Method for detecting high sensitivity of monkey pox virus by one-pot RPA-CRISPR (Recombinase Polymerase Chain Reaction-Cyclic Reduced Interference Short Palindromic

Through the temperature-controlled RPA-CRISPR method, the interference of Cas enzyme cleavage activity on the amplification process is solved, and the high sensitivity and specific detection of monkeypox virus is achieved. It is suitable for immediate detection, avoiding the cumbersome operation and the risk of cross-contamination.

CN120442858APending Publication Date: 2025-08-08JIANGSU OCEAN UNIV
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510568351.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-30
Publication Date
2025-08-08

AI Technical Summary

Technical Problem

In the prior art, Cas nucleases are prone to activate the cleavage activity of trace target nucleic acids during RPA amplification, interfering with the amplification process, resulting in cumbersome reaction operations and risk of cross-contamination, making it difficult to achieve high sensitivity and specific detection of monkeypox virus.

Method used

Through the temperature-controlled RPA-CRISPR method, the temperature difference between RPA amplification and CRISPR-Cas12b cleavage is used to regulate the reaction process in stages, and the temperature is increased to 60°C cleavage after amplification at 37°C to achieve timing separation between amplification and cleavage, and the fluorescence signal is released by molecular beacon breaking for detection.

Benefits of technology

It realizes high sensitivity detection of monkeypox virus, avoids liquid transfer and cross-contamination of the reaction mixture, is suitable for immediate detection, and provides a high-sensitivity and fast POCT adaptability detection method.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442858A_ABST
    Figure CN120442858A_ABST
Patent Text Reader

Abstract

The invention discloses a method for detecting high sensitivity of monkey pox virus by a one-pot method RPA-CRISPR based on temperature control, and the method comprises the following steps: establishing a temperature-controlled RPA and CRISPR-Cas12b combined detection method, which is called as CRATS for short, by utilizing the reaction temperature difference between RPA amplification and CRISPR-Cas12b cutting; the reaction process in a tube system is regulated and controlled by stages through a temperature switching strategy: target amplification is completed at 37 DEG C firstly, then the temperature is raised to 60 DEG C, Cas12b cutting is started, so that sequential separation of amplification and cutting reactions is realized, and finally detection is realized through a fluorescence signal released by molecular beacon breakage. The problem that Cas enzyme cutting activity interferes with the amplification process in a traditional one-pot method reaction is solved, the detection sensitivity and specificity are improved, and a new technical means is provided for on-site rapid detection of the monkey pox virus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of viral genotyping detection, namely, a real-time detection technology for the monkeypox F3L gene, and specifically to a high-sensitivity method for detecting monkeypox virus using a one-pot RPA-CRISPR method based on temperature control. Background Art

[0002] In 2024, the World Health Organization (WHO) once again designated the monkeypox virus as a Public Health Emergency of International Concern (PHEIC). The virus continues to cause infections worldwide, posing a serious public health challenge. As of October 2023, the WHO had received reports of over 90,000 cases of infection from 115 countries and regions. Monkeypox virus is a zoonotic pathogen that causes smallpox-like symptoms, including rash, fever, headache, and muscle aches. Given the potential for monkeypox virus mutation, timely identification and isolation of infected individuals through nucleic acid testing and symptom monitoring are crucial for preventing further spread, protecting vulnerable populations, and reducing the risk of the emergence of dangerous variants. In molecular detection, CRISPR-Cas nucleases are widely used in nucleic acid detection due to their high specificity. Guided by crRNA, Cas nucleases recognize and bind to target nucleic acid sequences. They then use their trans-cleavage activity to cleave fluorescently labeled molecular beacons, generating a detectable fluorescent signal. To further enhance detection sensitivity, nucleic acid amplification techniques are often used to pre-amplify the target nucleic acid. While traditional polymerase chain reaction (PCR) technology is widely used in laboratory testing, its complex thermal cycling process limits its application in point-of-care (POCT) testing. In contrast, isothermal amplification techniques, such as recombinase polymerase amplification (RPA), can complete nucleic acid amplification at a constant temperature of 37–42°C, eliminating the need for thermal cycling equipment and making it more suitable for on-site testing. The combination of RPA with CRISPR-Cas nucleases has led to the development of a variety of nucleic acid detection methods suitable for on-site use, such as the SHERLOCK technique combined with Cas13a and the DETECTR technique combined with Cas12a. However, integrating Cas nucleases and RPA into a one-pot reaction has been challenging, as even trace amounts of target nucleic acid can activate the cleavage activity of the Cas enzyme, thereby interfering with the nucleic acid amplification process. Therefore, most current detection methods based on Cas nucleases and RPA employ a two-step approach, with separate pre-amplification and Cas cleavage reactions. While this approach ensures optimal conditions for amplification and cleavage, it is cumbersome and carries the risk of cross-contamination. This study innovatively proposed a novel, one-pot RPA-CRISPR assay based on temperature control for monkeypox virus detection. By optimizing reaction conditions and temperature control, this method effectively addresses the interference of Cas enzyme cleavage activity with the amplification process in traditional one-pot reactions, improving detection sensitivity and specificity, and providing a new technical means for rapid on-site detection of monkeypox virus. Summary of the Invention

[0003] The present invention utilizes the reaction temperature difference between RPA amplification and CRISPR-Cas12b cleavage to establish a temperature-controlled RPA and CRISPR-Cas12b combined detection method. The specific technical solution is as follows: A highly sensitive temperature-controlled one-pot RPA-CRISPR method for detecting monkeypox virus, abbreviated as CRATS, regulates the reaction within a single tube system in stages through temperature switching: target amplification is first completed at 37°C, and then the temperature is raised to 60°C to initiate Cas12b cleavage, achieving temporal separation of amplification and cleavage reactions. Finally, detection is achieved by releasing a fluorescent signal through the breakage of a molecular beacon.

[0004] Furthermore, the CRATS test comprises the following steps: (1) Preparation of viral genomic DNA; (2) Expression and purification of Cas12b; (3) sgRNA preparation; (4) CRATS one-pot reaction system; (5) Monitor the fluorescence signal and plot the data.

[0005] Furthermore, the CRATS one-pot reaction system steps are as follows: (1) Prepare RPA premix and Cas12b premix; (2) The two premixes were mixed to prepare a one-pot CRATS reaction mixture; (3) The mixture in step (2) was incubated at 37°C for 20 min, and then incubated in a small metal bath at 60°C for 20 min; (4) Monitor the FAM fluorescence signal and read it every 1 minute. The endpoint signal is observed with the naked eye under blue light.

[0006] Furthermore, the RPA premix was prepared by adding 25 μL of A buffer, 2 μL of 10 μM forward primer, and 2 μL of 10 μM reverse primer to the lyophilized enzyme powder to prepare the RPA premix; the Cas12b premix was prepared by adding a final concentration of 260 nM Cas12a, 2 μM ssDNA-FQ, 200 nM crRNA to a total volume of 80 μL CRISPR premix, and adding 1×NEB buffer 2.1, and finally adding deionized water to the volume to 80 μL; the one-pot CRATS reaction mixture was prepared by mixing 14.5 μL of RPA premix, 6.25 μL of Cas12b premix, 1.25 μL of B buffer, and 3 μL of monkeypox virus F3L standard plasmid.

[0007] Furthermore, the forward and reverse primers, namely RPA-F and RPA-R, have gene sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively; the ssDNA-FQ is a molecular beacon, and its gene sequence is as shown in SEQ ID NO. 4.

[0008] Furthermore, the expression and purification of Cas12b includes plasmid construction, protein expression, and protein purification; the sgRNA gene sequence is as shown in SEQ ID NO. 3.

[0009] The above technical solution can achieve the following beneficial effects: Compared with the existing technology, the present invention establishes a one-pot detection method, namely the CRATS method with temperature-controlled continuous reaction. Since the optimal amplification temperature of RPA is 37°C, and the trans-cleavage activity of Cas12b needs to be active at 60°C, the CRATS method regulates the reaction process in a one-tube system in stages through a temperature switching strategy: first completing target amplification at 37°C, then heating to 60°C to initiate Cas12b cleavage, thereby achieving temporal separation of amplification and cleavage reactions, and finally achieving detection by releasing fluorescent signals through the breakage of molecular beacons.

[0010] Through a simple temperature switch, the present invention appropriately adjusts the primary reaction in the one-pot system, transforming "active amplification / silent cleavage" into "silent amplification / active cleavage." This not only avoids liquid transfer between reaction mixtures and the associated risk of cross-contamination, but also minimizes interference between RPA amplification and CRISPR-Cas12b cleavage. Compared to other CRISPR-Cas-based one-pot assays, CRATS leverages the inherent characteristics of RPA and Cas12b, namely their different preferred reaction temperatures, making the development of specific assays more reliable and less challenging. Therefore, the CRATS strategy is applicable to a wide range of nucleic acid tests. For monkeypox virus, the present invention provides a highly sensitive and point-of-care (POCT)-friendly molecular detection method. Furthermore, the CRATS method, for the first time, overcomes the compatibility bottleneck between CRISPR and RPA through a temperature gradient strategy, providing an innovative solution for major infectious pathogens that combines high sensitivity (single copy level), rapid detection (40 min), and compatibility with point-of-care (POCT) testing. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 Schematic diagram of the CRATS one-pot reaction method.

[0012] Figure 2 It is the performance analysis of CRATS.

[0013] Among them, the sensitivity of CRATS was tested using standard plasmid DNA, and fluorescence curves of different colors (A) represent different target contents. The endpoint quantitative analysis of the signal (the value of the fluorescence curve at the 40-min time point) is displayed in the form of a bar graph (D). The specificity of CRATS, the fluorescence curves of different pathogen samples (B) are displayed in different colors, and the quantitative signals are presented in a bar graph (E). CRATS was verified using simulated skin samples, and fluorescence curves of different colors (C) showed the detection signals of simulated samples containing different target amounts, and the quantitative signals were displayed in a bar graph (F). Above the fluorescence curve is the endpoint visualization image of the test results. NTC means no template control. The error bars are the standard errors of three parallel repeated experiments, **P<0.05, ****P<0.001 DETAILED DESCRIPTION

[0014] The following is a clear and complete description of the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. The following description of at least one exemplary embodiment is actually only illustrative and is in no way intended to limit the present invention and its application or use. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative work are within the scope of protection of the present invention.

[0015] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof.

[0016] The following is combined with Figure 1-2 The present invention is described in detail to facilitate those skilled in the art to understand the present invention.

[0017] A highly sensitive temperature-controlled one-pot RPA-CRISPR method for detecting monkeypox virus, abbreviated as CRATS, regulates the reaction within a single tube system in stages through temperature switching: target amplification is first completed at 37°C, and then the temperature is raised to 60°C to initiate Cas12b cleavage, achieving temporal separation of amplification and cleavage reactions. Finally, detection is achieved by releasing a fluorescent signal through the breakage of a molecular beacon.

[0018] As a preferred embodiment, the CRATS detection comprises the following steps: (1) Preparation of viral genomic DNA; (2) Expression and purification of Cas12b; (3) sgRNA preparation; (4) CRATS one-pot reaction system; (5) Monitor the fluorescence signal and plot the data.

[0019] As a preferred embodiment, the CRATS one-pot reaction system has the following steps: (1) Prepare RPA premix and Cas12b premix; (2) The two premixes were mixed to prepare a one-pot CRATS reaction mixture; (3) The mixture in step (2) was incubated at 37°C for 20 min, and then incubated in a small metal bath at 60°C for 20 min; (4) Monitor the FAM fluorescence signal and read it every 1 minute. The endpoint signal is observed with the naked eye under blue light.

[0020] As a preferred embodiment, the RPA premix is prepared by adding 25 μL of A buffer, 2 μL of 10 μM forward primer, and 2 μL of 10 μM reverse primer to the lyophilized enzyme powder to prepare the RPA premix; the Cas12b premix is prepared by adding a final concentration of 260 nM Cas12a, 2 μM ssDNA-FQ, 200 nM crRNA to a total volume of 80 μL CRISPR premix, and adding 1×NEB buffer 2.1, and finally adding deionized water to the volume to 80 μL; the one-pot CRATS reaction mixture is prepared by mixing 14.5 μL RPA premix, 6.25 μL Cas12b premix, 1.25 μL B buffer, and 3 μL monkeypox virus F3L standard plasmid to prepare a 25 μL one-pot CRATS reaction mixture.

[0021] As a preferred embodiment, the forward and reverse primers are RPA-F and RPA-R, and their gene sequences are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively; the ssDNA-FQ is a molecular beacon, and its gene sequence is shown in SEQ ID NO.4.

[0022] As a preferred embodiment, the expression and purification of Cas12b includes plasmid construction, protein expression, and protein purification; the sgRNA gene sequence is as shown in SEQ ID NO. 3, and its sequence table is shown in Table 1 below:

[0023] Table 1 Primer and sgRNA sequences Example

[0024] 1. Reagents and Instruments TIANamp Virus RNA Kit and DNA extraction kit were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; T7 High Efficiency Transcription Kit was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; RPA Basic Nucleic Acid Amplification Kit was purchased from Hangzhou Zhongce Biotechnology Co., Ltd.; Universal SYBR qPCR Master Mix, HiScript 1st Strand cDNA Synthesis Kit, and FastPure® Gel DNA Extraction Mini Kit were purchased from Nanjing Novogene Biotechnology Co., Ltd.; Qubit 4 Fluorometer was purchased from Thermo Fisher Scientific (China) Co., Ltd.; Roche LightCycler 480 II qPCR Instrument was purchased from Switzerland; Nanodrop Lite Spectrophotometer was purchased from Thermo Fisher Scientific (China) Co., Ltd.; Blue Light Transilluminator was purchased from Tianjin Novogene Bioinformatics Technology Co., Ltd.; Monkeypox Virus Nucleic Acid Detection Kit was purchased from Beinachuanglian Biotechnology Research Institute (Zhengzhou, China); 0.1M TCEP solution: weigh 2.51 g of tris(2-carboxyethyl)phosphine into a beaker, add water and stir until dissolved, finally dilute to 100 mL, filter, and store at room temperature; The SnakeSkin 10K MWCO dialysis tubing was purchased from Thermo Fisher Scientific (China) Co., Ltd.; Cas12b Lysis buffer: add 50 mM NaH2PO4 (pH 8.0) and 300 mM NaCl to a beaker, mix well, and place in a 4°C refrigerator for use; Cas12b Elute buffer: add 50 mM NaH2PO4 (pH 8.0), 300 mM NaCl, and 500 mM imidazole to a beaker, mix well, and place in a 4°C refrigerator for use; Cas12b Storage buffer: add 50 mM Tris-HCl (pH 8.0), 200 mM NaCl, 0.1 mM EDTA, 1 mM DTT, and 20% glycerol to a beaker, mix well, and place in a 4°C refrigerator for use; 1 mL Ni affinity prepacked columns were purchased from Sangon Biotechnology Co., Ltd. (Shanghai, China).

[0025] 2. Preparation of Viral Genomic DNA A standard plasmid containing the monkeypox virus F3L gene fragment (GenBank No. ON568298 / ON563414, 46168-46630 nt) was synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). Pseudovirus samples representing monkeypox virus and other human-associated orthopoxviruses (including cowpox virus, smallpox virus, and buffalopox virus), as well as DNA standards representing the N and ORF genes of SARS-CoV-2, were purchased from Fubaiao Biotechnology Co., Ltd. (Shanghai, China). Genomic DNA of Pseudomonas aeruginosa (ATCC 9027) was purchased from the American Type Culture Collection (ATCC). Skin swab samples were collected from consenting healthy individuals, immersed in 2 mL of virus stock solution (BeyondSky Biotechnology, Shanghai, China), and aliquoted into 200 µL aliquots. Mock samples were prepared by mixing the desired amount of monkeypox pseudovirus with the aliquots. The number of monkeypox pseudovirus copies in each mock sample was quantified by qPCR. Briefly, commercially available pseudotyped monkeypox virus (10 particles / mL) was tested using a monkeypox virus nucleic acid detection kit (qPCR) to determine the correlation between copy number and Ct value. Mock samples were subsequently tested using the same qPCR kit to confirm the copy number of each sample. DNA was extracted from the samples using a DNA extraction kit. qPCR experiments were performed on a Roche LightCycler 480 II qPCR instrument.

[0026] 3. Expression and purification of Cas12b (1) Plasmid construction: CRISPR-Cas12b was recombinantly expressed using the commercial plasmid BPK2014-AaCas12b (Shanghai Enzyme-Link Biotechnology Co., Ltd.). This plasmid contains the Cas12b expression coding sequence from Alicyclobacillus sp. (GenBank No. WP_067623834) and a 6×His tag at the C-terminus.

[0027] (2) Protein expression Transformation: The BPK2014-AaCas12b plasmid was transformed into BL21 (DE3) pLysS expression competent cells, incubated at 37°C, 200 rpm for 1 h, and plated onto LB solid medium containing Kana (50 µg / mL) and Chl (100 µg / mL); Activation: Pick 10 single clones and culture them in LB liquid medium containing 50µg / ml kanamycin and 35µg / ml chloramphenicol, at 37°C, 200rpm, for 4h; Scale up: Add 10 mL of activated bacterial solution to 500 mL of LB medium containing the corresponding resistance and culture at 37°C until the OD600 reaches 0.6-0.8; Induction: Add IPTG to a final concentration of 0.5 mM and incubate at 16 °C, 220 rpm, and shake for 16 h to induce AaCas12b protein expression; Harvest the bacteria: centrifuge the bacteria at 7500xg for 5 min at 4°C, collect the precipitate and store at -80°C for later purification.

[0028] (3) Protein purification The stored cells were resuspended in Buffer A (50 mM NaH₂PO₄ (pH 8.0), 300 mM NaCl) and PI (1000X). The cells were disrupted using a low-temperature high-pressure homogenizer at 1000-1500 MPa until the cells were no longer viscous. The suspension was transferred to a 50 mL centrifuge tube and centrifuged at 15,000 x g for 45 minutes at 4°C to separate the supernatant and precipitate. The supernatant was collected and passed through a 0.22 µM aqueous filter. Affinity purification was performed on an AKTA Prime-Plus instrument using a 1 mL Ni affinity prepacked column. Loading: The supernatant was passed through the Ni affinity prepacked column at a flow rate of 1 mL / min. Wash: Adjust the concentration of 95% Lysis Buffer + 5% Elution Buffer using the instrument, and wash for 10 column volumes until UV absorption equilibrium was reached. Elute: Adjust the Elution Buffer concentration from 5% to 100% using the instrument, and elute using a linear gradient over 10 column volumes. Sample collection: Collect the solution based on the UV absorption peak. Identify the collected protein solution using SDS-PAGE gel. Transfer the protein solution identified by SDS-PAGE to a dialysis bag and dialyze overnight in Cas12b Storage buffer. Purified Cas12b is stored in 50mM Tris-HCl (pH 8.0), 200mM NaCl, 0.1mM EDTA, 1mM DTT, and 20% glycerol at -20°C.

[0029] Example 1: sgRNA preparation A sgRNA sequence was designed based on the PAM sequence (TTV) in the RPA amplicon. The gene sequence is shown in SEQ ID NO. 3. To prepare the sgRNA, a plasmid for in vitro transcription was synthesized at General Bio. This plasmid contains the T7 promoter (TAATACGACTCACTATA) + the AaCas12b scaffold sequence (TGTCTAGAGGACAGAATTTTTCAACGGGTGTGCCAATGGCCACTTTCCAGGTGGCAAAGCCCGTTGAGCTTCTCAAATCTGAGAAGTGGCAC) + the target sequence (20 bp after the PAM sequence of the target DNA). A pair of amplification primers was designed for this plasmid. After amplification with KI high-fidelity enzyme, the amplified product was purified using the FastPure Gel DNA Extraction Mini Kit. The purified product was used with the T7 High-Yield RNA Transcription Kit to obtain the sgRNA required for detection. The transcribed sgRNA was purified by phenol-chloroform extraction, dissolved in DEPC water, and quantified using a Qubit 4 fluorometer against an RNA standard.

[0030] Example 2: CRATS one-pot reaction system A one-pot CRISPR reaction mixture was prepared by mixing two premixes: the RPA premix and the Cas12b premix. The RPA premix was prepared by adding 25 μL of Buffer A and 2 μL each of 10 μM forward and reverse primers to lyophilized enzyme powder (Hangzhou Zhongce Biotechnology Co., Ltd.). To a total volume of 80 μL of CRISPR premix, a final concentration of 260 nM Cas12b, 2 μM molecular beacon, and 200 nM sgRNA were added, along with 1× NEB Buffer 2.1, and the volume was brought up to 80 μL with deionized water. The forward and reverse primers, RPA-F and RPA-R, have the gene sequences shown in SEQ ID NOs. 1 and 2, respectively. The molecular beacon, ssDNA-FQ, has the gene sequence shown in SEQ ID NO. 4. A 25 μL one-tube CRATS reaction mixture was prepared by mixing 14.5 μL of RPA premix, 6.25 μL of Cas12b premix, 1.25 μL of buffer B, and 3 μL of monkeypox virus F3L standard plasmid. The reaction was incubated at 37°C for 20 min and then incubated in a 60°C mini-metal bath for 20 min. The FAM fluorescence signal (excitation wavelength 495 nm) was monitored using a Roche LightCycler 480 II qPCR machine (Basel, Switzerland), with the FAM signal read every 1 min. Figure 1 The endpoint fluorescence signal was observed with the naked eye under blue light.

[0031] Example 3: Performance evaluation of the CRATS one-pot process The sensitivity of CRATS in detecting monkeypox virus was tested using standard plasmid DNA at different concentrations. The results showed that the sensitivity was single copy / reaction ( Figure 2 A), making the CRATS method one of the most sensitive assays for monkeypox virus detection.

[0032] The specificity of the CRATS one-pot assay was verified by testing a series of orthopoxviruses, including cowpox virus, buffalopox virus, vaccinia virus, smallpox virus, SARS-CoV-2 N gene, SARS-CoV-2 ORF gene, and Pseudomonas aeruginosa. The results showed that only monkeypox virus produced a positive signal, such as Figure 2 As shown in Figure B, the CRATS method has good specificity. The one-pot CRATS was validated using simulated skin samples. When these samples contained different amounts of monkeypox pseudovirus, CRATS showed the same good sensitivity as standard plasmid DNA, that is, single copy / reaction, as shown in Figure 4. Figure 2 These results indicate that CRATS has potential application value in the clinical diagnosis of monkeypox virus infection.

[0033] The above are all preferred embodiments of the present invention. For ordinary technicians in this technical field, without departing from the principle of the present invention, various equivalent modifications to the present invention are within the scope of protection of the claims attached to this application.

Claims

1. A high-sensitivity method for detecting monkeypox virus using a one-pot RPA-CRISPR method based on temperature control, characterized by: This detection method is abbreviated as CRATS. CRATS regulates the reaction in a one-tube system in stages through temperature switching: first completing target amplification at 37°C, then raising the temperature to 60°C to initiate Cas12b cutting, achieving temporal separation of amplification and cutting reactions, and finally achieving detection through the release of fluorescent signals by molecular beacon breakage.

2. The method for detecting monkeypox virus with high sensitivity using a one-pot RPA-CRISPR method based on temperature control according to claim 1, characterized in that: The detection comprises the following steps: (1) Preparation of viral genomic DNA; (2) Expression and purification of Cas12b; (3) sgRNA preparation; (4) CRATS one-pot reaction system; (5) Monitor the fluorescence signal and plot the data.

3. The method of claim 2 for detecting monkeypox virus with high sensitivity using a one-pot RPA-CRISPR method based on temperature control, characterized in that: The steps of the CRATS one-pot reaction system are as follows: (1) Prepare RPA premix and Cas12b premix; (2) The two premixes were mixed to prepare a one-pot CRATS reaction mixture; (3) The mixture in step (2) was incubated at 37°C for 20 min, and then incubated in a small metal bath at 60°C for 20 min; (4) Monitor the FAM fluorescence signal and read it every 1 minute. The endpoint signal is observed with the naked eye under blue light.

4. The method of claim 3 for detecting monkeypox virus with high sensitivity using a one-pot RPA-CRISPR method based on temperature control, characterized in that: In step (1), an RPA premix solution is prepared by adding 25 μL of A buffer, 2 μL of a 10 μM forward primer, and 2 μL of a 10 μM reverse primer to the lyophilized enzyme powder to prepare an RPA premix solution; Prepare Cas12b master mix: Add 260 nM Cas12a, 2 µM ssDNA-FQ, 200 nM crRNA to a total volume of 80 µL CRISPR master mix, add 1× NEB buffer 2.1, and finally make up to 80 µL with deionized water. The one-pot CRATS reaction mixture in step (2) was prepared by mixing 14.5 µL RPA premix, 6.25 µL Cas12b premix, 1.25 µL B buffer and 3 µL monkeypox virus F3L standard plasmid to prepare a 25 µL one-pot CRATS reaction mixture.

5. The method of claim 4 for detecting monkeypox virus with high sensitivity using a one-pot RPA-CRISPR method based on temperature control, characterized in that: The forward and reverse primers are RPA-F and RPA-R, and their gene sequences are SEQ ID NO.1 and SEQ ID NO.2 respectively; the ssDNA-FQ is a molecular beacon, and its gene sequence is shown in SEQ ID NO.

4.

6. The temperature-controlled one-pot RPA-CRISPR technique for high-sensitivity detection of monkeypox virus according to claim 2, characterized in that: The expression and purification of Cas12b includes plasmid construction, protein expression, and protein purification; the sgRNA gene sequence is as shown in SEQ ID NO. 3.

Citation Information

Cited By

  • Variable-temperature one-step method detection system based on weak-effect PAM, establishment method of system and application of system in detection of chlamydia psittaci

    CN121496076A