Preparation of tetrastigma hemsleyanum extract and application of tetrastigma hemsleyanum extract in drugs for inhibiting ferroptosis and pyroptosis of epithelial cells in double ways

Abstract

The invention discloses a preparation method of a radix tetrastigme extract and an application of the radix tetrastigme extract in a medicine for inhibiting epithelial cell ferroptosis and pyroptosis in double ways, and mainly discloses an application of the radix tetrastigme extract in a medicine for inhibiting epithelial cell ferroptosis and pyroptosis in double ways. Comprising the following components: kaempferol-3-carveosyl glucose-7-rhamnoside and kaempferol-3-glucose-7-rhamnoside. In the technical scheme, the radix tetrastigme root hair extract can inhibit an SLC7A11 / GPX4 signal channel and an NLRP3 / GSDMD signal channel at the same time by up-regulating the protein expression levels of SLC7A11 and GPX4 and down-regulating the protein expression levels of NLRP3 and GSDMD-N at the same time, so that the radix tetrastigme root hair extract has a double-channel inhibition effect on ferroptosis and pyroptosis of epithelial cells at the same time; according to the scheme, the unique kaempferol-3-apiosyl glucose-7-rhamnoside and kaempferol-3-glucose-7-rhamnoside are extracted from the radix tetrastigme root hair, the extraction process is optimized, and the radix tetrastigme root hair with high purity is obtained through separation and effectively utilized.

Description

Technical Field

[0001] The present invention relates to the field of medical technology, and in particular to the preparation of a cloverleaf green extract and application of the extract in a drug for inhibiting ferroptosis and pyroptosis of epithelial cells through dual pathways. Background Art

[0002] Tetrastigma hemsleyanum (Diels et Gilg, TH) is a perennial vine of the Vitaceae family. It is mild in nature, slightly bitter in taste, and enters the liver and lung meridians, with benefits such as clearing heat and detoxifying, as well as anti-inflammatory and analgesic properties. The tuberous root is the primary medicinal part of Tetrastigma hemsleyanum. However, in actual production and research, the underground roots of Tetrastigma hemsleyanum are often discarded. These roots are rich in flavonoids and have a large biomass, resulting in significant waste of Tetrastigma resources.

[0003] Epithelial cells serve as the first barrier between the body and the external environment. They are widely distributed on the surfaces of organs such as the respiratory tract, digestive tract, and skin. Their functional integrity is crucial for maintaining tissue homeostasis. Studies have shown that epithelial cell damage is a core pathological link in many diseases, including acute lung injury (ALI), acute respiratory distress syndrome (ARDS), chronic obstructive pulmonary disease (COPD), inflammatory bowel disease (IBD), and inflammatory skin diseases. In the respiratory system, damage to alveolar epithelial cells and bronchial epithelial cells can lead to destruction of the alveolar-capillary barrier, release of inflammatory factors, and increased oxidative stress, thereby inducing pulmonary edema and fibrosis. However, current therapeutic strategies for the specific protection of epithelial cells still have limitations, and there is an urgent need to develop multi-target intervention drugs.

[0004] Ferroptosis is an iron-dependent, non-apoptotic form of programmed cell death characterized by the uncontrolled accumulation of membrane lipid peroxidation (LPO), ultimately leading to cell membrane structural destruction and functional failure. Pyroptosis is an inflammation-associated programmed necrotic cell death mediated by the Gasdermins (GSDM) family of proteins, primarily through the release of pro-inflammatory cytokines such as IL-1β and IL-18.

[0005] In many diseases, the interaction between ferroptosis and pyroptosis is bidirectional and complex. On the one hand, ferroptosis can upregulate the transcription of NLRP3 inflammasome and activate the expression of pro-inflammatory genes such as NLRP3 and IL-1β through the reactive oxygen species (ROS) produced by LPO. In addition, the Fe released by ferroptosis can 2+It not only catalyzes the generation of ROS through the Fenton reaction, but also directly binds to the PYD domain of NLRP3, promoting its oligomerization and inflammasome assembly, and activating the occurrence of cell pyroptosis. On the other hand, IL-1β and IL-18 released after the activation of NLRP3 inflammasome activate downstream pathways by binding to its receptors, further increasing the generation of ROS. ROS reduces cystine uptake by inhibiting the function of the SLC7A11 transporter, leading to GSH depletion and GPX4 inactivation. In addition, the pores formed by the pyroptosis execution protein GSDMD-N in the cell membrane cause cell swelling and rupture, while hindering the Fe 2+ Efflux through membrane channels leads to intracellular Fe 2+ Accumulation. The oxidative stress of ferroptosis and the inflammatory outbreak of pyroptosis form a vicious cycle that can lead to exponentially worsening tissue damage and is closely related to the occurrence and development of diseases such as acute lung injury, stroke, neurodegenerative diseases, cardiovascular diseases, and diabetes. Therefore, the development of drugs that dually inhibit ferroptosis and pyroptosis in epithelial cells is highly desirable. Summary of the Invention

[0006] In order to solve the above-mentioned technical problems, the present invention provides a preparation method of kaempferol-3-apiosyl glucose-7-rhamnoside and kaempferol-3-glucose-7-rhamnoside, which are extracts of Tripterygium wilfordii, and their application in drugs that inhibit ferroptosis and pyroptosis of epithelial cells through dual pathways. The present invention discovers for the first time that kaempferol-3-apiosyl glucose-7-rhamnoside and kaempferol-3-glucose-7-rhamnoside, which are extracts extracted from Tripterygium wilfordii roots, can inhibit ferroptosis and pyroptosis of epithelial cells through dual pathways, providing a new approach for the treatment of related diseases. In addition, the present invention also optimizes the process of extracting kaempferol-3-apiosyl glucose-7-rhamnoside and kaempferol-3-glucose-7-rhamnoside from Tripterygium wilfordii roots, thereby promoting the effective utilization of Tripterygium wilfordii resources.

[0007] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions:

[0008] The application of Tripterygium wilfordii extract in dual-pathway inhibition of ferroptosis and pyroptosis of epithelial cells. The Tripterygium wilfordii extract is an extract from the roots of Tripterygium wilfordii, including kaempferol-3-apiosylglucose-7-rhamnoside and kaempferol-3-glucose-7-rhamnoside.

[0009] The molecular formula of the kaempferol-3-apiosyl glucose-7-rhamnoside is C 32 H 38 O 19 , the structural formula is:

[0010]

[0011] The molecular formula of the kaempferol-3-glucose-7-rhamnoside is C 27H 30 O 15 , the structural formula is:

[0012]

[0013] Preferably, the mechanism for inhibiting ferroptosis is to inhibit the TFR1 / SLC7A11 / GPX4 signaling pathway; the mechanism for inhibiting pyroptosis is to inhibit the NLRP3 / ASC / Caspase-1 / IL-1β / IL-18 / GSDMD-N signaling pathway.

[0014] Preferably, inhibiting the TFR1 / SLC7A11 / GPX4 signaling pathway refers to downregulating the expression level of TFR1 protein and upregulating the expression levels of SLC7A11 and GPX4 proteins; inhibiting the NLRP3 / ASC / Caspase-1 / IL-1β / IL-18 / GSDMD-N signaling pathway refers to downregulating the expression levels of NLRP3 / ASC / Caspase-1 / IL-1β / IL-18 and GSDMD-N proteins.

[0015] Preferably, the epithelial cells include BEAS-2B, Caco-2 or HaCaT cells.

[0016] Preferably, diseases related to epithelial cell ferroptosis and pyroptosis include acute lung injury, acute respiratory distress syndrome, chronic obstructive pulmonary disease, inflammatory bowel disease and inflammatory skin diseases.

[0017] A dual-pathway drug for inhibiting ferroptosis and pyroptosis of epithelial cells, the active ingredients of which are kaempferol-3-apiosylglucose-7-rhamnoside and kaempferol-3-glucose-7-rhamnoside.

[0018] Preferably, the drug preparation is selected from one of oral solution, tablet, capsule or granule.

[0019] Preferably, the drug further contains pharmaceutically acceptable excipients or auxiliary ingredients.

[0020] The preparation of the clover extract used in the dual-pathway drug for inhibiting ferroptosis and pyroptosis of epithelial cells as described above comprises the following steps:

[0021] (1) The treated roots of Tripterygium wilfordii were mixed with 40-100% ethanol at a solid-liquid ratio of 1:5-1:25, extracted 1-5 times at 50-100°C, and the filtrates were combined and concentrated to 1 / 5-1 / 20 of the original volume;

[0022] (2) gradient elution with a macroporous resin, eluting with water, 10-20% ethanol, 30-50% ethanol, and 60-100% ethanol, respectively, to obtain component B; the macroporous resin includes one or more of HPD-28, AB-8, D140, and HPD417;

[0023] (3) Component B was purified by semi-preparative HPLC using acetonitrile-0.1% phosphoric acid solution, and the eluate was measured at 348 nm. The eluate with a retention time of 23.7-28.5 min was collected, concentrated and evaporated to dryness under reduced pressure to obtain the trifoliate green extract.

[0024] The method for processing the roots of Tripterygium wilfordii is to remove impurities from the roots, wash them, dry them in the air, dry them at 50-70℃ for 20-50min, and cut them into small segments with a slicer to obtain small segments of the roots of Tripterygium wilfordii.

[0025] Preferably, in step (3), the chromatographic column of the semi-preparative HPLC is an octadecylsilane bonded silica gel column, the column temperature is 30°C, the elution gradient is maintained at 5% acetonitrile in 0-12 min, increased to 15% acetonitrile in 12-40 min, and the flow rate is 5 mL / min.

[0026] The present invention has the following beneficial effects due to the adoption of the above technical solution:

[0027] 1. The present invention provides an alternative solution for the dual-pathway simultaneous inhibition of epithelial cell ferroptosis and pyroptosis and the treatment of related diseases, and offers new ideas for the development and innovation of drugs that simultaneously target epithelial cell ferroptosis and pyroptosis. Kaempferol-3-pyroglucose-7-rhamnoside and kaempferol-3-glucose-7-rhamnoside (SYQ-Flavonoid mix) can simultaneously inhibit the SLC7A11 / GPX4 signaling pathway and the NLRP3 / GSDMD signaling pathway by upregulating the expression levels of SLC7A11 and GPX4 proteins and downregulating the expression levels of NLRP3 and GSDMD-N proteins, thereby simultaneously inhibiting the SLC7A11 / GPX4 signaling pathway and the NLRP3 / GSDMD signaling pathway, achieving a dual-pathway inhibitory effect on epithelial cell ferroptosis and pyroptosis. In cell experiments, 40 μg / mL SYQ-Flavonoid mix can increase the survival rate of epithelial cells induced by Erastin and LPS+Nig, especially BEAS-2B cells; 20-80 μg / mL SYQ-Flavonoid mix can downregulate the TFR1 gene, upregulate the GPX4 and SLC7A11 genes, inhibit the occurrence of ferroptosis in Erastin-induced BEAS-2B cells, and downregulate the key pyroptosis genes NLRP3, ASC, Caspase-1, IL-1β, IL-18, and GSDMD-N, inhibiting the occurrence of pyroptosis in BSEA-2B cells induced by LPS+Nig.

[0028] 2. The present invention extracts the unique kaempferol-3-apiosylglucose-7-rhamnoside and kaempferol-3-glucose-7-rhamnoside (SYQ-Flavonoid mix) from the roots of Tripterygium wilfordii, optimizes the extraction process, and separates the SYQ-Flavonoid mix with a purity of more than 92%, thereby effectively utilizing the roots of Tripterygium wilfordii. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is the HPLC characterization spectrum of kaempferol-3-apiosylglucose-7-rhamnoside and kaempferol-3-glucose-7-rhamnoside in SYQ-Flavonoid mix;

[0030] Figure 2 These are the MS / MS spectra of kaempferol-3-apiosylglucose-7-rhamnoside and kaempferol-3-glucose-7-rhamnoside in the SYQ-Flavonoid mix. Figure A: MS / MS spectra of kaempferol-3-apiosylglucose-7-rhamnoside; Figure B: MS / MS spectra of kaempferol-3-glucose-7-rhamnoside.

[0031] Figure 3 is the protective effect of SYQ-Flavonoid mix on BEAS-2B cells; A: The protective effect of SYQ-FM on BEAS-2B cells induced by Erastin; B: The protective effect of SYQ-FM on BEAS-2B cells induced by LPS+Nig; Compared with the CON group, # P<0.05, ## P<0.01; compared with the Erastin / LPS+Nig group, $ P<0.05, $$ P < 0.01;

[0032] Figure 4 is the protective effect of SYQ-Flavonoid mix on Caco-1 cells; A: The protective effect of SYQ-FM on Caco-1 cells induced by Erastin; B: The protective effect of SYQ-FM on Caco-1 cells induced by LPS+Nig; Compared with the CON group, # P<0.05, ## P<0.01; compared with the Erastin / LPS+Nig group, $ P<0.05, $$ P < 0.01;

[0033] Figure 5is the protective effect of SYQ-Flavonoid mix on HaCaT cells; A: The protective effect of SYQ-FM on HaCaT cells induced by Erastin; B: The protective effect of SYQ-FM on HaCaT cells induced by LPS+Nig; Compared with the CON group, # P<0.05, ## P<0.01; compared with the Erastin / LPS+Nig group, $ P<0.05, $$ P < 0.01;

[0034] Figure 6 The effect of SYQ-Flavonoid mix on lipid peroxidation and oxidative stress in BEAS-2B cells induced by Erastin; A: T-SOD content in cells; B: MDA content in cells; C: LPS content in cells; D: GSH content in cells; Compared with the CON group, # P<0.05, ## P<0.01; compared with the Erastin group, $ P<0.05, $$ P < 0.01;

[0035] Figure 7 The effect of SYQ-Flavonoid mix on mitochondrial membrane potential in Erastin-induced BEAS-2B cells; compared with the CON group, # P<0.05, ## P<0.01; compared with the Erastin group, $ P<0.05, $$ P < 0.01;

[0036] Figure 8 The effect of SYQ-Flavonoid mix on Fe 2+ Inhibitory effect; compared with the CON group, # P<0.05, ## P<0.01; compared with the Erastin group, $ P<0.05, $$ P < 0.01;

[0037] Figure 9The effect of SYQ-Flavonoid mix on key proteins of ferroptosis; A: Representative images of TF, SLC7A11, GPX4 and β-actin proteins determined by WB method; B: Gray value statistics of GPX4 / β-actin bands; C: Gray value statistics of TF / β-actin bands; D: Gray value statistics of SLC7A11 / β-actin bands; Compared with the CON group, # P<0.05, ## P<0.01; compared with the Erastin group, $ P<0.05, $$ P < 0.01;

[0038] Figure 10 The effect of SYQ-Flavonoid mix on key ferroptosis genes; A: relative expression of GPX4 mRNA determined by RT-PCR; B: relative expression of TFR1 mRNA determined by RT-PCR; C: relative expression of SLC7A11 mRNA determined by RT-PCR; compared with the CON group, # P<0.05, ## P<0.01; compared with the Erastin group, $ P<0.05, $$ P < 0.01;

[0039] Figure 11 SYQ-Flavonoid mix improved the inflammatory response of BSEA-2B induced by LPS+Nig; the levels of inflammatory factors IL-1β, IL-6 and TNF-α were determined by ELISA; compared with the CON group, # P<0.05, ## P<0.01; compared with LPS+Nig group, $ P<0.05, $$ P < 0.01;

[0040] Figure 12 The SYQ-Flavonoid mix regulates the key proteins of pyroptosis; A: Representative images of NLRP3, GSDMD-N, IL-1β, ASC, IL-18, Caspase-1 and β-actin proteins determined by WB; B: Gray value statistics of NLRP3 / β-actin bands; C: Gray value statistics of GSDMD-N / β-actin bands; D: Gray value statistics of IL-1β / β-actin bands; E: Gray value statistics of ASC / β-actin bands; F: Gray value statistics of IL-18 / β-actin bands; G: Gray value statistics of Caspase-1 / β-actin bands; Compared with the CON group,# P<0.05, ## P<0.01; compared with LPS+Nig group, $ P<0.05, $$ P < 0.01;

[0041] Figure 13 The effect of SYQ-Flavonoid mix on key genes of pyroptosis; A: RT-PCR was used to determine the relative expression of NLRP3 mRNA; B: RT-PCR was used to determine the relative expression of GSDMD-N mRNA; C: RT-PCR was used to determine the relative expression of IL-1β mRNA; D: RT-PCR was used to determine the relative expression of ASC mRNA; E: RT-PCR was used to determine the relative expression of IL-18 mRNA; F: RT-PCR was used to determine the relative expression of Caspase-1 mRNA; Compared with the CON group, # P<0.05, ## P<0.01; compared with LPS+Nig group, $ P<0.05, $$ P<0.01. DETAILED DESCRIPTION

[0042] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0043] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0044] Example 1:

[0045] The method for extracting and preparing SYQ-Flavonoid mix (SYQ-FM) from the roots of Tripterygium wilfordii is as follows:

[0046] (1) The treated roots of Tripterygium wilfordii were mixed with 60% ethanol at a solid-liquid ratio of 1:10, soaked for 30 min, and extracted at 90 °C for 2 h. The extraction times were 2 times. The filtrates of the two extractions were combined and concentrated to 3.4 mg / mL to 5 mg / mL using a rotary evaporator.

[0047] (2) The concentrated filtrate in step (1) was purified using HPD417 macroporous resin. First, the resin was soaked in anhydrous ethanol for 24 hours to fully swell, then loaded into a chromatography column. After the anhydrous ethanol was released, the column was washed with water until there was no alcohol smell. The volume of HPD417 macroporous resin: concentrated filtrate was loaded at a ratio of 1:3, and the resin was eluted with water, 20% ethanol, 50% ethanol, and 100% ethanol in sequence, and the resin was divided into 4 parts. HPLC-DAD detection found that the target component was concentrated in component B.

[0048] (3) Component B was purified by semi-preparative HPLC on an octadecylsilane bonded silica gel column with acetonitrile as mobile phase A and 0.1% phosphoric acid solution as mobile phase B; the column temperature was 30°C, the detection wavelength was 348 nm, and the flow rate was 5 mL / min; the elution program was as follows: 0-12 min, 5% mobile phase A, 95% mobile phase B, 12-40 min, 15% mobile phase A, 85% mobile phase B, and the eluate with a retention time of 23.7-28.5 min was collected, concentrated, and dried to obtain SYQ-Flavonoid mix (SYQ-FM).

[0049] The semi-preparative HPLC chromatogram of the mixture of kaempferol-3-O-glucopyranose-7-O-rhamnoside and kaempferol-3-O-β-D-glucopyranose-7-O-α-L-rhamnoside in SYQ-Flavonoid mix is shown in Figure 2. Figure 1 The purity of the mixture of kaempferol-3-O-glucose-7-O-rhamnoside and kaempferol-3-O-β-D-pyranose-7-O-α-L-rhamnoside separated in the SYQ-Flavonoid mix obtained in this example is about 92%. The specific structure identification mass spectrum is shown in the figure below. Figure 2 shown.

[0050] The above-mentioned SYQ-Flavonoid mix (SYQ-FM) was used for cell experiments.

[0051] Cell culture conditions: BEAS-2B, Caco-2, and HaCaT cells were cultured in DMEM high-glucose complete medium supplemented with 10% fetal bovine serum and 1% double-antibody in a cell culture incubator (37°C, 5% CO2). The cells cultured here were used in the subsequent examples.

[0052] Example 2: Protective effect of SYQ-FM on BEAS-2B cells, Caco-1 cells and HaCaT cells

[0053] BEAS-2B cells, Caco-1 cells, and HaCaT cells were grouped and treated as follows:

[0054] (1) Blank (CON) group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were cultured with serum-free medium for 48 h, with the serum-free medium being changed every 24 h.

[0055] (2) Erastin group: The cells were first cultured with DMEM high-glucose complete medium for 24 h, then replaced with serum-free medium (containing 10 μg / mL Erastin) for 24 h, and then replaced with serum-free medium (containing 10 μg / mL Erastin) for another 24 h.

[0056] (3) Erastin+SYQ-FM-1 group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium (containing 10 μg / mL Erastin) for another 24 h, and then replaced with serum-free medium (containing 80 μg / mL SYQ-FM and 10 μg / mL Erastin) for another 24 h.

[0057] (4) Erastin+SYQ-FM-2 group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium (containing 10 μg / mL Erastin) for another 24 h, and then replaced with serum-free medium (containing 40 μg / mL SYQ-FM and 10 μg / mL Erastin) for another 24 h.

[0058] (5) Erastin+SYQ-FM-3 group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium (containing 10 μg / mL Erastin) for another 24 h, and then replaced with serum-free medium (containing 20 μg / mL SYQ-FM and 10 μg / mL Erastin) for another 24 h.

[0059] (6) Erastin + Ferrostatin-1 (Fer-1) group: The cells were first cultured with DMEM high-glucose complete medium for 24 h, then replaced with serum-free medium (containing 10 μg / mL Erastin) for 24 h, and finally replaced with serum-free medium (containing 1 μM Fer-1 and 10 μg / mL Erastin) for another 24 h.

[0060] (7) LPS + nigericin (Nig) group: After culturing in DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium (containing 1 μg / mL LPS + 2.5 μg / mL Nig) and cultured for another 24 h.

[0061] (8) LPS+Nig+SYQ-FM-1 group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium (containing 1 μg / mL LPS, 2.5 μg / mL Nig, and 80 μg / mL SYQ-FM) and cultured for another 24 h.

[0062] (9) LPS+Nig+SYQ-FM-2 group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium (containing 1 μg / mL LPS, 2.5 μg / mL Nig, and 40 μg / mL SYQ-FM) and cultured for another 24 h.

[0063] (10) LPS+Nig+SYQ-FM-3 group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium (containing 1 μg / mL LPS, 2.5 μg / mL Nig, and 20 μg / mL SYQ-FM) and cultured for another 24 h.

[0064] (11) LPS+Nig+MCC950 (MCC950) group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium (containing 1 μg / mL LPS, 2.5 μg / mL Nig, and 5 μM MCC950) and cultured for another 24 h.

[0065] Three parallel experiments were performed for each treatment;

[0066] After treating the cells according to the above conditions, the MTT assay was performed: discard the original culture medium and add 100 μL / well of MTT solution (0.5 mg / mL) and incubate at 37°C for 4 hours; discard the MTT solution and add 200 μL of DMSO solution / well, shaking to mix; measure the OD value of each well at a wavelength of 490 nm to calculate the cell survival rate. Cell survival rate (%) = (OD value of the drug group - OD value of the culture medium) / (OD value of the cell group - OD value of the culture medium) × 100%. Results are shown in Figure 2 In the figure, Cell viability (%CON) is the cell viability rate, "##" indicates a significant difference compared with the CON group (P<0.01), "$$" indicates a significant difference compared with the Erastin / LPS+Nig group (P<0.01), and "$" indicates a significant difference compared with the Erastin / LPS+Nig group (P<0.05).

[0067] Result analysis:

[0068] 1. SYQ-FM has a protective effect on BEAS-2B cells. Figure 3As shown in Figure A, compared with the Erastin group, the protective effect of SYQ-FM on ferroptosis in BEAS-2B cells was evaluated. It was found that SYQ-FM greatly improved the viability of BEAS-2B cells at a dose of 20 to 80 μg / mL, and showed a certain dose-dependency. The effect was best at a dose of 80 μg / mL, and at this dose, there was no significant difference in the replacement effect of SYQ-FM with the ferroptosis inhibitor Fer-1 on cell viability (P>0.05). Figure 3 As shown in Figure B, compared with the LPS+Nig group, the protective effect of SYQ-FM on BEAS-2B cell pyroptosis was evaluated. It was found that SYQ-FM greatly improved the viability of BEAS-2B cells at doses of 20 to 80 μg / mL, and showed a certain dose-dependent effect. The effect was best at a dose of 80 μg / mL, and there was no significant difference in the cell viability enhancement effect at this dose compared with the pyroptosis inhibitor MCC950 (P>0.05). This shows that SYQ-FM can greatly improve the survival rate of BEAS-2B cells damaged by Erastin or LPS+Nig.

[0069] 2. SYQ-FM has a protective effect on Caco-1 cells. Figure 4 As shown in A, the protective effect of SYQ-FM on ferroptosis of Caco-1 cells was evaluated compared with the Erastin group, and it was found that SYQ-FM at a dose of 40 to 80 μg / mL could improve the viability of Caco-1 cells. Figure 4 As shown in Figure B, the protective effect of SYQ-FM on pyroptosis in Caco-1 cells was evaluated compared with the LPS+Nig group. SYQ-FM at doses of 40 to 80 μg / mL increased the viability of BEAS-2B cells. This suggests that SYQ-FM can, to a certain extent, enhance the survival rate of Caco-1 cells induced by erastin or LPS+Nig.

[0070] 3. The protective effect of SYQ-FM on HaCaT cells. Figure 5 As shown in A, the protective effect of SYQ-FM on ferroptosis in HaCaT cells was evaluated compared with the Erastin group, and it was found that SYQ-FM at a dose of 40-80 μg / mL could improve the viability of HaCaT cells. Figure 5 As shown in Figure B, the protective effect of SYQ-FM on pyroptosis in BEAS-2B cells was evaluated compared with the LPS+Nig group. It was found that SYQ-FM at a dose of 40-80 μg / mL increased the viability of HaCaT cells. This suggests that SYQ-FM can, to a certain extent, enhance the survival rate of HaCaT cells induced by erastin or LPS+Nig.

[0071] Based on the above results, SYQ-FM had a very significant protective effect on Erastin / LPS+Nig-induced BEAS-2B cells. BEAS-2B cells were selected as a model to study the mechanism of anti-ferroptosis and anti-pyroptosis.

[0072] Example 3: Regulatory Effect of SYQ-FM on Ferroptosis in BEAS-2B Cells

[0073] BEAS-2B cells were grouped and treated as follows:

[0074] (1) Blank (CON) group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium for 48 h, with the serum-free medium replaced every 24 h;

[0075] (2) Erastin group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium (containing 10 μg / mL Erastin) for 24 h, and then replaced with serum-free medium (containing 10 μg / mL Erastin) for another 24 h.

[0076] (3) Erastin + SYQ-FM-1 group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium (containing 10 μg / mL Erastin) for another 24 h, and then replaced with serum-free medium (containing 80 μg / mL SYQ-FM and 10 μg / mL Erastin) for another 24 h.

[0077] (4) Erastin+SYQ-FM-2 group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium (containing 10 μg / mL Erastin) for another 24 h, and then replaced with serum-free medium (containing 40 μg / mL SYQ-FM and 10 μg / mL Erastin) for another 24 h.

[0078] (5) Erastin+SYQ-FM-3 group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium (containing 10 μg / mL Erastin) for another 24 h, and then replaced with serum-free medium (containing 20 μg / mL SYQ-FM and 10 μg / mL Erastin) for another 24 h.

[0079] (6) Erastin + Fer-1 (Fer-1) group: The cells were first cultured with DMEM high-glucose complete medium for 24 h, then replaced with serum-free medium (containing 10 μg / mL Erastin) for 24 h, and finally replaced with serum-free medium (containing 1 μM Fer-1 and 10 μg / mL Erastin) for another 24 h.

[0080] Three parallel experiments were performed for each treatment;

[0081] 1. Detection of total superoxide dismutase (T-SOD), malondialdehyde (MDA), lipid peroxidation products (LPO), and glutathione (GSH): Treat cells according to the method in the above grouping settings, wash cells twice with PBS, collect cells, and centrifuge at 3500rpm for 5 minutes to obtain cell pellets. Add lysis buffer to resuspend and ultrasonically disrupt cells, centrifuge at 12000rpm for 10 minutes to obtain supernatant. Then determine the content of T-SOD, MDA, LPO, and GSH in the sample according to the kit method. The results are as follows. Figure 6 As shown in Figures A and B, compared with the erastin group, SYQ-FM at doses ranging from 20 to 80 μg / mL significantly increased the secretion of T-SOD and GSH in BEAS-2B cells (P < 0.05, 0.01) and decreased the expression of MDA and LPO (P < 0.05, 0.01). This effect was dose-dependent. Furthermore, at a dose of 80 μg / mL, SYQ-FM showed no significant difference in the improvement of T-SOD, MDA, LPO, and GSH compared with the ferroptosis inhibitor Fer-1 (P > 0.05). Therefore, SYQ-FM can significantly reverse the lipid peroxidation and antioxidant capacity during erastin-induced ferroptosis in BEAS-2B cells.

[0082] 2. JC-1 mitochondrial membrane potential determination: cells (5×10 4 Cells were seeded in 24-well plates (cells / well), and after the density reached 70% to 80%, the cells were treated according to the above grouping method. After the cells were treated, JC-1 working solution was prepared according to the instructions, cell resuspension solution: JC-1 working solution = 1:1, inverted to mix, 37°C, 20min. After the incubation, centrifuged at 3500rpm, 4°C for 4min to obtain a cell pellet. After washing twice with JC-1 staining buffer (1×), the cell pellet was obtained. Resuspend with an appropriate amount of JC-1 staining buffer (1×), observe and take pictures under a fluorescence microscope. JC-1 was detected by fluorescence microplate reader: ① Monomer excitation light: 490nm, emission light: 530nm; ② Polymer excitation light: 525nm, emission light: 590nm; Calculate the mitochondrial membrane potential (MMP) level according to the instructions. The results are as follows Figure 7As shown, compared with the erastin group, SYQ-FM at 20-80 μg / mL significantly enhanced the red fluorescence of JC-1 aggregates and reduced the green fluorescence of JC-1 monomers, with the red / green fluorescence ratio significantly increased (P<0.01, 0.05). Furthermore, there was no significant difference in the reversal effect of SYQ-FM on mitochondrial membrane potential compared with the ferroptosis inhibitor Fer-1 at a dose of 80 μg / mL (P>0.05). These results indicate that SYQ-FM can significantly reverse erastin-induced BEAS-2B mitochondrial damage.

[0083] 3. Fe 2+ Assay: Cells (5×10 4 Cells were seeded at 500 μL / well in a 24-well plate. After the density reached 70% to 80%, the cells were treated according to the above grouping method. FerroOrange was balanced to room temperature and the powder in the bottle was centrifuged to the bottom of the tube at low speed. 35 μL of DMSO was added and pipetted 5 times repeatedly. After complete dissolution, 1 mM FerroOrange storage solution was obtained. The serum-free culture medium was used to prepare a final concentration of 5 μM FerroOrange working solution. The original culture medium was discarded and the working solution was added, 500 μL / well. After incubation in a cell culture incubator for 30 minutes, the cells were washed 1 to 2 times with sterile PBS. The cells were observed under a fluorescence microscope and photographed. The results are as follows: Figure 8 Results showed that compared with the Erastin group, 20-80 μg / mL of SYQ-FM could significantly reduce Fe 2+ The accumulation of Fe in cells was significantly decreased by SYQ-FM at a dose of 80 μg / mL and by the ferroptosis inhibitor Fer-1. 2+ The results showed that SYQ-FM could significantly reverse the ferroptosis induced by Erastin. 2+ Overload.

[0084] 4. Determination of the expression of key proteins in ferroptosis by WB method: After the above cells are treated according to (1), (2), (3), and (6), the culture medium is discarded, PBS is added to wash 3 times, the cells are scraped off, and collected into a centrifuge tube with PBS, centrifuged at 3500rpm for 5 minutes to obtain a cell pellet; cell lysis: resuspend the cells with lysis buffer, ultrasonically lyse at 4℃ for 30 minutes, centrifuge at 12000rpm for 10 minutes, and take the supernatant; after determining the protein concentration and quantification by BCA method, add a certain amount of loading buffer, heat at 100℃ for about 10 minutes to fully denature it, and place it in a -20℃ refrigerator for use. Prepare 5% concentrated gel mixture and 8% or 10% separation gel mixture according to the SDS-PAGE gel preparation ratio; first add the separation gel mixture, flatten the liquid surface with isopropanol, and after the separation gel solidifies, pour out the upper isopropanol. Continue to fill the glass plate with concentrated gel mixture, insert the sample comb, and remove it after solidification. Install the electrophoresis equipment, pull out the sample comb vertically, load the sample, and perform electrophoresis at a constant voltage of 120V. Stop the electrophoresis when the sample reaches the appropriate position. Activate the PVDF membrane with methanol for more than 5 minutes in advance, and cut out the gel intervals corresponding to different molecular weights according to the marker. The membrane was transferred using a wet transfer method at a constant current of 250 mA for 90 min. After transfer, the strips were blocked with 5% skim milk powder for 2 h. After washing with TBST, the membranes were added with antibodies against GPX4 (Boster, BM5231) at a dilution of 1:1000, antibodies against SLC7A11 (Boster, BM5318) at a dilution of 1:1000, antibodies against TF (Boster, RP1022) at a dilution of 1:10000, and antibodies against β-actin (Proteintech, 66009-1-Ig) at a dilution of 1:100,000, and incubated overnight at 4°C. After washing with TBST, the membranes were added with horseradish peroxidase-conjugated goat anti-rabbit IgG (Proteintech, SA00001-2) at a dilution of 1:100,000, and incubated at room temperature for 2 h. The membranes were then washed with TBST three times for 10 min each. The membranes were exposed to a chemiluminescence analyzer, stored, and analyzed using Image J. The results are shown in Figure 2. Figure 9 Compared with the erastin group, SYQ-FM at a dose of 80 μg / mL significantly upregulated the expression levels of GPX4 and SLC7A11 proteins (P<0.01) and downregulated the expression level of TF protein (P<0.01). Compared with the Fer-1 group, SYQ-FM's regulatory effects on these proteins were not significantly different (P>0.05). These results suggest that SYQ-FM can inhibit ferroptosis in BEAS-2B cells by promoting the expression of GPX4 and SLC7A11 proteins and inhibiting TF protein levels.

[0085] 5. Real-time fluorescence quantitative PCR (RT-PCR) determination of relative expression of key ferroptosis genes: After the above cells were treated according to (1), (2), (3), and (6), the TRIZOL method was used to extract RNA from the cells. The RNA concentration and purity were determined by NanoDrop spectrophotometer. Then, cDNA was used as a template and quantitative PCR was performed using a fluorescence quantitative PCR instrument. The target gene and internal reference gene reaction tubes were set up. The mRNA levels of related proteins were measured using a qRT-PCR kit. 2 -ΔΔCt The relative mRNA expression levels of the above proteins were calculated using GPADH as the internal reference gene. The primers are shown in Table 1 below:

[0086] Table 1: Primer sequences for BEAS-2B cells

[0087] Gene Forward(5'-3') Reverse(5'-3') GAPDH GAAAGCCTGCCGGTGACTAA GCCCAATACGACCAAATCAGAG GPX4 GTGCAGGCGCAGGAGG ACGCGCACGGGTCCT SLC7A11 ATGCAGTGGCAGTGACCTTT CATGGAGCCAAAGCAGGAGA TFR1 GGACGCGCTAGTGTTCTTCT CATCTACTTGCCGAGCCAGG

[0088] Test results such as Figure 10 As shown in the results, compared with the erastin group, the relative expression levels of GPX4 and SLC7A11 mRNA in the SYQ-FM group were significantly increased (P<0.01), and the expression level of the TFR1 gene was significantly decreased (P<0.01). Furthermore, compared with the Fer-1 group, there was no significant difference in the expression of these genes in the SYQ-FM group (P>0.05). This suggests that SYQ-FM can inhibit erastin-induced ferroptosis in BEAS-2B cells by downregulating the TFR1 gene and upregulating the GPX4 and SLC7A11 genes.

[0089] Furthermore, ROS levels were measured, and compared with the Erastin group, SYQ-FM at 80-20 μg / mL significantly reduced ROS levels in cells (P<0.01), and this was significantly dose-dependent, indicating that SYQ-FM can significantly reduce the surge in intracellular ROS levels induced by Erastin.

[0090] Example 4: Regulatory Effect of SYQ-FM on Pyroptosis in BEAS-2B Cells

[0091] BEAS-2B cells were grouped and treated as follows:

[0092] (1) Blank (CON) group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were cultured with serum-free medium for 48 h, with the serum-free medium being changed every 24 h.

[0093] (2) LPS+Nig group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium (containing 1 μg / mL LPS + 2.5 μg / mL Nig) and cultured for another 24 h.

[0094] (3) LPS+Nig+SYQ-FM-1 group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium (containing 1 μg / mL LPS, 2.5 μg / mL Nig, and 80 μg / mL SYQ-FM) and cultured for another 24 h.

[0095] (4) LPS+Nig+SYQ-FM-2 group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium (containing 1 μg / mL LPS, 2.5 μg / mL Nig, and 40 μg / mL SYQ-FM) and cultured for another 24 h.

[0096] (5) LPS+Nig+SYQ-FM-3 group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium (containing 1 μg / mL LPS, 2.5 μg / mL Nig, and 20 μg / mL SYQ-FM) and cultured for another 24 h.

[0097] (6) LPS+Nig+NLRP3 inhibition (MCC950) group: After culturing with DMEM high-glucose complete medium for 24 h, the cells were replaced with serum-free medium (containing 1 μg / mL LPS, 2.5 μg / mL Nig, and 5 μM MCC950) and cultured for another 24 h.

[0098] Three parallel experiments were performed for each treatment;

[0099] 1. Determination of inflammatory factor expression by ELISA: Treat cells according to the method in the above group setting, collect the cell supernatant, and centrifuge at 3500rpm for 5min to obtain cell supernatant without cell debris. Then fix the ELISA plate of IL-1β, IL-6 and TNF-α on a 96-well plate, add samples or standards, and incubate for binding. Then add enzyme-labeled detection antibody and incubate again. Finally, add colorimetric substrate, measure the absorbance according to the color depth, and compare with the standard curve for quantitative analysis. The results are as follows: Figure 11 As shown in the results, compared with the LPS+Nig group, SYQ-FM at doses of 80, 40, and 20 μg / mL significantly inhibited the expression of proinflammatory cytokines IL-1β, IL-6, and TNF-α (P<0.01). Furthermore, the ability of SYQ-FM to inhibit inflammatory factors at a dose of 80 μg / mL was not significantly different from that of the pyroptosis inhibitor MCC950 (P>0.05). These results indicate that SYQ-FM can inhibit the inflammatory response of LPS+Nig-induced cell pyroptosis by downregulating the expression levels of proinflammatory cytokines IL-1β, IL-6, and TNF-α.

[0100] 2. Determination of the expression of key pyroptosis proteins in cells by WB method: After the above cells are treated according to (1), (2), (4) and (6), the culture medium is discarded, and the cells are washed three times with PBS. The cells are scraped and collected into a centrifuge tube with PBS, and centrifuged at 3500 rpm for 5 minutes to obtain a cell pellet; cell lysis: resuspend the cells with lysis buffer, ultrasonically lyse at 4°C for 30 minutes, and centrifuge at 12000 rpm for 10 minutes to obtain the supernatant; after determining the protein concentration and quantifying it by BCA method, a certain amount of loading buffer is added, and the cells are heated at 100°C for about 10 minutes to fully denature them, and placed in a -20°C refrigerator for use.

[0101] Prepare a 5% stacking gel mixture and an 8% or 10% separating gel mixture according to the SDS-PAGE gel preparation ratio. First, add the separating gel mixture and flatten the liquid surface with isopropyl alcohol. Once the separating gel solidifies, pour off the upper layer of isopropyl alcohol. Continue to fill the glass plate with the stacking gel mixture and insert the sample comb. Once solidified, remove and set aside. Assemble the electrophoresis equipment, pull out the sample comb vertically, load the sample, and perform electrophoresis at a constant voltage of 120V. Stop the electrophoresis when the sample reaches the appropriate position. Pre-activate the PVDF membrane with methanol for at least 5 minutes and cut the gel segments corresponding to different molecular weights according to the marker. The membrane was transferred by wet transfer method with a constant current of 250 mA for 90 min. After the transfer, the strips were blocked with 5% skim milk powder for 2 h. After washing the membrane with TBST, IL-1β antibody (Affinity Bioscience, BF8021) diluted at a ratio of 1:1000, NLRP3 antibody (Boster, A00034-2) diluted at a ratio of 1:1000, and IL-18 antibody (Affinity Bioscience, BF8021) diluted at a ratio of 1:1000 were added. Bioscience, DF6252), ASC antibody (Boster, A00362-4) diluted at a ratio of 1:500, Caspase-1 antibody (Boster, M00048-2) diluted at a ratio of 1:1000, GSDMD-N antibody (Boster, M00048-2) diluted at a ratio of 1:100000, β-actin antibody (Proteintech, 66009-1-Ig) diluted at a ratio of 1:100000, incubated at 4°C overnight; after washing with TBST, horseradish peroxidase-conjugated goat anti-rabbit secondary antibody IgG (Proteintech, SA00001-2) diluted at a ratio of 1:100000 was added and incubated at room temperature for 2 hours; the membrane was washed with TBST for 10 minutes × 3 times. Chemiluminescence exposure was performed, and the data were saved and analyzed using Image J. The detection results are shown in Figure 2. Figure 12Compared with the LPS+Nig group, SYQ-FM at a dose of 80 μg / mL significantly inhibited the expression levels of NLRP3, GSDMD-N, IL-1β, ASC, and IL-18 proteins (P<0.01). Compared with the MCC950 group, SYQ-FM's regulatory effect on these proteins was not significantly different (P>0.05). These results suggest that SYQ-FM can exert an anti-pyroptosis effect on lung epithelial cells by downregulating the expression of NLRP3, GSDMD-N, IL-1β, ASC, and IL-18 proteins.

[0102] 3. Real-time fluorescence quantitative PCR (RT-PCR) determination of relative expression of key pyroptosis genes: After the above cells were treated according to (1), (2), (4), and (6), the RNA in the cells was extracted using the TRIZOL method. The RNA concentration and purity were determined using a NanoDrop spectrophotometer. Subsequently, cDNA was used as a template and quantitative PCR was performed using a fluorescence quantitative PCR instrument. Target gene and internal reference gene reaction tubes were set up. The mRNA levels of related proteins were measured using a qRT-PCR kit. 2 -ΔΔCt The relative mRNA expression levels of the above proteins were calculated using GPADH as the internal reference gene. The primers are shown in Table 2 below:

[0103] Table 2. Primer sequences for BEAS-2B cells

[0104] Gene Forward(5'-3') Reverse(5'-3') GAPDH GAAAGCCTGCCGGTGACTAA GCCCAATACGACCAAATCAGAG NLRP3 CTGGCATCTGGGGAAACCT TCCTTAGGCTTCGGTCCACA ASC TCTACCTGGAGACCTACGGC TCCAGAGCCCTGGTGC Caspase-1 GAAAAGCCATGGCCGACAAG TGTACCTTCACCCATGGAACG IL-1β CGAATCTCCGACCACCACTA AGGGAAAGAAGGTGCTCAGG IL-18 TGCAGTCTACACAGCTTCGG GCAGCCATCTTTATTCCTGCG GSDMD-N TTATTTGTACCCAAGGCTGCT GGCTTAGGTCCACACAGAAA

[0105] The results are as follows Figure 13 As shown in the results, compared with the LPS+Nig group, SYQ-FM at a dose of 80 μg / mL could significantly downregulate the key pyroptosis genes NLRP3, ASC, Caspase-1, IL-1β, IL-18, and GSDMD-N (P<0.01). The results showed that SYQ-FM could inhibit the occurrence of pyroptosis in BSEA-2B cells by inhibiting the above-mentioned key pyroptosis genes.

[0106] It can be seen from the above Examples 3 and 4 that the root extracts of Tripterygium wilfordii, kaempferol-3-piperidosyl glucose-7-rhamnoside and kaempferol-3-glucose-7-rhamnoside (SYQ-FM), can simultaneously and effectively inhibit ferroptosis and pyroptosis of BSEA-2B cells, improve ferroptosis and pyroptosis indicators and the abnormal expression of related proteins and genes, and are comparable to the effects of the classic ferroptosis inhibitor Ferrostatin and the pyroptosis inhibitor MCC950.

[0107] Although the embodiments of the present invention have been shown and described above, it is understandable that the above embodiments are illustrative and cannot be understood as limiting the present invention. Those skilled in the art may change, modify, replace, modify, delete some features, add features, or re-combine features to form a technical solution within the scope of the present invention without departing from the principles and purpose of the present invention. Any simple modifications, equivalent changes, and modifications made to the above embodiments based on the innovative principles of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. The use of Tripterygium wilfordii extract in a dual-pathway drug for inhibiting ferroptosis and pyroptosis of epithelial cells, characterized in that: Tripterygium wilfordii extract is an extract from the roots of Tripterygium wilfordii, and the Tripterygium wilfordii extract includes kaempferol-3-apiosylglucose-7-rhamnoside and kaempferol-3-glucose-7-rhamnoside.

2. The use according to claim 1, characterized in that The mechanism of inhibiting ferroptosis is to inhibit the TFR1 / SLC7A11 / GPX4 signaling pathway; the mechanism of inhibiting pyroptosis is to inhibit the NLRP3 / ASC / Caspase-1 / IL-1β / IL-18 / GSDMD-N signaling pathway.

3. The use according to claim 2, characterized in that Inhibition of the TFR1 / SLC7A11 / GPX4 signaling pathway refers to downregulating the expression level of TFR1 protein and upregulating the expression levels of SLC7A11 and GPX4 proteins; inhibition of the NLRP3 / ASC / Caspase-1 / IL-1β / IL-18 / GSDMD-N signaling pathway refers to downregulating the expression levels of NLRP3, ASC, Caspase-1, IL-1β, IL-18 and GSDMD-N proteins.

4. The use according to claim 1, characterized in that The epithelial cells include BEAS-2B, Caco-2 or HaCaT cells.

5. The use according to claim 1, characterized in that Diseases associated with epithelial cell ferroptosis and pyroptosis include acute lung injury, acute respiratory distress syndrome, chronic obstructive pulmonary disease, inflammatory bowel disease, and inflammatory skin diseases.

6. A dual-pathway drug for inhibiting ferroptosis and pyroptosis of epithelial cells, characterized in that: The active ingredients in the drug are kaempferol-3-apiosylglucose-7-rhamnoside and kaempferol-3-glucose-7-rhamnoside.

7. The drug according to claim 6, characterized in that The preparation of the medicine is selected from one of oral solution, tablet, capsule or granule.

8. The drug according to claim 6, characterized in that The medicine further contains pharmaceutically acceptable excipients or auxiliary ingredients.

9. Preparation of a clover extract for use in a dual-pathway drug for inhibiting ferroptosis and pyroptosis of epithelial cells as claimed in any one of claims 1 to 5, characterized in that: The following steps are involved: (1) The treated roots of Tripterygium wilfordii were mixed with 40-100% ethanol at a solid-liquid ratio of 1:5-1:25, extracted 1-5 times at 50-100°C, and the filtrates were combined and concentrated to 1 / 5-1 / 20 of the original volume; (2) performing gradient elution using a macroporous resin with water, 10-20% ethanol, 30-50% ethanol, and 60-100% ethanol, respectively, to obtain component B; (3) Component B was purified by semi-preparative HPLC using acetonitrile-0.1% phosphoric acid solution, and the eluate with a retention time of 23.7-28.5 min was collected, concentrated and dried to obtain the clover extract.

10. The preparation according to claim 9, characterized in that In step (3), the chromatographic column of the semi-preparative HPLC is an octadecylsilane bonded silica gel column, the column temperature is 30° C., the elution gradient is maintained at 5% acetonitrile from 0 to 12 min, increased to 15% acetonitrile from 12 to 40 min, and the flow rate is 5 mL / min.

Images