absorbance and the Salmonella concentration. The detection principle is that in the presence of Salmonella, the Ag-MoS₂ nanozyme complex releases cDNA through the CHA reaction, causing the H1 and H2 hairpin probes to form a double-stranded structure and separate from the nanozyme surface, exposing the catalytic active site. The H₂O₂ catalyzes the oxidation of TMB to produce a blue product. The absorbance is correlated with the bacterial concentration.

[0065] Specific Example 2: Verify the successful synthesis of the multivalent aptamer competitive probe in step 1 of Specific Example 1.

[0066] To directly characterize the formation of multivalent aptamer-based competitive probes, 3 µL of Salmonella aptamer solution (prepared by diluting 10 µM annealed Salmonella aptamer solution with PBS buffer to 1 µM), 3 µL of cDNA solution (1 µM concentration, solvent: PBS buffer), 3 µL of Salmonella aptamer-cDNA mixed solution (prepared by mixing 1.5 µL of 1 µM Salmonella aptamer solution with 1.5 µL of 1 µM cDNA solution and then annealing), 3 µL of S1 sequence solution (annealing 0.8 µL of 25 µM single-stranded S1), 3 µL of S1+S2 sequence solution (mixing 0.8 µL of 25 µM two single-stranded DNAs (single-stranded S1 and single-stranded S2) and 3 µL of S1+S2+S3 sequence solution (mixing 0.8 µL of 25 µM single-stranded DNAs (single-stranded S1 and single-stranded S2) and then annealing), were added. 25µM of three single-stranded DNAs (single-strand S1, single-strand S2, single-strand S3) mixed and annealed), 3 µL of tetrahedral sequence solution (0.8µL of 25µM of four single-stranded DNAs (single-strand S1, single-strand S2, single-strand S3, single-strand S4) mixed and annealed), and 3 µL of the multivalent aptamer competitive probe solution synthesized in step 1 of specific embodiment 1 were sequentially added to 1wt% agarose gel electrophoresis for separation (stained with GelRed nucleic acid dye, 1×TAE running buffer, constant voltage of 130V for 30 minutes) and imaged and observed on a gel imager. Figure 2 It can be seen that with the increase of DNA chains, the migration speed of the band gradually decreases, which indicates the successful formation of multivalent aptamer competitive probe.

[0067] Specific Example 3: Verify the feasibility of catalyzing hairpin self-assembly in Specific Example 1.

[0068] 1. Fluorescence method was used to verify the feasibility of catalytic hairpin self-assembly. The experimental group was designed as follows:

[0069] a: 5 μL of 1 μM H1 solution was mixed with 5 μL of 1 mg / mL Ag-MoS2 solution;

[0070] b: 5 µL of 1.5 µM H1 solution, 5 µL of 0.5 µM cDNA, and 5 µL of 1 mg / mL Ag-MoS2 solution were mixed;

[0071] c) Mix 5 µL of 1.5 µM H2 solution, 5 µL of 0.5 µM cDNA, and 5 µL of 1 mg / mL Ag-MoS2 solution.

[0072] d: 5 μL of 1.5 μM H1 solution, 5 μL of 1.5 μM H2 solution, and 5 μL of 1 mg / mL Ag-MoS2 solution were mixed;

[0073] e: 5 µL of 1.5 µM H1 solution, 5 µL of 1.5 µM H2 solution, 5 µL of 0.5 µM cDNA, and 5 µL of 1 mg / ml Ag-MoS2 solution were mixed.

[0074] After the a, b, c, d, and e groups were left to stand for 30 minutes, the fluorescence was observed using a blue light analyzer and the fluorescence value was measured using an enzyme marker (excitation wavelength 492 nm, emission wavelength 518 nm). Figure 3 It can be seen that H1 exhibits a weak fluorescence intensity on the nanozyme surface due to the quenching effect of the nanozyme on the H1 fluorophore. After adding cDNA, H1 shows a significant fluorescence enhancement, which is due to the formation of a double-stranded structure between H1 and cDNA and separation from the nanozyme surface. When a mixture of cDNA, H1 and H2 is used, the fluorescence intensity increases significantly, which is due to the significant signal amplification effect of the CHA reaction.

[0075] 2. The feasibility of catalytic hairpin self-assembly was verified by colorimetry. The experimental group was designed as follows:

[0076] a: 5 μL of 1 μM H1 solution was mixed with 5 μL of 1 mg / mL Ag-MoS2 solution;

[0077] b: 5 µL of 1.5 µM H1 solution, 5 µL of 0.5 µM cDNA, and 5 µL of 1 mg / mL Ag-MoS2 solution were mixed;

[0078] c: 5 µL of 1.5 µM H2 solution, 5 µL of 0.5 µM cDNA, and 5 µL of 1 mg / mL Ag-MoS2 solution were mixed;

[0079] d: 5 μL of 1.5 μM H1 solution, 5 μL of 1.5 μM H2 solution, and 5 μL of 1 mg / mL Ag-MoS2 solution were mixed;

[0080] e: 5 µL of 1.5 µM H1 solution, 5 µL of 1.5 µM H2 solution, 5 µL of 0.5 µM cDNA, and 5 µL of 1 mg / mL Ag-MoS2 solution were mixed.

[0081] After standing for 30 minutes, groups a, b, c, d, and e were added with H2O2 and TMB for catalytic reaction. The color was observed with the naked eye and the absorbance was measured at 652 nm using a microplate reader. Figure 4 It can be seen that H1, cDNA and H2, and the mixture of H1 and H2 have low absorbance at 652nm, indicating that the peroxidase-like activity of the Ag-MoS2 nanozyme is inhibited due to the attachment of DNA. After adding cDNA to the Ag-MoS2-H1-H2 mixture, the colorimetric signal is significantly enhanced. This is because the formation of DNA-H1 and H1-H2 duplexes causes the nanozyme surface to detach, thereby exposing the active site of the Ag-MoS2 nanozyme.

[0082] Specific Example 4: The peroxidase activity of Ag-MoS2 and MoS2 was compared using the method of Specific Example 1.

[0083] The experimental group design is as follows:

[0084] a: 50 μL of 1 mM H2O2 solution, 50 μL of 1 mM TMB solution, and 50 μL of 1 mg / mL Ag-MoS2 solution were mixed;

[0085] b: 50 μL of 1 mM H2O2 solution, 50 μL of 1 mM TMB solution, and 50 μL of 1 mg / mL MoS2 solution were mixed;

[0086] c: 100 μL of PBS solution was mixed with 50 μL of 1 mg / mL Ag-MoS2 solution;

[0087] d: 100 μL of PBS solution was mixed with 50 μL of 1 mg / mL MoS2 solution;

[0088] e: Mix 50 µL of 1mM H2O2 solution, 50 µL of 1mM TMB solution, and 50 µL of PBS solution.

[0089] After reacting groups a, b, c, d, and e at room temperature for 30 minutes, the absorbance was measured at 652 nm using a microplate reader. Figure 5As shown, after adding H2O2 and TMB to the Ag-MoS2 nanozyme solution, the reaction mixture quickly turned blue and a characteristic absorption peak appeared at 652nm. This peak corresponds to the charge transfer complex produced by the oxidation of the amino group in TMB, indicating that the nanozyme effectively catalyzes the oxidation of TMB. In contrast, under the same conditions, in the absence of Ag-MoS2, the mixture of H2O2 and TMB does not produce blue, indicating that H2O2 itself is not sufficient to oxidize TMB. In addition, the absorbance of Ag-MoS2 is significantly higher than that of MoS2, indicating that Ag-MoS2 has enhanced peroxidase-like catalytic activity.

[0090] Specific Example 5: The sensitivity test of Salmonella was performed using the method of Specific Example 1.

[0091] 1. Bacterial culture: Inoculate frozen Salmonella into BHI liquid medium and culture at 37°C for 20 hours. Centrifuge 1 mL of the bacterial solution at 6000 rpm for 8 minutes. Remove the supernatant and wash once with PBS buffer. Finally, redissolve the precipitate in 1 mL of PBS buffer and store at 4°C until use.

[0092] 2. Fluorescence detection: 200 μL of a series of Salmonella solutions of different concentrations were added to 20 μL of the multivalent aptamer competitive probe solution prepared in step 1 of specific embodiment 1, and incubated at room temperature for 1 hour. Then, 20 μL of the Ag-MoS2 nanozyme composite material prepared in step 3 was added and incubated at room temperature for 30 minutes to perform CHA reaction to obtain CHA reaction products. The fluorescence signal generated was recorded using a microplate reader at an excitation wavelength of 492 nm and an emission wavelength of 518 nm. The fluorescence intensity corresponding to different concentrations of Salmonella was measured, and a fluorescence intensity-Salmonella concentration curve was drawn. The results are shown in FIG. Figure 6 As shown, the linear equation is: y =1243871x+3578839, the correlation coefficient is R = 0.9885, the linear relationship is good, the detection limit is 8 CFU / mL, and it can be used to detect Salmonella of unknown concentration.

[0093] 3. Colorimetric detection: Add 20 μL of 50 mM H2O2 solution and 20 μL of 50 mM TMB solution to the CHA reaction product for peroxidase-catalyzed reaction. Measure the absorbance at 635 nm using a microplate reader. Measure the absorbance corresponding to different concentrations of Salmonella and draw a curve of absorbance value-Salmonella concentration. Figure 7 As shown, the linear equation is: y = 0.1218x + 0.0973, the correlation coefficient is R = 0.9799, the linear relationship is good, the detection limit is 8 CFU / mL, and it can be used for the detection of Salmonella of unknown concentration.

[0094] Specific Example 6: The method of Specific Example 1 was used to conduct the inhibition zone experiment of Salmonella.

[0095] 1. Bacterial culture: culture using the method of specific embodiment 5.

[0096] 2. Coating plate: Take 100 μL of Ag-MoS2 nanozyme solution with different concentrations (0.1, 0.25, 0.4, 0.55, 0.7, 0.85, 1 mg / mL) and add 100 μL of 10 6 CFU / ml of Salmonella solution was incubated at 37°C for 30 minutes. 100 μL of the mixture was spread on xylose lysine deoxycholate agar medium in each group and cultured in a 37°C incubator for 24 hours. Figure 8 As shown in the figure, the diameter of the inhibition zone gradually expanded with the increase of Ag-MoS2 concentration. This result shows that Ag-MoS2 exhibits excellent bactericidal activity.

[0097] Specific Example 7: The method of Specific Example 1 was used to carry out a Salmonella coating experiment.

[0098] The bacteria were cultured using the method of specific embodiment 5, and the bacterial concentration was adjusted to 10 6 CFU / mL, experimental design groups are as follows:

[0099] a: 100 µL of Salmonella suspension was mixed with 300 µL of sterile PBS solution;

[0100] b: 100 μL of Salmonella suspension, 100 μL of 1 mM TMB solution and 200 μL of sterile PBS solution were mixed;

[0101] c: 100 μL of Salmonella suspension, 100 μL of 1 mM H2O2 solution and 200 μL of sterile PBS solution were mixed;

[0102] d: 100 μL of Salmonella suspension, 100 μL of 1 mM H2O2, 100 μL of 1 mg / mL Ag-MoS2 solution and 100 μL of sterile PBS solution were mixed;

[0103] e: 100 µL of Salmonella suspension, 100 µL of 1 mM H2O2, 100 µL of 1 mM TMB, and 100 µL of 1 mg / mL Ag-MoS2 solution were mixed.

[0104] Mix groups a, b, c, d, and e evenly and incubate in a 37°C incubator for 30 min. Take 100 µL of the mixture from each group and spread it on xylose lysine deoxycholate agar medium and incubate in a 37°C incubator for 24 h. Count the number of colonies on the agar surface with the naked eye. Figure 9 、 Figure 10 As shown, compared to the control group (without H2O2, Ag-MoS2, or TMB), bacterial survival was slightly reduced when only TMB and H2O2 were present, while the synergistic effect of H2O2 and Ag-MoS2 led to a significant reduction in bacterial numbers, with a bactericidal efficiency exceeding 95%. When H2O2, Ag-MoS2, and TMB were present simultaneously, their bactericidal efficiency exceeded 99.99%, attributed to the synergistic effect between Ag-MoS2 nanozymes, oxidized TMB (oxTMB), and reactive oxygen species. These results demonstrate that Ag-MoS2 possesses significant antibacterial properties.

[0105] Specific Example 8: The method of Specific Example 1 was used to conduct a fluorescence microscopy experiment on Salmonella.

[0106] The bacteria were cultured using the method of specific embodiment 5, and the bacterial concentration was adjusted to 10 6 CFU / mL, 100 µL of 1mM H2O2, 100 µL of 1mM TMB, 100 µL of 1mg / mL Ag-MoS2 solution were mixed with 200 µL of Salmonella suspension and incubated in a 37°C incubator for 12 hours. After incubation, NucGreen and EthD-III dyes were added, mixed well, and incubated at room temperature in the dark for 15 minutes. The fluorescent signal of the bacteria was observed using a fluorescence microscope to analyze the bacterial activity. Figure 11 As shown in the figure, the Salmonella in the control group mainly showed green fluorescence, indicating that it was in a live bacteria state; while the red fluorescence of Salmonella after Ag-MoS2 treatment was significantly enhanced, indicating that the number of dead bacteria increased and the number of live bacteria decreased, proving that Ag-MoS2 has a significant bactericidal effect on Salmonella.

[0107] Specific Example 9: The method of Specific Example 1 was used to conduct a Salmonella protein release experiment.

[0108] The bacteria were cultured using the method of specific embodiment 5, and the bacterial concentration was adjusted to 10 6 CFU / mL, experimental design groups are as follows:

[0109] a: 100 µL of Salmonella suspension was mixed with 300 µL of sterile PBS solution;

[0110] b: 100 μL of Salmonella suspension, 100 μL of 1 mM H2O2 solution and 200 μL of sterile PBS solution were mixed;

[0111] c: 100 μL of Salmonella suspension, 100 μL of 1 mg / mL Ag-MoS2 solution and 200 μL of sterile PBS solution were mixed;

[0112] d: 100 μL of Salmonella suspension, 100 μL of 1 mM H2O2, 100 μL of 1 mg / mL Ag-MoS2 solution and 100 μL of sterile PBS solution were mixed;

[0113] Mix groups a, b, c, and d evenly and incubate in a 37°C incubator for 6 hours. Centrifuge at 10,000 rpm for 10 minutes, take 20 µL of the supernatant and mix it with 200 µL of BCA working solution (solution A:solution B = 50:1), incubate in a 37°C incubator for 30 minutes, and measure the absorbance at 562 nm using a microplate reader. Figure 12 As shown, the Ag-MoS2 nanozyme slowly releases silver ions and catalytically oxidizes H2O2 to produce reactive oxygen species, and its protein release is significantly higher than that of the H2O2 and Ag-MoS2 groups alone, indicating that the synergistic effect of the two on the destruction of Salmonella is more significant, proving its excellent bactericidal effect.

[0114] Specific Example 10: The specific experiment of Salmonella was carried out using the method of Specific Example 1.

[0115] 1. Fluorescence detection: 10 5 CFU / mL Vibrio parahaemolyticus ( V. parahaemolyticus), 10 5 CFU / mL Vibrio alginolyticus ( V. alginolyticus), 10 5 CFU / mL Vibrio vulnificus ( V. vulnificus), 10 5 CFU / mL Staphylococcus aureus ( S .aureus), 10 5 CFU / mL Listeria monocytogenes ( L .monocytogenes), 10 5 CFU / mL Escherichia coli ( E .coliO157:H7),10 5 CFU / mL Salmonella ( Salmonella ) and 10 5 The CFU / mL mixed bacterial solution (each of the above bacteria was mixed in a volume ratio of 1:1:1:1:1:1:1) was subjected to fluorescence determination using the method of Specific Example 1. The results are shown in Figure 1. Figure 13As shown, when Salmonella is present, the fluorescence intensity value detected is much higher than the fluorescence intensity value of interfering foodborne pathogens, indicating that the detection method is specific for Salmonella.

[0116] 2. Colorimetric detection: 10 5 CFU / mL Vibrio parahaemolyticus ( V. parahaemolyticus), 10 5 CFU / mL Vibrio alginolyticus ( V. alginolyticus), 10 5 CFU / mL Vibrio vulnificus ( V. vulnificus), 10 5 CFU / mL Staphylococcus aureus ( S .aureus), 10 5 CFU / mL Listeria monocytogenes ( L .monocytogenes), 10 5 CFU / mL Escherichia coli ( E .coliO157:H7),10 5 CFU / mL Salmonella ( Salmonella ) and 10 5 The absorbance of the CFU / mL mixed bacterial solution (each of the above bacteria was mixed in a volume ratio of 1:1:1:1:1:1:1) was measured using the method of Example 1. The results are as follows Figure 14 As shown in the figure, when Salmonella is present, the absorbance value detected is much higher than the absorbance value of interfering foodborne pathogens, indicating that the detection method is specific for Salmonella.

[0117] Specific embodiment 11: Verify the value of the method of specific embodiment 1 in practical applications.

[0118] Salmonella standard solution was added to milk, meat, fish and lake water as actual samples, and the Salmonella in different samples was detected using the method of specific embodiment 1. The results are as follows: Figure 15 and Figure 16 shown.

[0119] Depend on Figure 15 It can be seen that the linear equation of fluorescence intensity-Salmonella in milk is: y = 685977x + 4890555, R 2 = 0.952; the linear equation of fluorescence intensity in meat-Salmonella is: y = 591655x + 5137551, R 2 = 0.9608; the linear equation of fluorescence intensity-Salmonella in fish is: y = 571817x + 5135103, R 2= 0.9743; the linear equation of fluorescence intensity in lake water-Salmonella is: y = 628944x + 4890832, R 2 = 0.9849. Fluorescence intensity of four samples and Salmonella concentration (10 1 -10 7 CFU / mL) showed a strong linear relationship.

[0120] Depend on Figure 16 It can be seen that the linear equation of absorbance-Salmonella in milk is: y = 0.0835x + 0.0381, R 2 =0.9761; the linear equation of absorbance-Salmonella in meat is: y = 0.0805x + 0.0651, R 2 = 0.9673; the linear equation for absorbance-Salmonella in fish is: y = 0.0827x + 0.0718, R 2 = 0.9768; the linear equation of absorbance-Salmonella in lake water is: y = 0.0788x + 0.0841, R 2 = 0.9796. The absorbance of the four samples is related to the concentration of Salmonella (10 1 -10 7 CFU / mL) showed a strong linear relationship.

[0121] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by persons of ordinary skill in the art within the spirit and scope of the present invention shall also fall within the scope of protection of the present invention.

Claims

1. A method for detecting Salmonella using colorimetric and fluorescence dual signals based on Ag-MoS2 nanozymes, which is not intended for diagnosis or treatment, and is characterized by The following steps are involved: Step 1: Preparation of TDN probe: 25 µM single-stranded S1 solution, 25 µM single-stranded S2 solution, 25 µM single-stranded S3 solution, 25 µM single-stranded S4 solution, 10 µM Salmonella aptamer solution, 10 µM cDNA solution and TM buffer were mixed in a volume ratio of 1:1:1:1:10:10:26 and then annealed to obtain a multivalent aptamer competitive probe solution; The nucleotide sequence of the single-stranded S1 is shown in SEQ ID NO. 1: 5'-TCGATGACCCACTCTCACTTTATCACCAGGTCAGTCTGACAGTGTAGCAGAGCTGTAGATAGATGCTGAGGAGTCCAATAC-3'; The nucleotide sequence of the single-stranded S2 is shown in SEQ ID NO. 2: 5'-TCGATGACCCACTCTCACTTTCAGACTGACCTGGTGATAAAACGACACTGACGTGGTGAATCTACTATGTGCGTGCATCTC-3'; The nucleotide sequence of the single-stranded S3 is shown in SEQ ID NO. 3: 5'-TCGATGACCCACTCTCACTTTTCAGACTGTAGGAAGTGTGCTTCACCACGTCAGTGTCGTTTGTATTGGACTCCTCAGCAT-3'; The nucleotide sequence of the single-stranded S4 is shown in SEQ ID NO. 4: 5'-GTGAGAGTGGGTCATCGAAAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTCTGATGTCGGTAGT-3'; The nucleotide sequence of the Salmonella aptamer is shown in SEQ ID NO. 5: 5'-GTGAGAGTGGGTCATCGAAAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTCTGATGTCGGTAGT-3'; The nucleotide sequence of the cDNA is shown in SEQ ID NO.6: 5'-CAAACCACCGTGGTTACAGT-3'; Step 2: Preparation of hairpin probes: The hairpin probe H1 was dissolved in PBS buffer and then annealed to obtain a 1.5 μM H1 solution; the hairpin probe H2 was dissolved in PBS buffer and then annealed to obtain a 1 μM H2 solution, wherein the nucleotide sequence of the hairpin probe H1 is shown in SEQ ID NO. 7: 5'-FAM-ACCGTGGTTACAGTCCATGTGTAGAACTGTAACCACGGTGGTT-BHQ-3', and the nucleotide sequence of the hairpin probe H2 is shown in SEQ ID NO. 8: 5'-TGGTTACAGTTCTACACATGGACTGTAACCACGGTAGTCCATGTGTAGA-3'; Step 3: Preparation of Ag-MoS2 nanozyme composite material: A 2 mg / mL MoS2 solution was mixed with a 5 mM AgNO3 solution in a volume ratio of 1:1, and trisodium citrate (0.05-0.2% by mass of MoS2) was added and stirred. The precipitate was separated by centrifugation, and washed repeatedly with ethanol and deionized water and dried to obtain Ag-MoS2 nanomaterials. H1 solution, H2 solution and 1 mg / mL Ag-MoS2 nanomaterial solution were mixed and incubated to obtain Ag-MoS2 nanoenzyme composite materials. Step 4: Fluorescence detection of Salmonella: The sample to be tested was added to the multivalent aptamer competitive probe solution prepared in step 1, and the mixture was incubated at room temperature for 1 hour. The Ag-MoS2 nanozyme composite material prepared in step 3 was then added and incubated at room temperature for 30 minutes for CHA reaction to obtain a CHA reaction product. The fluorescence signal generated was recorded using a microplate reader at an excitation wavelength of 492 nm and an emission wavelength of 518 nm. The concentration of Salmonella in the sample to be tested was calculated based on the quantitative relationship between the fluorescence intensity and the Salmonella concentration. Step 5: Colorimetric detection of Salmonella: 50 mM H2O2 solution and 50 mM TMB solution were further added to the CHA reaction product obtained in step 4 for a peroxidase-catalyzed reaction. The absorbance was measured at 635 nm using a microplate reader. The concentration of Salmonella in the sample to be tested was calculated based on the quantitative relationship between the absorbance value and the Salmonella concentration.

2. The method for detecting Salmonella using colorimetric and fluorescence dual signals based on Ag-MoS2 nanozyme according to claim 1, characterized in that: The annealing process in step 1 is to heat at 95°C for 10 minutes and then quickly cool to 4°C and hold for 1 minute.

3. The method for detecting Salmonella using colorimetric and fluorescence dual signals based on Ag-MoS2 nanozyme according to claim 1, characterized in that: In step 3, the stirring conditions are 90° C. and 6 h; the incubation conditions are 37° C. and 2 h.

4. The method for detecting Salmonella using colorimetric and fluorescence dual signals based on Ag-MoS2 nanozyme according to claim 1, characterized in that: The volume ratio of the H1 solution, the H2 solution and the Ag-MoS2 nanomaterial solution in step 3 is 1:1:

8.

5. The method for detecting Salmonella using colorimetric and fluorescence dual signals based on Ag-MoS2 nanozyme according to claim 1, characterized in that: The volume ratio of the test sample, the multivalent aptamer competitive probe solution, the Ag-MoS2 nanozyme composite material, the H2O2 solution and the TMB solution in steps 4 and 5 is 10:1:1:1:1.

Citation Information

Patent Citations

  • Method for detecting salmonella based on HCR-mediated multivalent aptamer and CRISPR-Cas12a system

    CN116735867A

  • Design and application of graphene oxide nano-enzyme rapid pesticide residue detection platform combined with colorimetric-catalytic signal enhancement

    CN120102865A