Application of circPLCE1 protein or coding gene thereof or circPLCE1 gene promoter region methylation site in diagnosis and prognosis evaluation of esophageal squamous cell carcinoma

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to application of circPLCE1 protein or a coding gene thereof or a circPLCE1 gene promoter region methylation site in esophageal squamous cell carcinoma diagnosis and prognosis evaluation. The methylation level of a circPLCE1 gene promoter region methylation site and the expression level of circPLCE1 protein or a coding gene thereof in esophageal squamous cell carcinoma and para-carcinoma normal tissues are detected, and the average methylation level of the circPLCE1 gene promoter region and the expression level of the circPLCE1 gene are found to be differentially expressed in the esophageal squamous cell carcinoma and the para-carcinoma normal tissues; and the circPLCE1 gene expression level is related to prognosis of a patient, so that the circPLCE1 gene has statistical significance. The circPLCE1 protein or the coding gene thereof or the circPLCE1 gene promoter region methylation site can be used for diagnosis, adjuvant therapy and prognosis evaluation of esophageal squamous cell carcinoma, and has strong specificity and high sensitivity.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and specifically relates to the application of circPLCE1 protein or its encoding gene or circPLCE1 gene promoter region methylation sites in the diagnosis and prognosis evaluation of esophageal squamous cell carcinoma. Background Art

[0002] Esophageal cancer (EC) is the sixth leading cause of death among cancers worldwide. Esophageal squamous cell carcinoma (ESCC), also known as esophageal squamous cell carcinoma, is the most common histological subtype of esophageal cancer. Although existing technologies have improved the diagnosis and treatment of esophageal cancer, the survival rate of patients with advanced esophageal squamous cell carcinoma is still very low due to early lymph node metastasis, and the 5-year survival rate of patients is still low. Etiological and epidemiological studies have shown that the occurrence of esophageal cancer is a disease caused by the combined effects of multiple factors. Therefore, it is particularly important to find the pathogenic factors and pathogenesis that lead to esophageal cancer. Existing technologies have found that in esophageal cancer, the promoter regions of the P16 and RASSF1A genes are both hypermethylated, and hypermethylation inhibits gene expression, thereby promoting the development of cancer.

[0003] circPLCE1 (hsa_circ_0019230, Circular RNA PLCE1) is generated by reverse splicing of exons 12 and 13 of the PLCE1 precursor RNA. Studies have shown that circPLCE1 accelerates colorectal cancer proliferation and migration (A novel NF-κB regulator encoded by circPLCE1 inhibits colorectal carcinoma progression by promoting RPS3ubiquitin-dependent degradation). The circPCLE1 / miR-485-5p / ACTG1 axis is considered a potential molecular target for the treatment of advanced colorectal cancer. However, the use of circPLCE1 in esophageal squamous cell carcinoma has not been reported. Summary of the Invention

[0004] The purpose of the present invention is to provide an application of circPLCE1 protein or its encoding gene or circPLCE1 gene promoter region methylation site in the diagnosis and prognosis evaluation of esophageal squamous cell carcinoma, with high specificity and sensitivity.

[0005] The present invention provides the use of a reagent for detecting a biomarker in one or more of the following:

[0006] (1) Prepare products for diagnosing esophageal squamous cell carcinoma;

[0007] (2) preparing products for the adjuvant treatment of esophageal squamous cell carcinoma;

[0008] (3) Prepare products for assessing the prognosis of esophageal squamous cell carcinoma;

[0009] The biomarkers include one or more of the circPLCE1 gene, circPLCE1 protein, and circPLCE1 gene promoter region methylation sites;

[0010] The methylation site in the circPLCE1 gene promoter region includes CpG_5; the CpG_5 is located at 234bp in the AKR1C2 gene promoter region.

[0011] Preferably, the methylation sites in the promoter region of the circPLCE1 gene further include one or more of CpG_1, CpG_2, CpG_3 and CpG_4;

[0012] The CpG_1 is located at 38 bp in the promoter region of the circPLCE1 gene;

[0013] The CpG_2 is located at 51 bp in the promoter region of the circPLCE1 gene;

[0014] The CpG_3 is located at 108 bp in the promoter region of the circPLCE1 gene;

[0015] The CpG_4 is located at 158bp in the promoter region of the circPLCE1 gene.

[0016] Preferably, the nucleotide sequence of the methylation region where the methylation site in the promoter region of the circPLCE1 gene is located is shown in SEQ ID NO: 1.

[0017] Preferably, the reagents for detecting biomarkers include one or more of amplification primers, probes, and antibodies; the amplification primers include upstream primers and downstream primers;

[0018] The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 2;

[0019] The downstream primer includes the nucleotide sequence shown in SEQ ID NO: 3.

[0020] Preferably, the product comprises one or more of a kit, a gene chip and a device containing a detection module.

[0021] Preferably, the kit comprises one or more of a gene detection kit, an immunohistochemistry detection kit and a DNA methylation detection kit.

[0022] Preferably, the prognosis assessment of esophageal squamous cell carcinoma includes prognosing the survival rate of the subject.

[0023] Preferably, the esophageal squamous cell carcinoma includes esophageal squamous cell carcinoma.

[0024] Preferably, the expression level of the circPLCE1 gene and / or circPLCE1 protein is significantly upregulated in patients with esophageal squamous cell carcinoma;

[0025] The expression level of the circPLCE1 gene and / or circPLCE1 protein is significantly upregulated in patients with esophageal squamous cell carcinoma with a poor overall survival rate;

[0026] The methylation level of the circPLCE1 gene promoter region methylation site is significantly downregulated in patients with esophageal squamous cell carcinoma.

[0027] The present invention also provides a kit for diagnosing, adjuvant treating and evaluating the prognosis of esophageal squamous cell carcinoma, comprising an upstream primer and a downstream primer;

[0028] The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 2;

[0029] The downstream primer includes the nucleotide sequence shown in SEQ ID NO: 3.

[0030] The present invention also provides a device for diagnosing, assisting in the treatment of esophageal squamous cell carcinoma and evaluating the prognosis of esophageal squamous cell carcinoma, comprising a detection module and an evaluation module;

[0031] The detection module is used to detect one or more of the following: circPLCE1 gene expression level, circPLCE1 protein expression level, and methylation level of circPLCE1 gene promoter region methylation site; the circPLCE1 gene promoter region methylation site includes CpG_5; the CpG_5 is located at 234bp in the AKR1C2 gene promoter region;

[0032] The evaluation module is used to determine whether the subject has esophageal squamous cell carcinoma or the prognosis of an esophageal squamous cell carcinoma patient based on one or more of the circPLCE1 gene expression level, the circPLCE1 protein expression level, and the methylation level of the circPLCE1 gene promoter region methylation site.

[0033] Beneficial effects:

[0034] The present invention provides the use of a reagent for detecting a biomarker in one or more of the following: (1) preparing a product for diagnosing esophageal squamous cell carcinoma; (2) preparing a product for adjuvant treatment of esophageal squamous cell carcinoma; (3) preparing a product for evaluating the prognosis of esophageal squamous cell carcinoma; the biomarker includes one or more of the circPLCE1 gene, the circPLCE1 protein and a methylation site in the promoter region of the circPLCE1 gene; the methylation site in the promoter region of the circPLCE1 gene includes CpG_5; and the CpG_5 is located at 234 bp in the promoter region of the AKR1C2 gene. The present invention detects the expression levels of methylation sites in the promoter region of the circPLCE1 gene in esophageal squamous cell carcinoma tissues and adjacent normal tissues, and performs statistical analysis. The results show that there are significant differences in the methylation levels of CpG_5 in the methylation sites in the promoter region of the circPLCE1 gene between esophageal squamous cell carcinoma tissues and adjacent normal tissues. The methylation levels of the methylation sites in the promoter region of the circPLCE1 gene are significantly downregulated in esophageal squamous cell carcinoma patients; the expression levels of the circPLCE1 gene and / or circPLCE1 protein are significantly downregulated in esophageal squamous cell carcinoma patients. The present invention uses in situ hybridization to detect the expression of circPLCE1 in esophageal squamous cell carcinoma tissues and adjacent normal tissues. The in situ hybridization scores of circPLCE1 protein in esophageal squamous cell carcinoma tissues and adjacent normal tissues are statistically analyzed, and it is found that the expression of circPLCE1 protein or its encoding gene in esophageal squamous cell carcinoma is significantly higher than that in adjacent normal tissues. In addition, patients with high expression of circPLCE1 protein or its encoding gene have a lower overall survival rate. Any of the methylation sites in the circPLCE1 gene promoter region, the circPLCE1 protein, or its encoding gene can be used as detection targets for diagnosis and adjuvant treatment of esophageal squamous cell carcinoma, and for evaluating the prognosis of patients with esophageal squamous cell carcinoma with high specificity and sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0036] Figure 1 Schematic diagram of the CpG sites in the primer amplification sequence of the circPLCE1 gene promoter region in Example 1;

[0037] Figure 2 This is the electrophoresis diagram of the PCR amplification product of the circPLCE1 gene in Example 1;

[0038] Figure 3 This is a schematic diagram of the principle of methylation detection by MALDI-TOF MS in Example 1;

[0039] Figure 4This is a comparison of the methylation levels of CpG_5 differential sites in the promoter region of the circPLCE1 gene in esophageal squamous cell carcinoma and adjacent normal tissues in Example 1; where * indicates P < 0.05;

[0040] Figure 5 The sensitivity and specificity of the CpG_5 methylation status of the circPLCE1 gene promoter region in diagnosing esophageal squamous cell carcinoma in Example 1;

[0041] Figure 6 The methylation status of CpG units in the promoter region of circPLCE1 gene in esophageal squamous cell carcinoma tissue and the prognosis of patients in Example 1;

[0042] Figure 7 In situ hybridization staining of circPLCE1 in esophageal squamous cell carcinoma tissue and adjacent normal tissue in Example 2;

[0043] Figure 8 This is the differential expression analysis of circPLCE1 in esophageal squamous cell carcinoma tissue and adjacent normal tissue in Example 2; *** indicates P < 0.0005;

[0044] Figure 9 Example 2 shows the relationship between circPLCE1 in esophageal squamous cell carcinoma tissue and adjacent normal tissue and patient prognosis;

[0045] Figure 10 This is Example 2: The sensitivity and specificity of circPLCE1 in esophageal squamous cell carcinoma tissue and adjacent normal tissue for diagnosing esophageal squamous cell carcinoma. DETAILED DESCRIPTION

[0046] The present invention provides the use of a reagent for detecting a biomarker in one or more of the following:

[0047] (1) Prepare products for diagnosing esophageal squamous cell carcinoma;

[0048] (2) preparing products for the adjuvant treatment of esophageal squamous cell carcinoma;

[0049] (3) Prepare products for assessing the prognosis of esophageal squamous cell carcinoma;

[0050] The biomarkers include one or more of the circPLCE1 gene, circPLCE1 protein, and circPLCE1 gene promoter region methylation sites;

[0051] The methylation site in the circPLCE1 gene promoter region includes CpG_5; the CpG_5 is located at 234bp in the AKR1C2 gene promoter region.

[0052] As an embodiment, the methylation site in the circPLCE1 gene promoter region of the present invention also includes one or more of CpG_1, CpG_2, CpG_3 and CpG_4; the CpG_1 is located at 38bp of the circPLCE1 gene promoter region; the CpG_2 is located at 51bp of the circPLCE1 gene promoter region; the CpG_3 is located at 108bp of the circPLCE1 gene promoter region; and the CpG_4 is located at 158bp of the circPLCE1 gene promoter region.

[0053] As an embodiment, the nucleotide sequence of the methylation region where the methylation site in the promoter region of the circPLCE1 gene of the present invention is located is shown in SEQ ID NO: 1, specifically: 5'-ggttttttgcaatgccctgactctggatCGcagccctccctCGattctgggtattacatcatttcatttcagctaatgtaaacactcatcaccctgcaCGttgcaggatttttcactgtgatttgagattgggcttcattcagtgggtCGtggtgattaatggtttcagaaggaagtgcagcaggaagagactttgcaggaatggaagaggtgaggcagctccaCGtgagattctgcaaagggattaagatttggcaccaggcttggt ttctgtgcagcctcttaggcagagagccccaggagagggaagcaggctg-3'; the methylated region of the present invention is located at 4912bp to 5227bp upstream of the transcription start point of the circPLCE1 gene (hsa_circ_0019230). The methylated region is transcribed into an RNA fragment, which is cleaved by RNase A to obtain five CpG units, specifically including CpG_1, CpG_2, CpG_3, CpG_4, and CpG_5, wherein CpG_5 is the fifth methylation site appearing in the 5'-3' direction of the sequence shown in SEQ ID NO:1.

[0054] The present invention found, through the Mann-Whitney U test, that the average methylation levels of the five CpG units in esophageal squamous cell carcinoma tissues were significantly lower than those in adjacent normal tissues. In particular, there was a significant difference in the methylation levels of the single CpG unit CpG_5 between esophageal squamous cell carcinoma tissues and adjacent normal tissues. The methylation levels of the methylation sites in the circPLCE1 gene promoter region were significantly downregulated in esophageal squamous cell carcinoma patients. Kaplan-Meier survival analysis revealed that esophageal squamous cell carcinoma patients with low methylation expression of the CpG_5 site had a lower overall survival rate, but the difference was not statistically significant. Therefore, the methylation sites in the circPLCE1 gene promoter region can be used as detection targets for the diagnosis and / or adjuvant treatment of esophageal squamous cell carcinoma, and in particular, the methylation frequency of the CpG_5 site in the circPLCE1 gene promoter region can be used as a biomarker for the diagnosis and / or adjuvant treatment of esophageal squamous cell carcinoma.

[0055] The present study used in situ hybridization to detect the expression of circPLCE1 in esophageal squamous cell carcinoma (ESCC) tissues and adjacent normal tissues. Statistical analysis of the in situ hybridization scores for circPLCE1 protein in these tissues revealed that the expression of circPLCE1 protein or its encoding gene in ESCC tissues was significantly higher than that in adjacent normal tissues, with statistically significant differences. The expression level of circPLCE1 protein or its encoding gene was significantly upregulated in ESCC patients. Kaplan-Meier survival analysis was used to compare the relationship between circPLCE1 protein or its encoding gene expression in ESCC and patient prognosis. The results showed that patients with high circPLCE1 protein or its encoding gene expression had a lower overall survival rate (P < 0.05). Receiver operating characteristic (ROC) analysis showed that the sensitivity and specificity of circPLCE1 protein or its encoding gene for the diagnosis of ESCC were 85.5% and 86.3%, respectively, with an AUC of 0.898. Therefore, circPLCE1 protein or its encoding gene can be used as a detection target for diagnosis, adjuvant treatment, and prognosis assessment of ESCC patients with high specificity and sensitivity.

[0056] In one embodiment, the biomarker detection reagents of the present invention include one or more of amplification primers, probes, and antibodies; the amplification primers include an upstream primer and a downstream primer; the upstream primer includes the nucleotide sequence shown in SEQ ID NO: 2; the downstream primer includes the nucleotide sequence shown in SEQ ID NO: 3. In one embodiment, the probe of the present invention includes the nucleotide sequence shown in SEQ ID NO: 4.

[0057] In one embodiment, the product of the present invention comprises one or more of a kit, a gene chip, and a device containing a detection module. In another embodiment, the kit of the present invention comprises one or more of a gene detection kit, an immunohistochemistry detection kit, and a DNA methylation detection kit. The present invention does not particularly limit the composition of the kit; any reagent capable of detecting circPLCE1 genes, circPLCE1 proteins, and methylation sites in the circPLCE1 gene promoter region may be used as a component of the kit.

[0058] As an embodiment, the prognosis assessment of esophageal squamous cell carcinoma of the present invention includes prognosticating the survival rate of the subject.

[0059] The present invention also provides a kit for diagnosing, assisting in the treatment of esophageal squamous cell carcinoma and evaluating the prognosis of esophageal squamous cell carcinoma, comprising an upstream primer and a downstream primer; the upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 2; the downstream primer comprises the nucleotide sequence shown in SEQ ID NO: 3.

[0060] As an embodiment, the kit of the present invention further comprises PCR amplification reagents. As an embodiment, the PCR amplification reagents of the present invention include, but are not limited to, dNTPs, PCR buffer, and Tap polymerase. In the specific implementation process, other reagents can be conventionally selected according to actual needs.

[0061] The present invention also provides a device for diagnosing, assisting in the treatment of esophageal squamous cell carcinoma and evaluating the prognosis of esophageal squamous cell carcinoma, comprising a detection module and an evaluation module;

[0062] The detection module is used to detect one or more of the circPLCE1 gene expression level, the circPLCE1 protein expression level and the methylation level of the circPLCE1 gene promoter region methylation site; the circPLCE1 gene promoter region methylation site includes CpG_5; the CpG_5 is located at 234bp in the AKR1C2 gene promoter region.

[0063] The evaluation module is used to determine whether the subject has esophageal squamous cell carcinoma or the prognosis of an esophageal squamous cell carcinoma patient based on one or more of the circPLCE1 gene expression level, the circPLCE1 protein expression level, and the methylation level of the circPLCE1 gene promoter region methylation site.

[0064] To further illustrate the present invention, the application of the circPLCE1 protein or its encoding gene or the circPLCE1 gene promoter region methylation site provided by the present invention in the diagnosis and prognosis assessment of esophageal squamous cell carcinoma is described in detail below with reference to the accompanying drawings and examples. However, these should not be construed as limiting the scope of protection of the present invention.

[0065] The reagents used in the examples of the present invention are shown in Table 1, the main experimental instruments and consumables are shown in Table 2, and the prepared reagents used are shown in Table 3.

[0066] Table 1 Reagents

[0067]

[0068]

[0069] Table 2 Experimental instruments and consumables

[0070] name company Origin optical microscope Olympus Japan 4℃ refrigerator Haier China -20℃ Refrigerator Haier China constant temperature box Beijing Yongguangming Medical Instrument Factory China Electric blast drying oven Beijing Yongguangming Medical Instrument Factory China Micropipette Eppendorf Germany Micro-wave oven Midea China 1.5mL EP tube Axygen USA Tip Axygen USA slides Jiangsu Shitai Experimental Equipment Co., Ltd. China Cover glass Jiangsu Shitai Experimental Equipment Co., Ltd. China Wet box Haimen Kangtai Experimental Equipment Factory China Staining rack Haimen Kangtai Experimental Equipment Factory China

[0071] Table 3 Reagent preparation

[0072]

[0073] Example 1

[0074] Methylation of circPLCE1 gene in esophageal squamous cell carcinoma tissues

[0075] 1. Sample Collection

[0076] Tumor tissues from 42 patients with esophageal squamous cell carcinoma and their corresponding 42 adjacent normal tissues were collected. The samples were fixed in formalin and embedded in paraffin. The adjacent normal tissues were selected from the area more than 2 cm away from the esophageal squamous cell carcinoma tissues.

[0077] 2. DNA Preparation

[0078] The QIAamp DNA FFPE Tissue Kit was used to extract genomic DNA. The content and purity of the DNA were determined by measuring the absorbance with an ultraviolet spectrophotometer. The quality of the extracted DNA was ensured by gel electrophoresis.

[0079] 3. Bisulfite treatment

[0080] The extracted DNA was modified with bisulfite using the EZ-96 DNA Methylation-Gold™ Kit. The modified DNA was used immediately or stored at -20°C for later use.

[0081] 4. PCR amplification reaction

[0082] (1) Design upstream and downstream primers for the amplified fragment of the circPLCE1 gene promoter region, and perform PCR amplification using the modified DNA from step 3 as a template; the schematic diagram of the CpG site of the amplified fragment of the circPLCE1 gene promoter region is shown in the figure below. Figure 1 As shown, Figure 1The sequence is a reverse sequence, and CpG sites are represented by dots; dark marks are detectable CpG sites, and light marks are undetectable CpG sites;

[0083] Upstream primer: 5′-aggaagagagGGTTTTTGTAATGTTTTGATTTTGG-3′ (SEQ ID NO: 2);

[0084] Downstream primer: 3′-TCAAAATCCTCTCCCTTCATCCAACtcggaagagggatatcactcagcataatgac-5′ (SEQ ID NO: 3);

[0085] PCR amplification system: 1.0 μL 10× PCR Buffer, 1.0 μL dNTPs (final concentration of each dNTP is 200 μM), 0.2 μL PCR polymerase (5 U / μL), 0.2 μL 10 pmol / μL upstream primer, 0.2 μL 10 pmol / μL downstream primer, 1.0 μL template, and 6.4 μL ddH2O. The reaction system preparation process was completed on ice to prevent inactivation due to prolonged exposure to high temperature.

[0086] PCR amplification program: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 20 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, 45 cycles; extension at 72°C for 5 min; storage at 4°C.

[0087] (2) Take 3 μL of PCR product and mix it with 1 μL of 6× loading buffer. Then, perform electrophoresis on 1.5% agarose gel at 160V for 20 min and observe the results. Figure 2 As shown. Figure 2 It can be concluded that the results are good and subsequent experiments can be continued.

[0088] 5. Treatment of PCR amplification products with shrimp alkaline phosphatase (SAP):

[0089] (1) Add 7 μL of SAP reaction solution to each well of a 384-well reaction plate, carefully cover with a 384-well sealing film, and press each well firmly to prevent evaporation during the PCR process; the SAP reaction solution includes 1.70 μL of ddH2O, 0.30 μL of Shrimpalkaline phosphotase (SAP) Enzyme, and 5.00 μL of PCR amplification product;

[0090] (2) After mixing, centrifuge at 3000×g for 1 min. After centrifugation, proceed with the following procedures according to the following reaction conditions: incubate at 37°C for 20 min, incubate at 85°C for 5 min, and store at 4°C.

[0091] 6. T-cut / RNase A digestion reaction

[0092] (1) T transcription / RNase A mixture: 0.89 μL 5× T7 Polymerase Buffer, 0.22 μL TCleavage mix, 0.22 μL 100 μmol / L DTT, 0.40 μL T7 RNA & DNA polymerase, 0.06 μL RNase A (final concentration 0.09 mg / mL), 2.0 μL shrimp alkaline phosphatase-treated PCR amplification product obtained in step 5, and 3.21 μL ddH2O;

[0093] (2) Transfer 2 μL of PCR product and 5 μL of T transcription / RNase A mixture to a new 384-well plate;

[0094] (3) Cover with sealing film and centrifuge the microplate at 3000 g for 1 min;

[0095] (4) Incubate at 37°C for 3 h in a PCR instrument and store at 4°C.

[0096] (5) MALDI-TOF MS method was used for methylation mass spectrometry detection. The specific detection principle is as follows: Figure 3 The results showed that the circPLCE1 gene promoter contained 5 CpG sites. The total number of CpG units analyzed in the 73 samples studied in this example was 365.

[0097] 7. SPSS 26.0 software was used to perform the Mann-Whitney U test on the methylation level of the circPLCE1 gene in esophageal squamous cell carcinoma and adjacent normal tissues. The methylation differences of the five CpG units of the circPLCE1 gene were compared between the two groups of samples, and the CpG units with differential methylation were screened. The results showed that the methylation distribution of one CpG unit (CpG_5) of the circPLCE1 gene was different between the two groups (P < 0.05), as shown in Table 4 and Figure 4 .

[0098] Table 4 Comparison of methylation rates of CpG sites of circPLCE1 in esophageal squamous cell carcinoma and adjacent normal tissues

[0099] CpG Unit Normal (N=42) ESCC (N=42) Z P CpG_1 0.092±0.304 0.115±0.339 -1.380 0.383 CpG_2 0.088±0.296 0.097±0.312 -0.592 0.554 CpG_3 0.013±0.114 0.032±0.179 -0.155 0.877 CpG_4 0.07±0.0604 0.005±0.00341 -1.202 0.229 CpG_5 0.089±0.299 0.032±0.18 -2.048 <![CDATA[0.041 * ]]>

[0100] Note: ESCC denotes esophageal squamous cell carcinoma; Normal denotes adjacent normal tissue. * indicates P < 0.05. Values are medians.

[0101] Receiver operating characteristic (ROC) curve analysis was performed on the methylation levels of each CpG site and the calculated area under the curve (AUC). The results showed that the AUC value of circPLCE1 CpG_5 was 0.694 (P = 0.043), with a sensitivity and specificity of 52.6% and 88.9%, respectively, which were statistically significant ( Figure 5 ).

[0102] Kaplan-Meier survival analysis compared the relationship between the methylation level of circPLCE1 CpG_5 in the samples and the diagnosis and prognosis of the patients. Figure 6 As shown. Figure 6 It can be seen that there is no statistically significant relationship between the methylation level of circPLCE1 CpG_5 and the patient's diagnosis and prognosis.

[0103] Example 2

[0104] Expression of circPLCE1 in esophageal squamous cell carcinoma tissues and adjacent normal tissues.

[0105] 1. Sample Collection

[0106] A total of 207 esophageal squamous cell carcinoma tissues and 192 adjacent normal tissues were collected. The samples were fixed in formalin and embedded in paraffin to obtain tissue microarray wax blocks. The adjacent normal tissues were selected from the area more than 2 cm away from the esophageal squamous cell carcinoma tissues.

[0107] 2. Take the prepared tissue microarray wax block and perform 4 μm serial sectioning. Use in situ hybridization to detect the expression of circPLCE1 in the sample. The specific steps are as follows:

[0108] (1) Place the prepared 4 μm white slides into a slide box and store them in a 4°C refrigerator for subsequent experiments.

[0109] (2) Before the experiment, the white slices of the tissue chip stored in the 4°C refrigerator were placed in a metal basket and baked in a 60°C oven for 1.5 to 2 hours to prevent the tissue from falling off;

[0110] (3) Place the paraffin tissue sections baked in a 60°C oven in a xylene I solution, a xylene II solution, and a xylene III solution tank in sequence to perform tissue dewaxing. After dewaxing, place the sections in an absolute ethanol solution, a 90% by volume ethanol solution, an 80% by volume ethanol solution, and a 70% by volume ethanol solution in sequence to wash off the xylene on the paraffin tissue white sections. The sections are immersed in each solution tank for 5 minutes. Rinse with tap water three times and place in tap water to prevent drying.

[0111] (4) Prepare 3 mL of 30% H2O2 solution and place the slices in it to block the endogenous peroxidase activity. Incubate at room temperature in the dark for 10 min and rinse with clean water three times.

[0112] (5) Place the slices in a washing tank filled with PBS and wash them on a horizontal shaker three times for 5 minutes each time, replacing the PBS solution each time.

[0113] (6) Expose nucleic acid fragments: Add freshly diluted pepsin with 3% citric acid (add 2 drops of concentrated pepsin to 1 mL of 3% citric acid and mix well) and digest at 37°C for 30 min (adjust according to the age and thickness of the specimen). Wash the in situ hybridization sample three times with PBS for 5 min each, and then wash once with distilled water.

[0114] (7) Post-fixation: After pepsin digestion, fix with 4% paraformaldehyde containing 1 / 1000 DEPC at room temperature for 5 min. Wash three times with distilled water.

[0115] (8) Prehybridization: Add 20 mL of 20% glycerol to the bottom of a dry hybridization box to maintain humidity. Add 200 μL of prehybridization solution to each section and incubate in a 42°C incubator for 4 hours. Aspirate excess liquid without washing.

[0116] (9) Hybridization: 20 μL of circPLCE1 oligonucleotide probe hybridization solution was added to each slice; the circPLCE1 oligonucleotide probe was a mixture of circPLCE1 oligonucleotide probe 1, circPLCE1 oligonucleotide probe 2, and circPLCE1 oligonucleotide probe 3, with the following sequences: circPLCE1 oligonucleotide probe 1: 5'-CCAAGCACTAGGTCAGGCTGAAGAT-3' (SEQ ID NO: 4); circPLCE1 oligonucleotide probe 2: 5'-TACTGCTCCAAGCACTAGGTCAGGC-3' (SEQ ID NO: 5); circPLCE1 oligonucleotide probe 3: 5'-TACTACTGCTCCAAGCACTAGCTCA-3' (SEQ ID NO: 6).

[0117] Remove the protective film from the in situ hybridization cover glass and place it on the slice. Hybridize overnight in a constant temperature box at 42°C (this can be adjusted according to the hybridization situation).

[0118] (10) Post-hybridization washing: Remove the coverslip and wash twice at 37°C with 2× SSC for 5 min each; wash at 37°C with 0.5× SSC for 15 min; and wash at 37°C with 0.2× SSC for 15 min. If there is nonspecific staining, repeat the 37°C with 0.2× SSC for 15 min step 1–2 times.

[0119] (11) Add blocking solution dropwise and incubate at 37°C for 30 min. Remove excess liquid without washing.

[0120] (12) Add biotinylated mouse anti-digoxigenin and incubate at 37°C for 60 minutes or at room temperature for 120 minutes. Wash the in situ hybridization plate four times with PBS, each time for 5 minutes. Do not use other buffers or distilled water for washing.

[0121] (13) Add SABC and incubate at 37°C for 20 minutes or at room temperature for 30 minutes. Wash the in situ hybridization three times with PBS, each time for 5 minutes. Do not use other buffers or distilled water for washing.

[0122] (14) Add biotinylated peroxidase dropwise and incubate at 37°C for 20 min or at room temperature for 30 min. Wash in situ hybridization four times with PBS, each time for 5 min.

[0123] (15) Dry the slices and place them on a wet box. Wipe off excess PBS liquid. Add about 100 μL of DAB colorimetric reagent to each slice and observe the tissue coloring intensity and coloring location under a microscope. Control the coloring time based on the coloring intensity.

[0124] (16) After reaching the optimal color development effect, place it in room temperature water to terminate the color development and record the color development time;

[0125] (17) After all sections have developed color, the sections are placed in hematoxylin solution for counterstaining for 30 seconds, acidified in acid alcohol for 3–5 seconds, rinsed five times, and then blued in tap water for 5 minutes;

[0126] (18) Place the white slices in 70% ethanol solution, 80% ethanol solution, 90% ethanol solution, and anhydrous ethanol for 5 minutes (the purpose of this step is to dewax. If you want to dewax better, you can extend it to 10 minutes). Then put them in xylene I, xylene II, and xylene III in turn. Place the slices in each solution for 5 minutes (the purpose of this step is to remove alcohol) and dehydrate the slices until they are transparent.

[0127] (19) After the slices were dried, they were sealed with a neutral gum coverslip and observed under an Olympus optical microscope. Figure 7 Figures A (40×) and B (200×) show circPLCE1 staining in esophageal squamous cell carcinoma tissue, while images C (40×) and D (200×) show circPLCE1 staining in adjacent normal tissues. CircPLCE1 protein is primarily expressed in the cytoplasm of esophageal squamous cell carcinoma cells.

[0128] (20) Under an Olympus optical microscope with a magnification of 200 times, a double-scoring semi-quantitative method was used for scoring: <5% cells were positive for 0 points; 6% to 25% cells were positive for 1 point; 26% to 50% cells were positive for 2 points; 51% to 75% cells were positive for 3 points; >75% cells were positive for 4 points. The staining intensity was scored according to the presence and depth of cell coloration: no cell coloration for 0 points; light yellow for 1 point; brownish yellow for 2 points; and brownish brown for 3 points. Then, the percentage of positive cells and the staining intensity were multiplied and graded. When the score was 0 to 1, it was graded as (-); 2 to 4 points were (+); 5 to 8 points were (++); 9 to 12 points were (+++). Among them, - is negative; + is weakly positive; ++ / +++ is strongly positive. The range is 0 to 12. The results are as follows. Figure 8 As shown in the results, the expression of circPLCE1 in esophageal squamous cell carcinoma was significantly higher than that in adjacent normal tissues, and the difference was statistically significant.

[0129] (20) ROC curve and Kaplan-Meier survival analysis were used to compare the relationship between circPLCE1 expression in samples and patient diagnosis and prognosis. The results are as follows: Figures 9-10 shown.

[0130] The results of chromogenic in situ hybridization were scored using a double-scoring semi-quantitative method, with ≥4 indicating high expression and <4 indicating low expression. Figure 9 It can be seen that patients with high expression of circPLCE1 have a slightly worse prognosis, and the difference is statistically significant. Figure 10 It can be seen that the sensitivity and specificity of circPLCE1 for diagnosing esophageal squamous cell carcinoma are 85.5% and 86.5%, and the AUC value is 0.898, indicating a good diagnostic effect.

[0131] Based on the above results, it can be seen that one or more of the circPLCE1 gene, circPLCE1 protein, and circPLCE1 gene promoter region methylation sites can be used for the diagnosis and adjuvant treatment of esophageal squamous cell carcinoma, and prognosis evaluation of esophageal squamous cell carcinoma with high specificity and sensitivity.

[0132] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Use of reagents for detecting biomarkers in one or more of the following: (1) Prepare products for diagnosing esophageal squamous cell carcinoma; (2) preparing products for the adjuvant treatment of esophageal squamous cell carcinoma; (3) Prepare products for assessing the prognosis of esophageal squamous cell carcinoma; The biomarkers include one or more of the circPLCE1 gene, circPLCE1 protein, and circPLCE1 gene promoter region methylation sites; The methylation site in the circPLCE1 gene promoter region includes CpG_5; the CpG_5 is located at 234bp in the AKR1C2 gene promoter region.

2. The use according to claim 1, characterized in that The circPLCE1 gene promoter region methylation site also includes one or more of CpG_1, CpG_2, CpG_3 and CpG_4; The CpG_1 is located at 38 bp in the promoter region of the circPLCE1 gene; The CpG_2 is located at 51 bp in the promoter region of the circPLCE1 gene; The CpG_3 is located at 108 bp in the promoter region of the circPLCE1 gene; The CpG_4 is located at 158bp in the promoter region of the circPLCE1 gene.

3. The use according to claim 1, characterized in that The nucleotide sequence of the methylation region where the methylation site in the promoter region of the circPLCE1 gene is located is shown in SEQ ID NO: 1; the CpG_5 is the fifth methylation site in the nucleotide sequence shown in SEQ ID NO:

1.

4. The use according to claim 1, characterized in that The reagents for detecting biomarkers include one or more of amplification primers, probes, and antibodies; the amplification primers include upstream primers and downstream primers; The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 2; The downstream primer includes the nucleotide sequence shown in SEQ ID NO:

3.

5. The use according to claim 1, characterized in that The product includes one or more of a kit, a gene chip, and a device containing a detection module.

6. The use according to claim 4, characterized in that The kit includes one or more of a gene detection kit, an immunohistochemistry detection kit and a DNA methylation detection kit.

7. The use according to claim 1, characterized in that The prognosis assessment of esophageal squamous cell carcinoma includes prognosing the survival rate of the subject.

8. The use according to any one of claims 1 to 7, characterized in that: The expression level of the circPLCE1 gene and / or circPLCE1 protein is significantly upregulated in patients with esophageal squamous cell carcinoma; The expression level of the circPLCE1 gene and / or circPLCE1 protein is significantly upregulated in patients with esophageal squamous cell carcinoma with a poor overall survival rate; The methylation level of the circPLCE1 gene promoter region methylation site is significantly downregulated in patients with esophageal squamous cell carcinoma.

9. A kit for diagnosing, adjuvant treating and evaluating the prognosis of esophageal squamous cell carcinoma, characterized in that: Includes upstream primers and downstream primers; The upstream primer comprises the nucleotide sequence shown in SEQ ID NO: 2; The downstream primer includes the nucleotide sequence shown in SEQ ID NO:

3.

10. A device for diagnosing, assisting in the treatment of, and assessing the prognosis of esophageal squamous cell carcinoma, characterized in that: Includes detection module and evaluation module; The detection module is used to detect one or more of the following: circPLCE1 gene expression level, circPLCE1 protein expression level, and methylation level of circPLCE1 gene promoter region methylation site; the circPLCE1 gene promoter region methylation site includes CpG_5; the CpG_5 is located at 234bp in the AKR1C2 gene promoter region; The evaluation module is used to determine whether the subject has esophageal squamous cell carcinoma or the prognosis of an esophageal squamous cell carcinoma patient based on one or more of the circPLCE1 gene expression level, the circPLCE1 protein expression level, and the methylation level of the circPLCE1 gene promoter region methylation site.

Images