Transgenic maize event LP1141-1 and detection method thereof

By designing specific nucleic acid sequences for primers and probes, the problem of rapid and accurate detection of genetically modified corn event LP1141-1 is solved, simplifying the breeding process, reducing costs and ensuring regulatory compliance, and maintaining corn yield and herbicide tolerance.

CN120464784AActive Publication Date: 2025-08-12LONGPING BIOTECHNOLOGY (HAINAN) CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510976012.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-16
Publication Date
2025-08-12
Estimated Expiration
2045-07-16

AI Technical Summary

Technical Problem

The prior art is difficult to quickly and accurately detect the existence of the genetically modified corn event LP1141-1, and traditional methods cannot distinguish between different transformation events, which increases the cost of breeding and compliance with regulations.

Method used

Specific nucleic acid sequences (SEQ ID NO: 1-7 or their complementary sequences) are provided for designing primers and probes to ensure that the amplification product specifically recognizes the presence of transgenic corn event LP1141-1 by PCR and DNA hybridization methods.

Benefits of technology

The rapid and accurate identification of the presence of GM corn event LP1141-1 is achieved, simplifying the breeding process, reducing costs, and ensuring regulatory compliance, maintaining corn yield and herbicide tolerance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120464784A_ABST
    Figure CN120464784A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a transgenic maize event LP1141-1 and a detection method thereof. The invention provides a nucleic acid sequence for detecting a transgenic maize event LP1141-1, the nucleic acid sequence is selected from one or more of sequences SEQ ID NO: 1-7 or complementary sequences thereof, and the nucleic acid sequence is derived from the transgenic maize event LP1141-1. A representative sample of a seed of the transgenic maize event LP1141-2 is preserved in the China Center for Type Culture Collection on April 13, 2025, and the preservation number is CCTCC NO: P202511. The transgenic maize event LP1141-1 has the three characters of obtaining red maintainer line seeds, breeding sterile line materials and glufosinate-resistant herbicides, the screening mode is simplified through the event, and the labor cost is saved; the corn yield is not influenced; molecular markers can be used to track transgenic insertion elements of breeding populations and progeny thereof. The detection method provided by the invention can be used for rapidly, accurately and stably identifying the existence of the plant material derived from the transgenic maize event LP1141-1.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology technology and relates to a method for detecting transgenic plants and their products, and in particular to a transgenic corn event LP1141-1 that is bred for male sterile corn and tolerates the application of glufosinate herbicide, and a nucleic acid sequence and method for detecting the transgenic corn LP1141-1. Background Art

[0002] corn( Zea mays L.) is a staple food crop in many parts of the world. By fully leveraging heterosis, corn yields have been significantly increased. Hybridization is an important means of improving agronomic traits in corn production. Male sterility is a common phenomenon in the plant kingdom. It refers to the inability of stamens to grow and produce effective pollen during sexual reproduction, while pistils can develop and fertilize normally. In hybrid breeding, controlled pollination using male sterile lines can produce high-yield hybrids. Most corn hybrids used in production are produced by artificially detasseling the female parent and then crossing it with the male parent. However, manual detasseling consumes significant manpower, material, and financial resources, increasing breeding costs and reducing seed production income. Corn hybrid seed production requires the use of specific parental lines for hybridization to produce high-yield corn hybrids. However, the availability of male sterile lines in production is limited and often fails to meet seed production needs. Therefore, the development of multi-controlled maize sterility technology and universal dominant male sterility technology, developed through biotechnology combined with genetic engineering and molecular design breeding, offers new possibilities for addressing the maintenance and propagation of recessive nuclear male sterile lines in corn.

[0003] Another important agronomic trait is herbicide tolerance, especially tolerance to glufosinate herbicide. Tolerance of corn to glufosinate herbicide can be achieved by genetically modifying the glufosinate herbicide tolerance gene (e.g. pat ) was expressed in corn plants.

[0004] In addition to the functional gene itself, the selection and sequencing of regulatory elements are crucial for achieving a successful transformation event, and their technical effectiveness can be unpredictable. Furthermore, the expression of exogenous genes in plants is influenced by their insertion site into the maize chromosome, potentially due to chromatin structure (e.g., heterochromatin) or the proximity of transcriptional regulatory elements (e.g., enhancers) to the integration site. Therefore, screening a large number of events is often required to identify those suitable for commercialization (i.e., those in which the introduced target gene is optimally expressed). For example, it has been observed in plants and other organisms that the expression level of the introduced gene can vary significantly between events; spatial or temporal expression patterns can also vary, such as the relative expression of the transgene varies between different plant tissues. This variability manifests itself in actual expression patterns that may be inconsistent with the expression pattern expected from the transcriptional regulatory elements in the introduced gene construct. Consequently, it is often necessary to generate hundreds or even thousands of different events and screen them for a single event that exhibits the desired transgene expression level and pattern for commercialization. Such transformation events have excellent agronomic traits, extremely low to zero pollen leakage rate and resistance to glufosinate herbicide without affecting corn yield, and can be used to breed male sterile corn or maintainer lines through hybridization using conventional breeding methods.

[0005] The offspring produced by this hybridization method retain the characteristics and traits of the original male sterile line. Applying this strategy can ensure that the sterile lines of many varieties are stable and resistant to glufosinate herbicide, while being well adapted to local growing conditions.

[0006] It would be beneficial to be able to detect the presence of specific events to determine whether the offspring of sexual crosses maintain male sterility. Furthermore, methods for detecting specific events would also facilitate compliance with regulations, such as the need for formal approval and labeling of foods derived from recombinant crops before they can be marketed. Detection of the presence of transgenes is possible using any well-known polynucleotide detection method, such as polymerase chain reaction (PCR) or Southern hybridization using polynucleotide probes. These detection methods typically focus on common genetic elements, such as promoters, terminators, and marker genes. Therefore, unless the sequence of the chromosomal DNA adjacent to the inserted transgenic DNA ("flanking DNA") is known, these methods cannot be used to distinguish between different events, particularly those generated using the same DNA construct. Therefore, currently, identification of specific transgenic events is often performed by PCR using a pair of primers spanning the junction of the inserted T-DNA and the flanking DNA: specifically, a first primer containing the flanking sequence and a second primer containing the inserted sequence. Summary of the Invention

[0007] The purpose of the present invention is to provide a transgenic corn event LP1141-1 and a detection method thereof, which can accurately and quickly identify whether a biological sample contains a specific transgenic corn event LP1141-1 DNA molecule.

[0008] To achieve the above objectives, the present invention provides a nucleic acid sequence for detecting transgenic maize event LP1141-1, comprising one or more sequences selected from SEQ ID NO: 1-7 (i.e., SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7) or their complementary sequences. In some embodiments, the nucleic acid sequence is derived from transgenic maize event LP1141-1, and a representative sample of seeds comprising the event was deposited with the China Center for Type Culture Collection (CCTCC, address: Wuhan University, 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, China, Wuhan University Collection Center, zip code 430072) on April 13, 2025, and is classified as maize seed LP1141-1 Zea mays L. LP1141-1. In some embodiments, the nucleic acid sequence is an amplicon that diagnoses the presence of transgenic maize event LP1141-1.

[0009] In some embodiments of the present invention, the present invention provides a nucleic acid sequence comprising at least 11 consecutive nucleotides of the sequence SEQ ID NO:3 or its complementary sequence and / or at least 11 consecutive nucleotides of the sequence SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises the sequence SEQ ID NO:1 or its complementary sequence and / or the sequence SEQ ID NO:2 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises the sequence SEQ ID NO:3 or its complementary sequence and / or the sequence SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises the sequence SEQ ID NO:5 or its complementary sequence.

[0010] The sequence SEQ ID NO: 1 or its complementary sequence is a 20-nucleotide sequence located near the insertion junction at the 5' end of the insertion sequence in the transgenic maize event LP1141-1. The sequence SEQ ID NO: 1 or its complementary sequence spans the flanking genomic DNA sequence of the maize insertion site and the DNA sequence at the 5' end of the insertion sequence. The presence of the transgenic maize event LP1141-1 can be identified by including the sequence SEQ ID NO: 1 or its complementary sequence. The sequence SEQ ID NO: 2 or its complementary sequence is a 20-nucleotide sequence located near the insertion junction at the 3' end of the insertion sequence in the transgenic maize event LP1141-1. The sequence SEQ ID NO: 2 or its complementary sequence spans the DNA sequence at the 3' end of the insertion sequence and the flanking genomic DNA sequence of the maize insertion site. The presence of the transgenic maize event LP1141-1 can be identified by including the sequence SEQ ID NO: 2 or its complementary sequence.

[0011] The nucleic acid sequence provided herein can be at least 11 or more contiguous polynucleotides of any portion of the transgenic insertion sequence of the sequence SEQ ID NO: 3 or its complement (first nucleic acid sequence), or at least 11 or more contiguous polynucleotides of any portion of the 5' flanking maize genomic DNA region of the sequence SEQ ID NO: 3 or its complement (second nucleic acid sequence). The nucleic acid sequence can further be homologous to or complementary to a portion of the sequence SEQ ID NO: 3 comprising the entire sequence SEQ ID NO: 1. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences comprise a DNA primer pair in a DNA amplification method for producing an amplification product. When the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product comprising the sequence SEQ ID NO: 1, the presence of the transgenic maize event LP1141-1 or its progeny can be diagnosed. It is well known to those skilled in the art that the first and second nucleic acid sequences need not consist solely of DNA and can also comprise RNA, a mixture of DNA and RNA, or a combination of DNA, RNA, or other nucleotides or their analogs that do not serve as templates for one or more polymerases. In addition, the probe or primer of the present invention should be at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive nucleotides in length, which can be selected from the nucleotides set forth in the sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5. When selected from the nucleotides set forth in the sequences of SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, the probe and primer can be about 17 to 50 or more consecutive nucleotides in length.

[0012] The sequence SEQ ID NO: 3 or its complementary sequence is a 980-nucleotide sequence located near the insertion junction at the 5' end of the insertion sequence in the transgenic corn event LP1141-1. The sequence SEQ ID NO: 3 or its complementary sequence consists of a 441-nucleotide corn flanking genomic DNA sequence (nucleotides 1-441 of SEQ ID NO: 3), a 300-nucleotide pLP1141-1 construct DNA sequence (nucleotides 442-741 of SEQ ID NO: 3), and a 239-nucleotide 3'-end DNA sequence of the tNos terminator (nucleotides 742-980 of SEQ ID NO: 3). The presence of the sequence SEQ ID NO: 3 or its complementary sequence can be identified as the presence of the transgenic corn event LP1141-1.

[0013] The nucleic acid sequence can be at least 11 or more contiguous polynucleotides of any portion of the transgenic insert sequence of SEQ ID NO:4 or its complement (a third nucleic acid sequence), or at least 11 or more contiguous polynucleotides of any portion of the 3'-flanking maize genomic DNA region of SEQ ID NO:4 or its complement (a fourth nucleic acid sequence). The nucleic acid sequence can further be homologous to or complementary to a portion of SEQ ID NO:2 or SEQ ID NO:4. When the third and fourth nucleic acid sequences are used together, these nucleic acid sequences can be used in a DNA amplification method that includes a DNA primer pair to produce an amplification product. When the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product that includes the sequence of SEQ ID NO:2, the presence of transgenic maize event LP1141-1 or its progeny can be diagnosed. The sequence SEQ ID NO: 4 or its complementary sequence is a 932-nucleotide sequence located near the insertion junction at the 3' end of the insertion sequence in the transgenic maize event LP1141-1. The sequence SEQ ID NO: 4 or its complementary sequence consists of a 253-nucleotide tNos (nopaline synthase) transcription terminator sequence (nucleotides 1-253 of SEQ ID NO: 4), a 205-nucleotide pLP1141-1 construct DNA sequence (nucleotides 254-458 of SEQ ID NO: 4), and a 474-nucleotide maize integration site flanking genomic DNA sequence (nucleotides 459-932 of SEQ ID NO: 4). The presence of the sequence SEQ ID NO: 4 or its complementary sequence can be used to identify the presence of the transgenic maize event LP1141-1.

[0014] The sequence SEQ ID NO: 5 or its complementary sequence is a 14241-nucleotide sequence characterizing the transgenic maize event LP1141-1, and its specific genomic and genetic elements are shown in Table 1. The presence of the sequence SEQ ID NO: 5 or its complementary sequence can be used to identify the presence of the transgenic maize event LP1141-1.

[0015] Table 1 Genome and genetic elements contained in sequence SEQ ID NO: 5 genetic elements length Position located on the sequence SEQ ID NO:5 5' genome 441bp 1-441 RB area 300bp 442-741 pHvLPT2 856bp 742-1597 DsRed 678bp 1602-2279 tPinII 311bp 2280-2590 pZm5126 503bp 2617-3119 ZmMS45 1552bp 3120-4671bp tZmMS45 400bp 4672-5071 Mar1 862bp 5118-5979 pZmPG47 2736bp 6017-8752 spZmbt1 225bp 8755-8979 cZmAmylase 1263bp 8980-10242 tIn2 344bp 10320-10663 pZmUbi1 1993bp 10753-12745 PAT 552bp 12752-13303 tNos 253bp 13310-13562 LB area 205bp 13563-13767 3' genome 474bp 13768-14241 The nucleic acid sequence or its complementary sequence can be used in a DNA amplification method to produce an amplification product, and the presence of the transgenic corn event LP1141-1 or its progeny in a biological sample can be diagnosed by detecting the amplification product; the nucleic acid sequence or its complementary sequence can be used in a nucleotide detection method to detect the presence of the transgenic corn event LP1141-1 or its progeny in a biological sample.

[0016] The present invention provides a DNA primer pair comprising a first primer and a second primer, wherein the first primer and the second primer each comprise a fragment of the sequence SEQ ID NO: 5 or a complementary sequence thereof, and when used in an amplification reaction together with DNA containing transgenic corn event LP1141-1, an amplification product of the transgenic corn event LP1141-1 in a detection sample is generated.

[0017] In some embodiments, the first primer is selected from the sequence SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 8 or SEQ ID NO: 12; the second primer is selected from the sequence SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 11 or SEQ ID NO: 14.

[0018] In some embodiments of the present invention, the amplification product includes at least 11 consecutive nucleotides in the sequence of SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides in the sequence of SEQ ID NO: 4 or its complementary sequence.

[0019] Furthermore, the amplification product includes the 1st to 10th or 11th to 20th consecutive nucleotides in the sequence SEQ ID NO: 1 or its complementary sequence, or the 1st to 10th or 11th to 20th consecutive nucleotides in the sequence SEQ ID NO: 2 or its complementary sequence.

[0020] Furthermore, the amplification product includes the sequence SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence, or the sequence SEQ ID NO: 7 or its complementary sequence.

[0021] In the above technical solution, the primers include at least one of the nucleic acid sequences. Specifically, the primers include a first primer and a second primer, wherein the first primer is selected from the sequence of SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 8 or SEQ ID NO: 12, and the second primer is selected from the sequence of SEQ ID NO: 9 or SEQ ID NO: 13; or the first primer is selected from the sequence of SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 10 or SEQ ID NO: 15, and the second primer is selected from the sequence of SEQ ID NO: 11 or SEQ ID NO: 14.

[0022] The present invention also provides a DNA probe comprising one or more of the sequences SEQ ID NOs: 1-7 or their complementary sequences, wherein the DNA probe hybridizes with a DNA molecule comprising a nucleic acid sequence selected from the sequence SEQ ID NOs: 1-7 or their complementary sequences under stringent hybridization conditions, and does not hybridize with a DNA molecule not comprising a nucleic acid sequence selected from the sequence SEQ ID NOs: 1-7 or their complementary sequences under stringent hybridization conditions.

[0023] In some embodiments, the DNA probe comprises a sequence selected from the group consisting of SEQ ID NO: 1 or its complement, SEQ ID NO: 2 or its complement, SEQ ID NO: 6 or its complement, and SEQ ID NO: 7 or its complement.

[0024] In some embodiments, the DNA probe is labeled with a fluorescent group.

[0025] In some embodiments, the probe comprises at least 11 consecutive nucleotides in the sequence SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in the sequence SEQ ID NO:4 or its complementary sequence; further, the probe comprises the 1st to 10th or 11th to 20th consecutive nucleotides in the sequence SEQ ID NO:1 or its complementary sequence, or the 1st to 10th or 11th to 20th consecutive nucleotides in the sequence SEQ ID NO:2 or its complementary sequence.

[0026] The present invention also provides a marker nucleic acid molecule comprising one or more of the sequences SEQ ID NOs: 1-7 or their complementary sequences, wherein the marker nucleic acid molecule hybridizes with a DNA molecule comprising a nucleic acid sequence selected from the sequence SEQ ID NOs: 1-7 or their complementary sequences under stringent hybridization conditions, and does not hybridize with a DNA molecule not comprising a nucleic acid sequence selected from the sequence SEQ ID NOs: 1-7 or their complementary sequences under stringent hybridization conditions.

[0027] In some embodiments, the marker nucleic acid molecule comprises a sequence selected from the group consisting of SEQ ID NO: 1 or its complement, SEQ ID NO: 2 or its complement, SEQ ID NO: 6 or its complement, and SEQ ID NO: 7 or its complement.

[0028] In one embodiment, the marker nucleic acid molecule comprises at least 11 consecutive nucleotides of the sequence SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides of the sequence SEQ ID NO: 4 or its complementary sequence; In some embodiments, the marker nucleic acid molecule includes consecutive nucleotides 1-10 or 11-20 in the sequence of SEQ ID NO: 1 or its complementary sequence, or consecutive nucleotides 1-10 or 11-20 in the sequence of SEQ ID NO: 2 or its complementary sequence.

[0029] Furthermore, the present invention provides a method for detecting the presence of DNA of transgenic maize event LP1141-1 in a sample, comprising: (1) contacting the sample to be tested with the DNA primer pair in a nucleic acid amplification reaction; (2) Performing nucleic acid amplification reaction; (3) Detecting the presence of amplification products; The amplification product includes a nucleic acid sequence selected from SEQ ID NO: 1-7 or a complementary sequence thereof, indicating the presence of DNA of the transgenic corn event LP1141-1 in the test sample.

[0030] The present invention also provides a method for detecting the presence of DNA of the transgenic maize event LP1141-1 in a sample, comprising: (1) contacting the sample to be tested with the DNA probe and / or the marker nucleic acid molecule; (2) hybridizing the sample to be detected with the probe and / or the marker nucleic acid molecule under stringent hybridization conditions; (3) Detecting the hybridization between the sample to be detected and the probe and / or the marker nucleic acid molecule.

[0031] The stringent conditions may be hybridization in a 6×SSC (sodium citrate) and 0.5% SDS (sodium dodecyl sulfate) solution at 65° C., followed by washing the membrane once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.

[0032] The hybridization between the sample to be tested and the marker nucleic acid molecule is detected, and then marker-assisted breeding analysis is performed to determine whether red fluorescence, male fertility recovery, tassel pollen lethality and glufosinate resistance are genetically linked to the marker nucleic acid molecule.

[0033] The present invention also provides a DNA detection kit comprising: a DNA primer pair that produces an amplicon diagnostic for transgenic maize event LP1141-1, and a probe specific for the sequences of SEQ ID NOs: 1-7, or a marker nucleic acid molecule specific for the sequences of SEQ ID NOs: 1-7. Specifically, the detection kit comprises the probe, primer pair, or marker nucleic acid molecule described herein.

[0034] In some embodiments, the present invention provides a DNA detection kit comprising at least one DNA molecule, wherein the DNA molecule comprises at least 11 consecutive nucleotides of a homologous sequence of SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides of a homologous sequence of SEQ ID NO: 4 or its complementary sequence, which can be used as a DNA primer or probe specific for transgenic corn event LP1141-1 or its progeny.

[0035] Furthermore, the DNA molecule includes the 1st to 10th or 11th to 20th consecutive nucleotides in the sequence SEQ ID NO: 1 or its complementary sequence, or the 1st to 10th or 11th to 20th consecutive nucleotides in the sequence SEQ ID NO: 2 or its complementary sequence.

[0036] Furthermore, the DNA molecule comprises a homologous sequence of SEQ ID NO: 1 or its complementary sequence, a homologous sequence of SEQ ID NO: 2 or its complementary sequence, a homologous sequence of SEQ ID NO: 6 or its complementary sequence, or a homologous sequence of SEQ ID NO: 7 or its complementary sequence. To achieve the above object, the present invention also provides a plant cell comprising a nucleic acid sequence encoding a red fluorescent protein DsRed, a male fertility restorer protein MS45, a tassel pollen lethal protein ZmAmylase, a nucleic acid sequence encoding a glufosinate herbicide tolerance PAT protein, and a nucleic acid sequence of a specific region, wherein the nucleic acid sequence of the specific region comprises a sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 7.

[0037] The sequences provided by the present invention include the sequences listed in Table 2 below: Table 2 Related sequences of the present invention Sequence number (SEQ ID NO) Sequence Description 1 RB end junction sequence (including part of the T-DNA RB end sequence and genomic sequence, 22bp) 2 LB end junction sequence (including part of the T-DNA LB end sequence and genomic sequence, 22bp) 3 The 5' end of the inserted sequence is the nucleotide sequence located near the insertion site, which is the RB end for T-DNA (containing approximately 500 bp of genomic sequence) 4 The 3' end of the inserted sequence is the nucleotide sequence located near the insertion site, which is the LB end for T-DNA (containing approximately 500bp of genomic sequence) 5 Full-length T-DNA sequence (including approximately 200 and 300 bp of sequences at the LB and RB ends, including genomic sequence, and extended by 500 bp at both ends) 6 Sequence located within SEQ ID NO: 3, LP1141-1 T-DNA sequence 7 Sequence located within SEQ ID NO: 4, LP1141-1 T-DNA sequence 8 The first primer for amplifying SEQ ID NO: 3, primer 11 9 Amplify the second primer of SEQ ID NO:3, primer 12 10 The first primer for amplifying SEQ ID NO: 4, primer 13 11 A second primer for amplifying SEQ ID NO: 4, primer 14 12 5' flanking genomic primer, primer 15 13 Primer 16 on T-DNA that pairs with sequence 12 14 3' flanking genomic primer, primer 17 15 Primer 18 on T-DNA that pairs with sequence 14 16 Taqman detection of DsRed primer 1 17 Taqman detection of DsRed primer 2 18 Taqman detection of DsRed probe 1 19 Taqman assay for MS45 primer 3 20 Taqman assay for MS45 primer 4 21 Taqman detection of MS45 probe 2 22 Taqman assay for ZmAmylase primer 5 23 Taqman assay for ZmAmylase primer 6 24 Taqman assay for ZmAmylase probe 3 25 Taqman assay PAT primer 7 26 Taqman assay PAT primer 8 27 Taqman assay for PAT probe 4 28 The first primer 9 of maize endogenous gene Ubiqutin 29 The second primer of maize endogenous gene Ubiqutin 10 30 DsRed probe 5 in Southern hybridization detection 31 Probe 6 for MS45 in Southern hybridization 32 Probe 7 for ZmAmylase in Southern Hybridization 33 Probe 8 for PAT in Southern hybridization 34 Primer 19 located on the T-DNA, in the same direction as SEQ ID NO: 13 35 Primer 20 located on the T-DNA, in the opposite direction to SEQ ID NO: 13 36 Primer 21 located on T-DNA, in the opposite direction to SEQ ID NO: 13 37 Primer 22 located on the T-DNA, in the same direction as SEQ ID NO: 15 38 Primer 23 located on T-DNA, in the opposite direction to SEQ ID NO: 15 39 Primer 24 located on the T-DNA, in the opposite direction to SEQ ID NO: 15 The present invention also provides a method for obtaining red maintainer seeds and male sterile materials that can be observed with the naked eye, comprising: (1) Planting at least one corn seed; the genome of the corn seed sequentially comprises the sequences SEQ ID NO: 1, the nucleic acid sequence at positions 452 to 13757 of SEQ ID NO: 5, and SEQ ID NO: 2; or the genome of the corn seed comprises the sequence SEQ ID NO: 5; (2) growing the corn seeds into corn plants; (3) The corn plants are hybridized with male sterile plants and / or the corn plants are sprayed with an effective dose of glufosinate-ammonium herbicide, and the maintainer plants and male sterile plants are harvested as offspring, wherein the maintainer plants include red maintainer seeds and yellow male sterile seeds that can be observed with the naked eye, and the red maintainer seeds that can be observed with the naked eye are cultivated to obtain maintainer materials, and the male sterile materials are screened to obtain them.

[0038] The present invention also provides a method for protecting corn plants from damage caused by herbicides, comprising planting at least one transgenic corn plant, wherein the transgenic corn plant genome comprises, in order, the sequences of SEQ ID NO: 1, the nucleic acid sequence at positions 452-13757 of SEQ ID NO: 5, and SEQ ID NO: 2; or wherein the transgenic corn plant genome comprises the sequence of SEQ ID NO: 5. In some embodiments, the method comprises applying an effective amount of glufosinate-ammonium herbicide to a field in which the at least one transgenic corn plant is planted, wherein the transgenic corn plant comprises transgenic corn event LP1141-1.

[0039] The present invention also provides a method for controlling weeds in a field planted with corn plants, comprising applying an effective dose of a glufosinate herbicide to a field planted with at least one transgenic corn plant, wherein the genome of the transgenic corn plant sequentially comprises the sequences SEQ ID NO: 1, the nucleic acid sequence at positions 452 to 13757 of SEQ ID NO: 5, and SEQ ID NO: 2; or the genome of the transgenic corn plant comprises the sequence SEQ ID NO: 5.

[0040] The probe or primer pair-based detection method and / or kit of the present invention can be used to detect a transgenic corn event LP1141-1 nucleic acid sequence such as that shown in SEQ ID NO: 1 or SEQ ID NO: 2 in a biological sample, wherein the probe sequence or primer sequence is selected from the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5 to diagnose the presence of transgenic corn event LP1141-1.

[0041] Compared with the prior art, the present invention has the following beneficial effects: The transgenic corn event LP1141-1 of the present invention has the triple traits of obtaining red maintainer seeds, breeding sterile plants, and herbicide resistance, and has the following advantages: 1) hybridization with male sterile plants can obtain offspring containing only maintainer and male sterile lines, and the obtained maintainer is red seeds observable to the naked eye, and the remaining yellow seeds are male sterile seeds; 2) the ability to apply agricultural herbicides containing glufosinate ammonium to maintainer corn crops for broad-spectrum weed control; 3) corn yield is not reduced. Specifically, the hybrid offspring of the transgenic corn event LP1141-1 of the present invention has a 1:1 ratio of maintainer to male sterile seeds; it has high tolerance to glufosinate ammonium herbicide, and even when the glufosinate ammonium herbicide is applied at four times the recommended dose, it can still protect the plant and reduce its damage rate to 0%; and the plants containing this event exhibit excellent agronomic traits, with a yield percentage of up to 101%. In addition, the gene encoding red fluorescence DsRed , male fertility restorer gene MS45 , male spike pollen causes death ZmAmylase The expression cassette and the gene for the glufosinate-ammonium tolerance trait are linked to the same DNA segment and present at a single locus in the genome of the transgenic maize event LP1141-1. This improves breeding efficiency and enables the use of molecular markers to track transgenic inserts in breeding populations and their progeny. Furthermore, the primer or probe sequences provided in the detection method of the present invention can produce amplification products identified as transgenic maize event LP1141-1 or its progeny, enabling rapid, accurate, and stable identification of the presence of plant material derived from transgenic maize event LP1141-1.

[0042] the term The following definitions and methods can better define the present invention and guide those skilled in the art to implement the present invention. Unless otherwise specified, the terms are understood according to conventional usage by those skilled in the art.

[0043] The term "corn" refers to maize ( Zea mays ), and includes all plant varieties that can be crossed with corn, including wild corn species.

[0044] The term “comprising” means “including but not limited to.” The term “processed product” refers to a product obtained by processing raw materials such as plants and seeds, such as a composition.

[0045] In some embodiments, the present invention provides the nucleotide sequence of the present invention. " flanking DNA " can comprise the genome that is naturally present in the organism of for example plant or the foreign source (heterologous) DNA that is introduced by transformation process, for example the fragment relevant to transformation event.Therefore, flanking DNA can comprise the combination of natural and foreign DNA.In the present invention, " flanking region " or " flanking sequence " or " genome border zone " or " genome border sequence " refer to at least 3,5,10,11,15,20,50,100,200,300,400,1000,1500,2000,2500 or 5000 base pairs or longer sequence, and it is positioned at the direct upstream or downstream of initial external source insertion DNA molecule and is adjacent to initial external source insertion DNA molecule.When this flanking region was positioned at downstream, it also can be called " left boundary flank " or " 3 ' flank " or " 3 ' genome border zone " or " genome 3 ' border sequence " etc. When the flanking region is located upstream, it may also be referred to as the "right border flank" or the "5' flank" or the "5' genomic border region" or the "genomic 5' border sequence" or the like.

[0046] Transformation procedures that cause random integration of exogenous DNA will result in transformants containing different flanking regions, which are specifically contained in each transformant. When recombinant DNA is introduced into plants by traditional hybridization, its flanking regions are generally unchanged. Transformants will also contain unique junctions between segments of heterologous insert DNA and genomic DNA, or between two segments of genomic DNA, or between two segments of heterologous DNA. "Junction" is the point where two specific DNA fragments connect. For example, a junction is present at the position where the insert DNA connects to the flanking DNA. Junctions are also present in transformed organisms where two DNA fragments are linked together in a manner modified from that found in natural organisms. "Junction DNA" refers to the DNA that comprises a junction.

[0047] The present invention provides a transgenic corn event called LP1141-1 and its progeny, wherein the transgenic corn event LP1141-1 is a corn plant LP1141-1, which includes plants and seeds of the transgenic corn event LP1141-1 and plant cells or their regenerable parts. The plant parts of the transgenic corn event LP1141-1 include but are not limited to cells, pollen, ovules, flowers, buds, roots, stems, silks, inflorescences, ears, leaves and products from the corn plant LP1141-1, such as corn flour, corn meal, corn oil, corn steep liquor, corn silk, corn starch and biomass remaining in the corn crop field.

[0048] In some embodiments of the present invention, the DNA construct comprises four tandem expression cassettes. The first expression cassette comprises a suitable promoter for expression in plants, operably linked to the nucleic acid sequence of the red fluorescent gene DsRed, wherein the DsRed protein exhibits red fluorescence. The second expression cassette comprises a suitable promoter for expression in plants, operably linked to the nucleic acid sequence of the male fertility restorer gene MS45, wherein the MS45 restores male fertility. The third expression cassette comprises a suitable promoter for expression in plants, operably linked to the nucleic acid sequence of the tassel pollen lethal gene ZmAmylase, wherein the nucleic acid sequence of the ZmAmylase is primarily lethal to tassel pollen. The fourth expression cassette comprises a suitable promoter for expression in plants, operably linked to the gene for glufosinate acetyltransferase (PAT), wherein the nucleic acid sequence of the PAT protein confers tolerance to glufosinate herbicide. Further, the promoter can be a suitable promoter isolated from a plant, including a constitutive, inducible and / or tissue-specific promoter, and the suitable promoter includes but is not limited to, cauliflower mosaic virus (CaMV) p35S promoter, figwort mosaic virus (FMV) 35S promoter, ubiquitin protein (Ubiquitin) promoter, actin (Actin) promoter, Agrobacterium tumefaciens nopaline synthase (NOS) promoter, octopine synthase (OCS) promoter, Cestrum yellow leaf curl virus promoter, potato tuber storage protein (Patatin) promoter, ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCO) promoter, glutathione S-transferase (GST) promoter, E9 promoter, GOS promoter, alcA / alcR promoter, Agrobacterium rhizogenes ( Agrobacterium rhizogenes )RolD promoter and Arabidopsis ( Arabidopsis thaliana ) Suc2 promoter. The polyadenylation signal sequence may be a suitable polyadenylation signal sequence that functions in plants, including but not limited to, polyadenylation signal sequences derived from Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) polyadenylation signal sequence from the nopaline synthase (NOS) gene, the t35S terminator from the cauliflower mosaic virus (CaMV), the polyadenylation signal sequence from the proteinase inhibitor II (PIN II) gene, and the polyadenylation signal sequence from the α-tubulin gene.

[0049] In addition, the expression cassette may also include other genetic elements, including but not limited to enhancers and signal peptide / transit peptide nucleic acid coding sequences. The enhancers can enhance the expression level of the gene, including but not limited to tobacco etch virus (TEV) translation activator, CaMV35S enhancer, and FMV35S enhancer. The signal peptide / transit peptide can guide the EPSPS protein to be transported to a specific organelle or compartment outside the cell or within the cell, for example, by targeting the chloroplast using a chloroplast transit peptide sequence, or by targeting the endoplasmic reticulum using a 'KDEL' retention sequence.

[0050] In some embodiments of the present invention, a corn cell, seed or plant comprising transgenic corn event LP1141-1 comprises in its genome, in sequence, the sequences of SEQ ID NO: 1, the nucleic acid sequence at positions 452-13757 of SEQ ID NO: 5 and SEQ ID NO: 2, or comprises the sequence of SEQ ID NO: 5.

[0051] The term "glufosinate" refers to the enzyme glufosinate acetyltransferase, and treatment with a "glufosinate herbicide" refers to treatment with any herbicide formulation containing glufosinate. The selection of a specific glufosinate formulation's rate of use to achieve a biologically effective dose is well within the skill of an ordinary agronomist. Treatment of a field containing plant material derived from transgenic maize event LP1141-1 with any of the herbicide formulations containing glufosinate will control weed growth in the field without affecting the growth or yield of the plant material derived from transgenic maize event LP1141-1.

[0052] The DNA construct is introduced into the plant using a transformation method including, but not limited to, Agrobacterium-mediated transformation, biolistic transformation, and pollen tube pathway transformation.

[0053] Agrobacterium-mediated transformation is a common method for plant transformation. The foreign DNA to be introduced into the plant is cloned between the left and right consensus border sequences of the vector, i.e., the T-DNA region. The vector is transformed into Agrobacterium cells, which are then used to infect plant tissue, and the T-DNA region of the vector containing the foreign DNA is inserted into the plant genome.

[0054] Following transformation, transgenic plants must be regenerated from the transformed plant tissue and progeny harboring the foreign DNA selected using appropriate markers.

[0055] DNA construct is the combination that DNA molecule is connected to each other, and this combination provides one or more expression cassettes.DNA construct specifically can self-replicate in bacterial cell, and contains the plasmid of different restriction endonuclease sites, and contained restriction endonuclease sites are used to import the DNA molecule that functional gene element is provided, i.e. promoter, intron, leader sequence, coding sequence, 3 ' terminator region and other sequences.Expression cassette contained in the DNA construct comprises the necessary gene element that messenger RNA is transcribed, and described expression cassette can be designed to express in prokaryotic cell or eukaryotic cell.Expression cassette of the present invention is designed to express in plant cell the most specifically.

[0056] A transgenic "event" is obtained by transforming plant cells with a heterologous DNA construct, i.e., comprising at least one nucleic acid expression cassette containing a gene of interest, transgenically inserted into the plant genome to produce a plant population, regenerate the plant population, and select for specific plants characterized by the insertion at a specific genomic locus. The term "event" refers to the original transformant that contains the heterologous DNA and the progeny of the transformant. The term "event" also refers to the progeny obtained by sexually crossing a transformant with individuals of another variety containing the heterologous DNA, wherein the inserted DNA and flanking genomic DNA from the transformant parent are present at the same chromosomal location in the progeny of the hybrid, even after repeated backcrossing with the recurrent parent. The term "event" also refers to a DNA sequence from the original transformant that contains the inserted DNA and flanking genomic sequences immediately adjacent to the inserted DNA, which is expected to be transferred to progeny produced by sexually crossing a parental line containing the inserted DNA (e.g., the original transformant and progeny resulting from selfing thereof) with a parental line that does not contain the inserted DNA, and which progeny receive the inserted DNA containing the gene of interest.

[0057] As used herein, "heterologous" means that the first molecule is not normally found in combination with the second molecule in nature. For example, a molecule can be derived from a first species and inserted into the genome of a second species. Thus, such a molecule is heterologous to the host cell and has been artificially introduced into the genome of the host cell.

[0058] Cultivating red maintainer seeds that can be directly observed with the naked eye and breeding male sterile materials with tolerance to glufosinate herbicide can be achieved through the following steps: first, sexually hybridizing a first parent corn plant with a second parent corn plant to produce diverse first-generation progeny plants, wherein the first parent corn plant consists of corn plants cultivated from the transgenic corn event LP1141-1 and its offspring, and the transgenic corn event LP1141-1 and its offspring are transformed using the expression cassette of the present invention that exhibits red fluorescence, male fertility restoration, tassel pollen killing, and tolerance to glufosinate herbicide, and the second parent corn plant is a heterozygous male sterile material; and self-pollinating the offspring to obtain red maintainer materials with genotypes of LP1141-1 / -, ms45 / ms45 and yellow sterile materials with genotypes of - / , ms45 / ms45. These steps can obtain red maintainer seeds visible to the naked eye, achieve the breeding of male sterile seeds again, and then select offspring by applying glufosinate herbicide or through identification of molecular markers related to the trait (such as DNA molecules containing the junction sites identified at the 5' and 3' ends of the insertion sequence in the transgenic corn event LP1141-1), thereby producing the next generation of maintainer lines that can continue to breed male sterile lines that are visible to the naked eye, and corn plants that are male sterile and tolerant to glufosinate herbicide.

[0059] It should also be understood that two different transgenic plants can also be crossed to produce offspring containing two independent, segregating added exogenous genes. Selfing of appropriate offspring can produce offspring plants that are homozygous for both added exogenous genes. Backcrossing of the parent plants and outcrossing with non-transgenic plants as described above are also contemplated, as are asexual propagation.

[0060] The term "probe" refers to an isolated nucleic acid molecule to which a conventional detectable label or reporter molecule, such as a radioisotope, ligand, chemiluminescent agent, or enzyme, may be conjugated. Such a probe is complementary to a strand of a target nucleic acid. In the present invention, the probe is complementary to a strand of genomic DNA from transgenic maize event LP1141-1, whether the genomic DNA is from transgenic maize event LP1141-1 or seeds, or from plants, seeds, or extracts thereof. The probes of the present invention include not only deoxyribonucleic acids (DNAs) or RNAs, but also polyamides and other probe materials that specifically bind to a target DNA sequence and can be used to detect the presence of the target DNA sequence.

[0061] The term "primer" refers to an isolated nucleic acid molecule that anneals to a complementary target DNA strand through nucleic acid hybridization, forming a hybrid between the primer and the target DNA strand, which is then extended along the target DNA strand by a polymerase (e.g., DNA polymerase). The primer pairs of the present invention relate to their use in amplifying a target nucleic acid sequence, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.

[0062] Methods for designing and using primers and probes are well known in the art. DNA molecules comprising the full length or fragments of the sequences SEQ ID NOs: 1-7 can be used as primers and probes for detecting transgenic maize event LP1141-1 and can be easily designed by those skilled in the art using the sequences provided herein.

[0063] The length of the probe and primer is generally 11 polynucleotides or more, preferably 18 polynucleotides or more, more preferably 24 polynucleotides or more, and most preferably 30 polynucleotides or more. Such probes and primers specifically hybridize with the target sequence under highly stringent hybridization conditions. Although probes that are different from the target DNA sequence and that maintain hybridization ability to the target DNA sequence can be designed by conventional methods, preferably, the probes and primers of the present invention have complete DNA sequence identity with the continuous nucleic acid of the target sequence.

[0064] Primers and probes based on the flanking genomic DNA and insert sequences of the present invention can be determined by conventional methods, for example, by isolating the corresponding DNA molecules from plant material derived from transgenic maize event LP1141-1 and determining the nucleic acid sequence of the DNA molecules. The DNA molecules contain the transgenic insert sequence and the maize genomic flanking regions, and fragments of the DNA molecules can be used as primers or probes.

[0065] The nucleic acid probes and primers of the present invention hybridize to target DNA sequences under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from transgenic maize event LP1141-1 in a sample. Nucleic acid molecules or fragments thereof are capable of specific hybridization to other nucleic acid molecules under certain circumstances. As used herein, two nucleic acid molecules are said to be capable of specific hybridization to each other if they can form an antiparallel double-stranded nucleic acid structure. If two nucleic acid molecules exhibit complete complementarity, one is said to be the "complement" of the other. As used herein, two nucleic acid molecules are said to exhibit "complete complementarity" when every nucleotide in one molecule is complementary to the corresponding nucleotide in the other. Two nucleic acid molecules are said to be "minimally complementary" if they can hybridize with sufficient stability to anneal and bind to each other under at least conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to be "complementary" if they can hybridize with sufficient stability to anneal and bind to each other under conventional "high stringency" conditions. Deviations from perfect complementarity are permissible as long as such deviations do not completely prevent the two molecules from forming a duplex structure. In order for a nucleic acid molecule to function as a primer or probe, it is only necessary that it possess sufficient sequence complementarity to allow a stable duplex structure to form under the particular solvent and salt concentration employed.

[0066] As used herein, a substantially homologous sequence is a nucleic acid molecule that is capable of specifically hybridizing to the complementary strand of a matching nucleic acid molecule under highly stringent conditions. Suitable stringent conditions for promoting DNA hybridization, such as treatment with 6.0× sodium chloride / sodium citrate (SSC) at approximately 45°C, followed by washing with 2.0×SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the wash step can be selected from about 2.0×SSC at 50°C for low stringency conditions to about 0.2×SSC at 50°C for high stringency conditions. In addition, the temperature in the wash step can be increased from room temperature, about 22°C, for low stringency conditions, to about 65°C for high stringency conditions. Both the temperature and the salt concentration can be varied, or one of them can be held constant while the other is varied. Specifically, a nucleic acid molecule of the present invention can specifically hybridize to one or more nucleic acid molecules of the sequence SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, or their complementary sequences, or any fragments thereof, under moderate stringency conditions, for example, at about 2.0×SSC and about 65° C. More specifically, a nucleic acid molecule of the present invention can specifically hybridize to one or more nucleic acid molecules of the sequence SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, or their complementary sequences, or any fragments thereof, under high stringency conditions. In the present invention, a preferred marker nucleic acid molecule has the sequence SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 7, or their complementary sequences, or any fragments thereof. Another preferred marker nucleic acid molecule of the present invention has 80% to 100% or 90% to 100% sequence identity to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 7, or its complement, or any fragment thereof. The sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, and SEQ ID NO: 7 can be used as markers in plant breeding methods to identify progeny of genetic crosses. Hybridization of the probe to the target DNA molecule can be detected by any method known to those skilled in the art, including, but not limited to, fluorescent labels, radioactive labels, antibody-based labels, and chemiluminescent labels.

[0067] With respect to amplification of a target nucleic acid sequence using specific amplification primers (e.g., by PCR), "stringent conditions" refer to conditions that only allow the primers to hybridize to the target nucleic acid sequence in a DNA thermal amplification reaction, wherein the primers having a wild-type sequence corresponding to the target nucleic acid sequence (or its complementary sequence) are capable of binding to the target nucleic acid sequence and preferably produce a unique amplification product, i.e., an amplicon.

[0068] As used herein, "amplified DNA," "amplification product," or "amplicon" refers to the product of nucleic acid amplification of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a corn plant was produced by sexual crosses containing the transgenic corn event LP1141-1 of the present invention, or whether a corn sample collected from the field contains the transgenic corn event LP1141-1, or whether a corn extract, such as meal, flour, or oil, contains the transgenic corn event LP1141-1, DNA extracted from a corn plant tissue sample or extract can be subjected to a nucleic acid amplification method using a primer pair to produce an amplicon that is diagnostic for the presence of DNA from the transgenic corn event LP1141-1. The primer pair includes a first primer that includes flanking sequences derived from the plant genome or adjacent to the insertion site of the inserted exogenous DNA, and a second primer that is derived from the inserted exogenous DNA. The amplicon has a length and sequence that is also diagnostic for the transgenic corn event LP1141-1. The length of the amplicon can range from the combined length of the primer pair plus one nucleotide base pair, preferably plus about fifty nucleotide base pairs, more preferably plus about two hundred and fifty nucleotide base pairs, and most preferably plus about four hundred and fifty nucleotide base pairs or more.

[0069] Alternatively, the primer pairs can be derived from flanking genomic sequences on either side of the insert DNA to produce an amplicon that includes the entire insert nucleic acid sequence. One of the primer pairs derived from a plant genomic sequence can be positioned at a distance from the insert DNA sequence that can range from one nucleotide base pair to approximately 20,000 nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed during thermal DNA amplification reactions.

[0070] Nucleic acid amplification reactions can be achieved by any nucleic acid amplification reaction method known in the art, including polymerase chain reaction (PCR). Various nucleic acid amplification methods are well known to those skilled in the art. PCR amplification methods have been developed to amplify 22 kb of genomic DNA and 42 kb of phage DNA. These methods and other DNA amplification methods in the art can be used in the present invention. The inserted exogenous DNA sequence and the flanking DNA sequence from the transgenic corn event LP1141-1 can be amplified by using the provided primer sequences to amplify the genome of the transgenic corn event LP1141-1, and after amplification, the PCR amplicon or cloned DNA is subjected to standard DNA sequencing.

[0071] DNA detection kits based on DNA amplification methods can contain DNA primer molecules that specifically hybridize to the target DNA under appropriate reaction conditions and amplify a diagnostic amplicon. The kit can provide agarose gel-based detection methods or many methods known in the art for detecting diagnostic amplicons. Kits containing DNA primers homologous or complementary to any portion of the maize genomic region of sequence SEQ ID NO:3 or SEQ ID NO:4, and homologous or complementary to any portion of the transgenic insertion region of sequence SEQ ID NO:5 are provided by the present invention. In particular, the primer pairs identified as useful in DNA amplification methods are sequences SEQ ID NO:8 and SEQ ID NO:9, which amplify a diagnostic amplicon homologous to a portion of the 5' transgene / genomic region of transgenic maize event LP1141-1, wherein the amplicon includes the sequence SEQ ID NO:1. Other DNA molecules used as DNA primers can be selected from the sequence SEQ ID NO:5.

[0072] The amplicons generated by these methods can be detected using a variety of techniques. One method is GeneticBit Analysis, in which a DNA oligonucleotide strand is designed that spans the insert DNA sequence and the adjacent flanking genomic DNA sequence. This oligonucleotide strand is immobilized in a microwell of a microplate, and after PCR amplification of the target region (using one primer within the insert sequence and one primer within the adjacent flanking genomic sequence), the single-stranded PCR product can be hybridized to the immobilized oligonucleotide strand and used as a template for a single-base extension reaction using a DNA polymerase and ddNTPs specifically labeled for the next expected base. The results can be obtained using fluorescence or ELISA-type methods. The signal represents the presence of the insert / flanking sequence, indicating that the amplification, hybridization, and single-base extension reactions were successful.

[0073] Another method is Pyrosequencing technology. This method designs an oligonucleotide chain that spans the inserted DNA sequence and the adjacent genomic DNA binding site. The oligonucleotide chain is hybridized with the single-stranded PCR product of the target region (one primer is used in the inserted sequence and one primer is used in the adjacent flanking genomic sequence) and then incubated with DNA polymerase, ATP, sulfhydrylase, luciferase, apyrase, adenosine-5'-phosphosulfate and luciferin. dNTPs are added separately and the resulting light signal is measured. The light signal represents the presence of the inserted / flanking sequence, which indicates that the amplification, hybridization, and single-base or multi-base extension reaction are successful.

[0074] The fluorescence polarization phenomenon described by Chen et al. (Genome Res. 9:492-498, 1999) is also a method that can be used to detect the amplicon of the present invention. Using this method requires designing an oligonucleotide chain that spans the inserted DNA sequence and the adjacent genomic DNA binding site. The oligonucleotide chain is hybridized with the single-stranded PCR product of the target region (one primer each is used in the inserted sequence and the adjacent flanking genomic sequence), and then incubated with DNA polymerase and a fluorescently labeled ddNTPs. Single-base extension will result in the insertion of ddNTPs. This insertion can be measured using a fluorescence instrument to measure its polarization change. The change in polarization represents the presence of the inserted / flanking sequence, which indicates that the amplification, hybridization and single-base extension reactions are successful.

[0075] Taqman is described as a method for detecting and quantifying the presence of DNA sequences and is described in detail in the manufacturer's instructions. As a brief example, a FRET oligonucleotide probe is designed that spans the binding sites of an insert DNA sequence and the adjacent genomic flanking sequence. The FRET probe and PCR primers (one primer within the insert sequence and one primer in the adjacent flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in the cleavage of the fluorescent and quenching moieties on the FRET probe and the release of the fluorescent moiety. The generation of a fluorescent signal represents the presence of the insert / flanking sequence, indicating that amplification and hybridization were successful.

[0076] Suitable techniques for detecting plant material derived from transgenic maize event LP1141-1 based on hybridization principles may also include Southern blot hybridization, Northern blot hybridization, and in situ hybridization. Specifically, suitable techniques include incubating the probe with the sample, washing to remove unbound probe, and detecting whether the probe has hybridized. The detection method depends on the type of label attached to the probe; for example, radiolabeled probes can be detected by exposure and development of X-ray film, or enzyme-labeled probes can be detected by color change caused by substrate conversion.

[0077] Tyangi et al. (Nat. Biotech. 14:303-308, 1996) introduced the application of molecular markers in sequence detection. A brief description is as follows: a FRET oligonucleotide probe is designed that spans the insertion DNA sequence and the adjacent genomic flanking binding site. The unique structure of the FRET probe causes it to contain a secondary structure that can maintain a fluorescent moiety and a quenching moiety in close proximity. The FRET probe and PCR primers (one primer each is used in the insertion sequence and in the adjacent flanking genomic sequence) are cyclically reacted in the presence of a thermostable polymerase and dNTPs. After successful PCR amplification, the hybridization of the FRET probe and the target sequence causes the loss of the probe secondary structure, thereby separating the fluorescent moiety and the quenching moiety in space and generating a fluorescent signal. The generation of the fluorescent signal represents the presence of the insertion / flanking sequence, indicating that the amplification and hybridization are successful.

[0078] Other described methods, such as microfluidics, provide methods and apparatus for separating and amplifying DNA samples. Optical dyes are used to detect and measure specific DNA molecules. Nanotube devices comprising electronic sensors for detecting DNA molecules or nanobeads that bind specific DNA molecules and are thus detectable are useful for detecting the DNA molecules of the present invention.

[0079] DNA detection kits can be developed using the compositions of the present invention and methods described or known in the art of DNA detection. The kits are useful for identifying the presence of DNA from transgenic maize event LP1141-1 in a sample and can also be used to grow maize plants containing DNA from transgenic maize event LP1141-1. The kits can contain DNA primers or probes that are homologous to or complementary to at least a portion of the sequence of SEQ ID NO: 1, 2, 3, 4, or 5, or other DNA primers or probes that are homologous to or complementary to DNA contained in a transgenic genetic element of the DNA. These DNA sequences can be used in DNA amplification reactions or as probes in DNA hybridization methods.

[0080] Contained in the maize genome and in Figure 1 The DNA structure of the transgenic insertion sequence and the maize genome binding site illustrated in Table 1 includes: the maize LP1141-1 flanking genomic region located at the 5' end of the transgenic insertion sequence; a portion of the insertion sequence from the right border region (RB) of Agrobacterium; The first expression cassette consisted of the barley aleurone-specific expression gene promoter pHvLP2, operably linked to the red fluorescent gene (DsRed), and operably linked to the potato proteinase inhibitor II gene transcription terminator (tPinII); the second expression cassette consisted of the maize anther-specific expression promoter (Cigan and Albertsen, 1997) pZm5126, operably linked to the male fertility restorer gene ZmMS45 (Ms45), and operably linked to the terminator from the maize male fertility restorer gene (tZmMS54); the third expression cassette consisted of the pea chromosome motif-associated region Mar1-enhanced ZmAmylase gene promoter pZmPG47, operably linked to the maize polygalacturonase gene, and operably linked to the spZmbt1 promoter, and operably linked to the tassel pollen lethal gene ZmAmylase ( The invention relates to a novel transgenic maize cassette comprising a pZmAmylase promoter (pZmAmylase) operably linked to a terminator from the maize In gene (tIn2); a fourth expression cassette consisting of the pZmUbi1 promoter from the maize polyubiquitin-1 gene, operably linked to a phosphinothricin acetyltransferase (PAT) and operably linked to a transcriptional terminator for nopaline synthase (tNos); a portion of the insert sequence from the left border region (LB) of Agrobacterium tumefaciens; and a flanking genomic region from maize plant LP1141-1 (SEQ ID NO: 5) located 3' to the transgenic insert sequence. In the DNA amplification method, the primer DNA molecule can be any portion of the transgenic insert sequence from the transgenic maize event LP1141-1 or any portion of the flanking maize genomic DNA region from the transgenic maize event LP1141-1.

[0081] The present invention provides a transgenic corn event LP1141-1, and nucleic acid sequences and detection methods for detecting corn plants containing the event. The transgenic corn event LP1141-1 can be hybridized with male sterile plants, yielding male sterile seeds and maintainer seeds that are distinguishable to the naked eye as red, and is tolerant to the phytotoxic effects of agricultural herbicides containing glufosinate. The triple-trait corn plant enables long-term breeding of male sterile plants, while easily distinguishing maintainer offspring from offspring of two genotypes. The maintainer offspring can be used to breed male sterile lines again, significantly reducing labor costs. The plant also expresses a glufosinate acetyltransferase (PAT) protein, which imparts tolerance to glufosinate. BRIEF DESCRIPTION OF THE DRAWINGS

[0082] Figure 1 This is a schematic diagram of the structure of the binding site between the transgenic insertion sequence of the present invention and the corn genome; Figure 2 Schematic diagram of the structure of the recombinant expression vector LP1141-1 of the present invention; Figure 3 The color development of the corn ear obtained by the present invention; Figure 4 The tassel traits of the self-pollinated progeny of the maintainer line obtained by the present invention; Figure 5 This is the KI-I2 staining result of the maintainer transgenic corn pollen obtained in the present invention. DETAILED DESCRIPTION

[0083] The following is a further explanation of the technical solutions of the present invention for detecting the nucleic acid sequence of the transgenic corn event LP1141-1 and the detection method thereof through specific examples.

[0084] Example 1 Cloning and transformation 1.1. Vector cloning The recombinant expression vector pLP1141-1 was constructed using standard gene cloning technology. The structural diagram of the recombinant expression vector pLP1141-1 of the present invention is shown in FIG. Figure 2The vector pLP1141-1 contains four transgenic expression cassettes in series. The first expression cassette consists of the barley aleurone-specific expression gene promoter pHvLP2, operably linked to the red fluorescent gene (DsRed), and operably linked to the potato proteinase inhibitor II gene transcription terminator (tPinII); the second expression cassette consists of the maize anther-specific expression promoter (Cigan and Albertsen, 1997) pZm5126, operably linked to the male fertility restorer gene ZmMS45 (Ms45), operably linked to the terminator from the maize male fertility restorer gene (tZmMS54); the third expression cassette consists of the pea chromosome motif-related region Mar1 to enhance ZmAmylase gene expression, operably linked to the maize promoter pZmPG47 of the maize polygalacturonase gene, and operably linked to the spZmbt1 promoter, operably linked to the tassel pollen lethal gene ZmAmylase (cZmAmylase), operably linked to The invention relates to a novel vector comprising a pLP1141-1 promoter and a terminator of the maize In gene (tIn2); a fourth expression cassette comprises the pZmUbi1 promoter of the maize polyubiquitin-1 gene, operably linked to phosphinothricin acetyltransferase (PAT) and operably linked to the transcription terminator (tNos) of nopaline synthase; the vector pLP1141-1 is transformed into Agrobacterium tumefaciens LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) using the liquid nitrogen method, and the transformed cells are screened using phosphinothricin acetyltransferase (PAT) as a selection marker.

[0085] 1.2 Plant Transformation Conventional Agrobacterium infection was used for transformation. Sterile maize (AX808 variety) immature embryos were co-cultured with the Agrobacterium described in Example 1.1 to transfer the T-DNA in the constructed recombinant expression vector pLP1141-1 into the maize chromosome to produce a transgenic maize event.

[0086] For Agrobacterium-mediated transformation of maize, briefly, immature embryos are isolated from maize and contacted with a suspension of Agrobacterium, which is able to transform DsRed, MS45, ZmAmylase and glufosinate-resistant genes pat The nucleic acid sequence is transferred to at least one cell of one of the embryos (step 1: infection step), in which the embryo is immersed in a suspension of Agrobacterium (OD 660= 0.4-0.6, and inoculated with infection medium (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 68.5 g / L sucrose, 36 g / L glucose, 40 mg / L acetosyringone (AS), 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), pH 5.3) for initial inoculation. The immature embryos are co-cultivated with Agrobacterium for a period of three days (Step 2: Co-cultivation Step). Specifically, after the infection step, the immature embryos are cultured on solid medium (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 20 g / L sucrose, 10 g / L glucose, 100 mg / L acetosyringone (AS), 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 8 g / L agar, pH 5.8). This co-cultivation period can be followed by an optional "recovery" step. During the "recovery" step, the recovery medium (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 30 g / L sucrose, 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 3 g / L phytagel, pH 5.8) contains at least one antibiotic (cephalosporin) known to inhibit Agrobacterium growth, and no selective agent for plant transformants is added (Step 3: Recovery Step). Specifically, immature embryos are cultured on solid medium containing antibiotics but no selective agent to eliminate Agrobacterium and provide a recovery period for infected cells. Subsequently, the inoculated immature embryos are cultured on medium containing the selective agent (N-(phosphonomethyl)glycine) to select for growing transformed callus (Step 4: Selection Step). Specifically, immature embryos are cultured on a selective solid medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, N-(phosphonomethyl)glycine 0.25 mol / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, phytagel 3 g / L, pH 5.8) containing a selective agent, resulting in the selective growth of transformed cells. Callus tissue is then regenerated into plants (step 5: regeneration step). Specifically, callus tissue grown on a medium containing a selective agent is cultured on solid media (MS differentiation medium and MS rooting medium) to regenerate plants.

[0087] The resistant calli obtained by screening were transferred to MS differentiation medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzyladenine 2 mg / L, N-(phosphonomethyl)glycine 0.125 mol / L, phytagel 3 g / L, pH = 5.8) and cultured for differentiation at 25°C. The differentiated seedlings were transferred to MS rooting medium (MS salts 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, agar 8 g / L, pH = 5.8), cultured at 25°C to a height of approximately 10 cm, and then moved to a greenhouse for cultivation until fruiting. In the greenhouse, the seedlings were cultured at 28°C for 16 hours and at 20°C for 8 hours each day.

[0088] 1.3 Identification and screening of transgenic events A total of 3,000 independent transgenic T0 plants were generated. After multiple generations of screening for agronomic traits, pollen leakage rate, and copy number, the single-copy LP1141-1 was obtained, which exhibits good agronomic performance, a low pollen leakage rate, and high resistance to glufosinate.

[0089] Example 2 Detection of transgenic maize event LP1141-1 using TaqMan About 100 mg of leaves from the transgenic maize event LP1141-1 were taken as samples, and their genomic DNA was extracted using Qiagen's DNeasyPlantMaxi Kit. The Taqman probe fluorescence quantitative PCR method was used to detect the DsRed, MS45, ZmAmylase and pat The copy number of the gene was quantified. Wild-type maize plants (non-transgenic, recipient-transformed) were used as controls and the assays were performed according to the above method. The experiment was repeated three times and the average value was taken.

[0090] The specific method is as follows: Step 1: 100 mg of leaves from the transgenic maize event LP1141-1 were taken and ground into a homogenate using liquid nitrogen in a mortar and pestle. Three replicates were taken for each sample. Step 2: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. For specific methods, refer to the product manual. Step 3: Determine the genomic DNA concentration of the above samples using NanoDrop 2000 (Thermo Scientific); Step 4: adjusting the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80 to 100 ng / μl; Step 5: Taqman probe fluorescence quantitative PCR method was used to identify the copy number of the sample. The sample with known copy number was used as the standard, and the sample of wild-type corn plant was used as the control. Each sample was repeated 3 times, and the average value was taken. The sequences of the fluorescence quantitative PCR primers and probes were: The following primers and probes were used for detection DsRed Gene sequence: Primer 1: CCTCCTCCGAGAACGTCATC, as shown in SEQ ID NO: 16 in the sequence listing; Primer 2: CCCTCCATGCGCACCTT, as shown in SEQ ID NO: 17 in the sequence listing; Probe 1: CCGAGTTCATGCGCTT, as shown in SEQ ID NO: 18 in the sequence listing; The following primers and probes were used to detect Ms45 Gene sequence: Primer 3: TCTAGCTGATTGATCTCTGGTATTTACC, as shown in SEQ ID NO: 19 in the sequence listing; Primer 4: TCTCCATGGCAAAGCAACTTT, as shown in SEQ ID NO: 20 in the sequence listing; Probe 2: CTTCCTTCAATTCTAAATAC, as shown in SEQ ID NO: 21 in the sequence listing; The following primers and probes were used to detect ZmAmylase Gene sequence: Primer 5: CAAGAGACACGAATAAAGCATCGA, as shown in SEQ ID NO: 22 in the sequence listing; Primer 6: TCCTTGCTCCTCGTCACCAT, as shown in SEQ ID NO: 23 in the sequence listing; Probe 3: CACGACACCATGGCGGCGAC, as shown in SEQ ID NO: 24 in the sequence listing; The following primers and probes were used to detect pat Gene sequence: Primer 7: TTGAGATTAGGCCAGCTAC, as shown in SEQ ID NO: 25 in the sequence listing; Primer 8: TGTGGTGTTTGTGGCTCTGTCCTAA, as shown in SEQ ID NO: 26 in the sequence listing; Probe 4: TAACCATTACATTGAGACGTCTACAGTGAA, as shown in SEQ ID NO: 27 in the sequence listing; The PCR reaction system is: JumpStart TM Taq ReadyMix TM (Sigma) 10 μL; 50× primer / probe mixture 1 μL; 3 μL of genomic DNA; Water (ddH2O) 6 μL; The 50× primer / probe mixture contained 45 μL of each primer at 1 mM concentration, 50 μL of probe at 100 μM concentration, and 860 μL of 1× TE buffer and was stored in amber tubes at 4°C.

[0091] PCR reaction conditions are: Step Temperature Time 21 95℃ 5min; 22 95℃ 30s; 23 60℃ 1min; 24 Return to step 22 and repeat 40 times.

[0092] The data were analyzed using SDS2.3 software (Applied Biosystems), and a single-copy transgenic maize event LP1141-1 was obtained.

[0093] Example 3 Detection of transgenic corn event LP1141-1 3.1 Genomic DNA Extraction DNA extraction was performed according to the conventional CTAB (cetyltrimethylammonium bromide) method: 2 g of young leaves of transgenic maize event LP1141-1 were ground into powder in liquid nitrogen, and then 0.5 mL of DNA extraction CTAB buffer (20 g / L CTAB, 1.4 M NaCl, 100 mM Tris-HCl, 20 mM EDTA (ethylenediaminetetraacetic acid)], adjust the pH to 8.0 with NaOH, mix thoroughly, and extract at 65°C for 90 minutes; add 0.5 times the volume of phenol and 0.5 times the volume of chloroform, mix by inversion; centrifuge at 12000 rpm (revolutions per minute) for 10 minutes; aspirate the supernatant, add 1 volume of isopropanol, gently shake the centrifuge tube, and let it stand at -20°C for 30 minutes; centrifuge at 12000 rpm for another 10 minutes; collect DNA to the bottom of the tube; discard the supernatant, wash the precipitate with 0.5 mL of 70% ethanol; centrifuge at 12000 rpm for 5 minutes; vacuum dry or blow dry in a clean bench; dissolve the DNA precipitate in an appropriate amount of TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0) and store at -20°C.

[0094] 3.2 Analysis of flanking DNA sequences The concentration of the DNA sample extracted above was measured to make the concentration of the sample to be tested between 80-100 ng / μL. Spe I. Pst I. Bss HII (5' end analysis) and Sac I. Kpn I. Xma I. NheI (3' end analysis) genomic DNA was digested separately. 26.5 μL genomic DNA, 0.5 μL of the restriction endonuclease selected above, and 3 μL of digestion buffer were added to each digestion system and digested at an appropriate temperature for 1 hour. After the digestion was completed, 70 μL of anhydrous ethanol was added to the digestion system, ice-bathed for 30 minutes, centrifuged at 12000 rpm for 7 minutes, the supernatant was discarded, and the solution was blown dry. Then, 8.5 μL of double-distilled water (ddH2O), 1 μL of 10× T4 Buffer, and 0.5 μL of T4 ligase were added and ligated at 4°C overnight. PCR amplification was performed using a series of nested primers to separate 5' and 3' transgenic / genomic DNA. Specifically, the primer combination for separating 5' transgenic / genomic DNA includes sequences of SEQ ID NO: 13 and SEQ ID NO: 34 as first primers, sequences of SEQ ID NO: 35 and SEQ ID NO: 36 as second primers, and sequence of SEQ ID NO: 13 as a sequencing primer. The 3' transgene / genomic DNA isolation primer combination included sequences of SEQ ID NO: 15 and SEQ ID NO: 37 as first primers, sequences of SEQ ID NO: 38 and SEQ ID NO: 39 as second primers, and sequence of SEQ ID NO: 15 as a sequencing primer. The PCR steps and reaction mixture conditions for identifying the 5' transgene insert / genomic junction region of transgenic maize event LP1141-1 are shown in Table 3.

[0095] The obtained amplicons were electrophoresed on a 2.0% agarose gel to separate the PCR products, and the target fragments were subsequently isolated from the agarose matrix using a QIAquickGel extraction kit (Catalog # 28704, Qiagen Inc., Valencia, CA). The purified PCR products were then sequenced (e.g., ABI Prism™ 377, PE Biosystems, Foster City, CA) and analyzed.

[0096] Standard PCR methods were used to confirm the 5' and 3' flanking sequences and junction sequences. The 5' flanking and junction sequences can be confirmed using the sequences of SEQ ID NO:8 or SEQ ID NO:12, or in combination with SEQ ID NO:9, SEQ ID NO:13, or SEQ ID NO:34. The 3' flanking and junction sequences can be confirmed using the sequences of SEQ ID NO:11 or SEQ ID NO:14, or in combination with SEQ ID NO:10, SEQ ID NO:15, or SEQ ID NO:37. The PCR reaction system and amplification conditions are shown in Tables 3 and 4. Those skilled in the art will appreciate that other primer sequences can also be used to confirm the flanking and junction sequences.

[0097] DNA sequencing of the PCR products provides DNA that can be used to design other DNA molecules that serve as primers and probes for identification of corn plants or seeds derived from transgenic corn event LP1141-1.

[0098] The maize genomic sequence is found at nucleotides 1-441 of SEQ ID NO: 5, flanking the right border of the insertion sequence of transgenic maize event LP1141-1 (5' flanking sequence), and the maize genomic sequence is found at nucleotides 13768-14241 of SEQ ID NO: 5, flanking the left border of the insertion sequence of transgenic maize event LP1141-1 (3' flanking sequence). The 5' junction sequence is set forth in SEQ ID NO: 1, and the 3' junction sequence is set forth in SEQ ID NO: 2.

[0099] 3.3. PCR zygosity determination Junction sequences are relatively short polynucleotide molecules that are novel DNA sequences that, when detected in a polynucleotide detection assay, are diagnostic for the DNA of transgenic maize event LP1141-1. The binding sequence of SEQ ID NO: 1 consists of 10 bp on either side of the T-DNARB region insertion site of transgenic maize event LP1141-1 and the maize genomic DNA insertion site, while the binding sequence of SEQ ID NO: 2 consists of 10 bp on either side of the T-DNALB region insertion site of transgenic maize event LP1141-1 and the maize genomic DNA insertion site. Longer or shorter polynucleotide junction sequences can be selected from the sequence of SEQ ID NO: 3 or the sequence of SEQ ID NO: 4. The junction sequences (5' junction region sequence of SEQ ID NO: 1 and 3' junction region sequence of SEQ ID NO: 2) are useful as DNA probes or as DNA primer molecules in DNA detection methods. Junction sequences SEQ ID NO: 6 and SEQ ID NO: 7 are also novel DNA sequences in transgenic maize event LP1141-1 and can be used as DNA probes or primers to detect the presence of transgenic maize event LP1141-1 DNA. Sequence SEQ ID NO: 6 (nucleotides 442-980 of SEQ ID NO: 3) spans the LP114-1 construct DNA sequence and the tNos transcriptional termination sequence, while sequence SEQ ID NO: 7 (nucleotides 1-458 of SEQ ID NO: 4) spans the tNos transcriptional termination sequence and the LP114 construct DNA sequence.

[0100] Additionally, amplicons were generated by using primers derived from at least one of the sequences of SEQ ID NO: 3 or SEQ ID NO: 4, which when used in a PCR method produced an amplicon diagnostic for transgenic maize event LP1141-1.

[0101] Specifically, a PCR product was generated from the 5' end of the transgenic insert sequence, comprising a portion of genomic DNA flanking the 5' end of the T-DNA insert sequence from the genome of plant material derived from transgenic maize event LP1141-1. This PCR product comprises SEQ ID NO: 3. For PCR amplification, primer 11 (SEQ ID NO: 8) was designed to hybridize to the genomic DNA sequence flanking the 5' end of the transgenic insert sequence, and primer 12 (SEQ ID NO: 9) was paired with primer 11, which is located at the transgenic tNos transcriptional termination sequence.

[0102] A PCR product was generated from the 3' end of the transgenic insert sequence. This PCR product comprised a portion of genomic DNA from plant material of transgenic maize event LP1141-1 flanking the 3' end of the T-DNA insert sequence. This PCR product comprised SEQ ID NO: 4. For PCR amplification, primer 14 (SEQ ID NO: 11) was designed to hybridize to the genomic DNA sequence flanking the 3' end of the transgenic insert sequence. Primer 13 (SEQ ID NO: 10) was paired with primer 14 to hybridize to the tNos transcriptional terminator sequence located at the 3' end of the insert sequence.

[0103] The DNA amplification conditions described in Tables 3 and 4 can be used in the above-described PCR zygosity assay to generate diagnostic amplicons for transgenic maize event LP1141-1. Detection of the amplicons can be performed using a Stratagene Robocycle, MJ Engine, Perkin-Elmer 9700, or Eppendorf Mastercycler Gradient thermal cycler, or other methods and equipment known to those skilled in the art.

[0104] Table 3 5' transgenic insert / genome for transgenic maize event LP1141-1 PCR steps and reaction mixture conditions for junction region identification

[0105] Table 4 Perkin-Elmer 9700 Thermal Cycler Conditions

[0106] Mix gently and add 1-2 drops of mineral oil to each reaction mixture if there is no insulation cap on the thermal cycler. Use the cycling parameters in Table 4 to perform PCR on a Stratagene Robocycler (Stratagene, La Jolla, CA), an MJ Engine (MJR-Biorad, Hercules, CA), a Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or an Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in a calculated mode. The Perkin-Elmer 9700 thermal cycler should be run with the ramp speed set to maximum.

[0107] The experimental results showed that: primers 11 and 12 (sequence SEQ ID NO: 8 and 9), when used in the PCR reaction of the genomic DNA of the transgenic corn event LP1141-1, produced an amplification product of a 980bp fragment, and when used in the PCR reaction of the untransformed corn genomic DNA and the non-LP1141-1 corn genomic DNA, no fragment was amplified; primers 13 and 14 (sequence SEQ ID NO: 10 and 11), when used in the PCR reaction of the genomic DNA of the transgenic corn event LP1141-1, produced an amplification product of a 932bp fragment, and when used in the PCR reaction of the untransformed corn genomic DNA and the non-LP1141-1 corn genomic DNA, no fragment was amplified.

[0108] PCR zygosity assays can also be used to identify whether material derived from transgenic maize event LP1141-1 is homozygous or heterozygous. Primer 15 (SEQ ID NO: 12), primer 16 (SEQ ID NO: 13), and primer 17 (SEQ ID NO: 14), or primer 16 (SEQ ID NO: 13), primer 17 (SEQ ID NO: 14), and primer 18 (SEQ ID NO: 15) are used in an amplification reaction to generate a diagnostic amplicon for transgenic maize event LP1141-1. The DNA amplification conditions described in Tables 5 and 6 can be used in the above zygosity assays to generate a diagnostic amplicon for transgenic maize event LP1141-1.

[0109] Table 5 Zygosity assay reaction solution

[0110] Table 6 Zygosity determination conditions of Perkin-Elmer 9700 thermal cycler

[0111] PCR was performed on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler using the cycling parameters in Table 6. The MJ Engine or Eppendorf Mastercycler Gradient thermal cyclers should be run in calculated mode. The Perkin-Elmer 9700 thermal cycler should be run with the ramp speed set to maximum.

[0112] In the amplification reaction, the biological sample containing template DNA contains DNA diagnostic for the presence of transgenic maize event LP1141-1 in the sample. Alternatively, the reaction will produce two distinct DNA amplicons from a biological sample containing DNA derived from a maize genome that is heterozygous for the allele corresponding to the inserted DNA present in transgenic maize event LP1141-1. These two distinct amplicons will correspond to a first amplicon derived from a wild-type maize genomic locus and a second amplicon diagnostic for the presence of transgenic maize event LP1141-1 DNA. A maize DNA sample that produces only a single amplicon corresponding to the second amplicon described for a heterozygous genome can be diagnosed for the presence of transgenic maize event LP1141-1 in the sample, and the sample is produced from maize seeds that are homozygous for the allele corresponding to the inserted DNA present in the transgenic maize plant LP1141-1.

[0113] It should be noted that primer pairs specific to transgenic maize event LP1141-1 were used to generate amplicons diagnostic for genomic DNA from transgenic maize event LP1141-1. These primer pairs, including but not limited to primers 11 and 12 (SEQ ID NOs: 8 and 9), and primers 13 and 14 (SEQ ID NOs: 10 and 11), were used in the described DNA amplification method. Additionally, control primers 9 and 10 (SEQ ID NOs: 28 and 29), designed to amplify an endogenous maize gene, were included as an internal standard for reaction conditions. Analysis of DNA extracts from transgenic maize event LP1141-1 should include a positive control DNA extract from transgenic maize event LP1141-1, a negative control DNA extract from a non-transgenic maize event LP1141-1, and a negative control DNA extract from maize without template. In addition to these primer pairs, any primer pair derived from the sequences of SEQ ID NO: 3 or SEQ ID NO: 4, or their complements, which, when used in a DNA amplification reaction, produce an amplicon comprising the sequences of SEQ ID NO: 1 or SEQ ID NO: 2, respectively, that is diagnostic for tissue derived from the transgenic event maize plant LP1141-1 can be used. The DNA amplification conditions described in Tables 3-6 can be used to generate diagnostic amplicons for the transgenic maize event LP1141-1 using the appropriate primer pairs. Extracts of maize plants or seeds that are presumed to contain DNA from the transgenic maize event LP1141-1, or products derived from the transgenic maize event LP1141-1, that produce an amplicon that is diagnostic for the transgenic maize event LP1141-1 when tested in a DNA amplification method, can be used as templates for amplification to determine the presence of the transgenic maize event LP1141-1.

[0114] Example 4 Detection of transgenic maize event LP1141-1 by Southern blot hybridization 4.1 DNA Extraction for Southern Blot Hybridization Southern blot analysis was performed using homozygous transformation events from the T3 and T4 generations. Approximately 5 to 10 g of plant tissue was ground in liquid nitrogen using a mortar and pestle. The tissue was resuspended in 12.5 mL of extraction buffer A (0.2 M Tris pH 8.0, 50 mM EDTA, 0.25 M NaCl, 0.1% v / v β-mercaptoethanol, 2.5% w / v polyvinylpyrrolidone) and centrifuged at 4000 rpm for 10 minutes (2755 g). The supernatant was discarded and the pellet was resuspended in 2.5 mL of extraction buffer B (0.2 M Tris pH 8.0, 50 mM EDTA, 0.5 M NaCl, 1% v / v β-mercaptoethanol, 2.5% w / v polyvinylpyrrolidone, 3% sarkosyl, 20% ethanol) and incubated at 37°C for 30 minutes. During the incubation period, the sample was mixed once with a sterile loop. After incubation, add an equal volume of chloroform / isoamyl alcohol (24:1), mix gently by inversion, and centrifuge at 4000rpm for 20 minutes. Collect the aqueous layer and centrifuge at 4000rpm for 5 minutes to precipitate DNA after adding 0.54 volume isopropanol. Discard the supernatant and resuspend the DNA pellet in 500μL TE. In order to degrade any RNA present, at 37°C, DNA and 1μL 30mg / mL RNAaseA were incubated for 30 minutes, centrifuged at 4000rpm for 5 minutes, and in the presence of 0.5 volume 7.5M ammonium acetate and 0.54 volume isopropanol, precipitate the DNA by centrifugation at 14000rpm for 10 minutes. After discarding the supernatant, wash the pellet with 500μL of 70% ethanol by mass and resuspend it in 100μL TE after drying.

[0115] 4.2 Restriction enzyme digestion Quantify the DNA concentration using a spectrophotometer or fluorometer (using 1×TAE and GelRED dye). Digest 5 μg of DNA at a time in a 100 μL reaction system. Use restriction endonucleases AscI, SwaI, AscI, KpnI, and Hin Digest the genomic DNA with dIII and use the T-DNA DsRed, MS45, ZmAmylase and pat The partial sequence of was used as a probe. For each enzyme, the digest was incubated overnight at the appropriate temperature. The sample was spun down to 30 μL using a speed vacuum.

[0116] 4.3 Gel Electrophoresis Bromophenol blue loading dye was added to each sample from Example 4.2, and each sample was loaded onto a 0.7% agarose gel containing ethidium bromide and separated by electrophoresis in TBE running buffer. The gel was run at 20 volts overnight.

[0117] Wash the gel for 15 minutes in 0.25M HCl to depurinate the DNA, then wash with water. Set up Southern blot hybridization as follows: place 20 thick dry blotting papers in a dish, and place 4 thin dry blotting papers on it. In 0.4M NaOH, pre-wet 1 thin blotting paper and place it on the paper stack, then place 1 Hybond-N+ transfer membrane (Amersham Pharmacia Biotech, #RPN303B) pre-wetted in 0.4M NaOH. The gel is placed on the top to ensure that there are no bubbles between the gel and the membrane. 3 additional pre-soaked blotting papers are placed on the top of the gel and fill the buffer tray with 0.4M NaOH. Connect the gel stack and buffer tray with a wick pre-soaked in 0.4M NaOH and transfer the DNA to the membrane. Carry out DNA transfer for about 4 hours at room temperature. After the transfer, rinse the Hybond membrane for 10 seconds in 2×SSC, and the DNA is bound to the membrane by UV cross-linking.

[0118] 4.4 Hybridization Use PCR to amplify a suitable DNA sequence for probe preparation. The DNA probe is the sequence SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32 and SEQ ID NO:33, or is partially homologous or complementary to the above sequences. Boil 25ng of probe DNA in 45μL TE for 5 minutes, place on ice for 7 minutes, and then transfer to a RediprimeⅡ (AmershamPharmacia Biotech, #RPN1633) test tube. After adding 5μl 32P-labeled dCTP to the Rediprime test tube, incubate the probe at 37°C for 15 minutes. Purify the probe by centrifugation through a microcentrifuge G-50 column (Amersham Pharmacia Biotech, #27-5330-01) according to the manufacturer's instructions to remove unincorporated dNTPs. Measure the probe activity using a scintillation counter. Prehybridize the Hybond membrane by wetting it with 20 mL of pre-warmed Church's prehybridization solution (500 mM Na3PO4, 1 mM EDTA, 7% SDS, 1% BSA) at 65°C for 30 minutes. Boil the labeled probe for 5 minutes and place on ice for 10 minutes. Add an appropriate amount of probe (1 million counts per 1 mL of prehybridization buffer) to the prehybridization buffer and hybridize overnight at 65°C. The next day, discard the hybridization buffer, rinse with 20 mL of Church's wash solution 1 (40 mM Na3PO4, 1 mM EDTA, 5% SDS, 0.5% BSA), and then wash the membrane in 150 mL of Church's wash solution 1 at 65°C for 20 minutes. Repeat this process twice with Church's wash solution 2 (40 mM Na3PO4, 1 mM EDTA, 1% SDS). Expose the membrane to a phosphor screen or X-ray film to detect probe binding sites.

[0119] Two control samples were included on each Southern run: (1) DNA from a negative (untransformed) segregant, which was used to identify any endogenous maize sequences that hybridized to the element-specific probe; and (2) DNA from a positive segregant, in which the Hin The amount of dIII-digested pLP1141-1 was equivalent to one copy number based on the probe length to illustrate the sensitivity of the assay in detecting a single gene copy within the maize genome.

[0120] Hybridization data provide conclusive evidence supporting TaqMan TM PCR analysis showed that maize plant LP1141-1 contained DsRed, ZmMS45, ZmAmylase and pat Single copy of the gene. DsRed probe, Asc I and HinDigestion with dIII produced single bands of approximately 24.249 kb and 4.185 kb, respectively. ZmMS45 probe, Swa I and Hin Digestion with dIII produced double bands of approximately 14.9 kb, 33.9 kb (endogenous) and 12.23 kb, 9.327 kb (endogenous), respectively. Hin Digestion with dIII produced double bands of approximately 24.249 kb, 34.5 kb (endogenous) and 12.23 kb, 5.461 kb (endogenous). pat probe Kpn I and Hin Digestion with dIII produced single bands of approximately 18.695 kb and 12.23 kb, respectively. DsRed, ZmMS45, ZmAmylase and pat Present in maize transformation event LP1141-1.

[0121] Example 5: Creation of Stable Sterile and Maintainer Line Materials Transgenic LP1141-1 plants (female parent) were crossed with heterozygous male sterile ms45 mutants (male parent). The progeny were self-pollinated to obtain maintainer lines with the genotypes LP1141-1 / - and ms45 / ms45, and sterile lines with the genotypes - / and ms45 / ms45. Visual inspection of the maintainer self-pollinated progeny at full maturity revealed that approximately half of the kernels were red (containing the LP1141-1 transgene), while the other half were yellow, consistent with kernels in the non-transgenic control (WT) ear. After threshing, the number of red and yellow kernels in each ear was counted and recorded. The ratio of red to yellow seeds in each ear of ramets was calculated, and the P value was calculated.

[0122] LP1141-1 corn DsRed The gene is expressed using an endosperm-specific expression promoter, making the seeds appear distinctly red, which is significantly different from conventional seeds when observed with the naked eye. The color development of the corn ears obtained by the present invention is as follows: Figure 3 The seeds of LP1141-1 from T2 to T4 generations all showed obvious color differences, with the ratio of red to yellow seeds being approximately 1:1. This phenotype was stably inherited between generations, and the segregation ratio of red to yellow seeds is shown in Table 7.

[0123] Table 7 Analysis of segregation ratio of red seeds in maintainer line progeny

[0124] Example 6 Evaluation of corn fertility restoration effects After harvesting the self-pollinated offspring of the maintainer line with the genotype LP1141-1 / -, / ms45 ms45, the transgenic (red maintainer line) and non-transgenic (yellow, sterile line) seeds were visually distinguished and sown in different areas. When the plants entered the flowering period, their pollen shedding was investigated. The results showed that the plants in the non-transgenic area had no male spikes that could shed pollen, indicating that they were male sterile plants; while the plants in the transgenic area all shed pollen normally. Other agronomic traits between the maintainer line and the sterile line were consistent, and were consistent with those of the control. This confirmed that the transgenic material can restore the fertility of the sterile line plants. The male spike traits of the self-pollinated offspring of the maintainer line obtained by the present invention are as follows: Figure 4 shown.

[0125] Example 7 Pollen Killing Effect Detection Maintainer line seeds were self-pollinated to obtain red seeds of the T2-T4 generations. These seeds were sown and grown in the field until the pollen shedding stage. Pollen viability was assessed using starch potassium iodide staining. Pollen-shedding tassels were bagged and the bags removed the following morning. Three aliquots of transgenic corn pollen and three aliquots of non-transgenic control (WT) pollen were collected. Pollen was evenly sprinkled onto a slide, covered with two drops of KI-I2 (iodine-potassium iodide) solution, and allowed to stand for two minutes. After distinct black pollen grains appeared, the pollen was observed under a microscope. The number of black and yellow pollen grains was counted and recorded for each region. The number of black and yellow pollen grains in each pollen grain was counted, their ratios analyzed, and their P values calculated. The results of the pollen staining data analysis for transgenic LP1141-1 corn plants are shown in Table 8.

[0126] The results showed that about half of the transgenic corn pollen was black (normal, viable non-transgenic pollen), and the other half was yellow (transgenic pollen, inactive, with starch degraded by pollen-specifically expressed ZmAmylase, preventing color development), consistent with Mendel's laws of inheritance. The pollen of the non-transgenic control corn was entirely black. The KI-I2 staining results of the maintainer transgenic corn pollen obtained by the present invention are shown in Figure 1. Figure 5 shown.

[0127] Table 8 Pollen staining data analysis of transgenic LP1141-1 corn plants

[0128] Example 8 Pollen leakage rate detection When transgenic plants reached the pollen shedding stage in the field, artificial cross pollination was performed using the transgenic material LP1141-1 as the male parent and the conventional background material as the female parent. The ear characteristics were then assessed at harvest time. Theoretically, the presence of only one yellow seed in the offspring ear indicates non-transgenic material. The presence of red seeds indicates pollen leakage. Results showed that the majority of the seeds in the T4 maintainer line were yellow (no transgenic seeds from LP1141-1 were present). Pollen leakage rate test results are shown in Table 9.

[0129] Table 9 Pollen leakage rate test results strain Red seeds (visual observation) Yellow seeds Leakage rate LP1141-1 5 781047 0.00064 Example 9 Glufosinate tolerance test This experiment selected the herbicide Glufosinate-ammonium for spraying. A randomized block design was used with 3 replicates. The plot area was 15m 2 The plots were plotted in a 5 m × 3 m plot format with a 60 cm row spacing and a 25 cm plant spacing. Conventional cultivation and management were employed, with 1 m wide isolation strips between plots. Transgenic corn was subjected to two treatments: 1) no spraying; 2) spraying with the herbicide 1600 g ai / ha (four times the recommended dose) at the V3 leaf stage, followed by another spraying with the same dose at the V8 stage. It should be noted that the following conclusions were based on the conversion of different glufosinate herbicide dosages and formulations to equivalent amounts of glufosinate acid. Injury symptoms were assessed one and two weeks after application, and plot yields were measured at harvest. The grading criteria for the degree of glufosinate herbicide damage to corn are shown in Table 10. The herbicide damage rate was used as an evaluation metric to assess herbicide tolerance in transformation events. Specifically, herbicide damage rate (%) = ∑ (number of affected plants in the same class × number of classes) / (total number of plants × highest class); the herbicide damage rate refers to the glufosinate damage rate, determined based on the results of a two-week phytotoxicity survey after glufosinate treatment. Corn yield in each plot was calculated by weighing the total corn kernel yield (by weight) from the three central rows of each plot. Yield differences between treatments were measured as yield percentages (%) = sprayed yield / non-sprayed yield. Results of glufosinate tolerance and yield in the transgenic maintainer corn line are shown in Table 11.

[0130] Table 10 Grading standards for the degree of damage caused by glufosinate herbicide to corn Level of phytotoxicity Symptom description Level 0 No pesticide damage, and the growth is consistent with the clear water control; Level 1 Slightly visible symptoms of drug damage, local color changes, and drug-damaged spots occupying less than 10% of the leaf area; Level 2 Slight growth inhibition or chlorosis, with the phytotoxic spots occupying less than 1 / 4 of the leaf area; Level 3 Significant impact on growth and development, leaf deformity or plant dwarfing or drug-damaged spots occupying less than 1 / 2 of the leaf area Level 4 It has a great impact on growth and development, with severe leaf deformity or obvious dwarfing of the plant or leaf spots less than 3 / 4; Level 5 The drug damage is extremely serious, the plants die or the drug-damaged spots occupy more than 3 / 4 of the leaf area. Table 11 Transgenic maintainer corn tolerance to glufosinate herbicide and corn yield results Project / Plant Maintaining system T2 CK- Glufosinate damage rate (%) 0 0 Glufosinate damage rate (%) (guaranteed to reach 1600 g ai / ha, recommended concentration 400 g ai / ha) 0 100 Yield percentage (guaranteed to reach 1600 g ai / ha, recommended concentration 400 g ai / ha) 102 0 The results showed that in terms of herbicide (glufosinate) damage rate: 1) the damage rate of transgenic maintainer corn plants was basically 0 when treated with glufosinate (1600 g ai / ha), thus, the transgenic maintainer corn plants had good tolerance to glufosinate.

[0131] In terms of yield: there was no significant difference in the yield of the transgenic maintainer corn plants under the two treatments of no spraying and spraying with 1600 g ai / ha of glufosinate. After spraying with glufosinate herbicide, the yield of the transgenic maintainer corn plants did not decrease basically, which further demonstrated that the transgenic maintainer corn plants had good tolerance to glufosinate herbicide.

[0132] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A nucleic acid sequence for detecting transgenic maize event LP1141-1, characterized in that: The nucleic acid sequence is selected from one or more sequences of SEQ ID NO: 1-7 or their complementary sequences, and the nucleic acid sequence is derived from the transgenic corn event LP1141-1. Representative samples of seeds of the transgenic corn event LP1141-1 were deposited in the China Center for Type Culture Collection on April 13, 2025, with the deposit number CCTCC NO: P202511, and the classification name is corn seed LP1141-1 Zea mays L. LP1141-1.

2. A DNA primer pair comprising a first primer and a second primer, characterized in that: The first primer and the second primer, when used together with DNA containing the transgenic corn event LP1141-1 in an amplification reaction, produce an amplicon of the transgenic corn event LP1141-1 in a detection sample; The first primer is selected from the sequence of SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 8 or SEQ ID NO: 12, and the second primer is selected from the sequence of SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 11 or SEQ ID NO: 14; or, The first primer is selected from the sequence of SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 8 or SEQ ID NO: 12, and the second primer is selected from the sequence of SEQ ID NO: 9 or SEQ ID NO: 13; or, The first primer is selected from the sequence of SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 10 or SEQ ID NO: 15, and the second primer is selected from the sequence of SEQ ID NO: 11 or SEQ ID NO:

14.

3. A DNA probe, characterized in that The DNA probe comprises the nucleic acid sequence of claim 1, and the DNA probe hybridizes under stringent hybridization conditions to a DNA molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-7 or their complementary sequences, and does not hybridize under stringent hybridization conditions to a DNA molecule not comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-7 or their complementary sequences; The DNA probe comprises a sequence selected from SEQ ID NO: 3 or its complementary sequence, SEQ ID NO: 4 or its complementary sequence; or The DNA probe comprises a sequence selected from the group consisting of SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence, and SEQ ID NO: 7 or its complementary sequence.

4. A marker nucleic acid molecule, characterized in that The marker nucleic acid molecule comprises the nucleic acid sequence of claim 1, and the marker nucleic acid molecule hybridizes with a DNA molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-7 or their complementary sequences under stringent hybridization conditions, and does not hybridize with a DNA molecule not comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-7 or their complementary sequences under stringent hybridization conditions; The marker nucleic acid molecule comprises a sequence selected from the sequence SEQ ID NO: 3 or its complementary sequence, SEQ ID NO: 4 or its complementary sequence; or, the marker nucleic acid molecule comprises a sequence selected from the sequence SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence and SEQ ID NO: 7 or its complementary sequence.

5. A method for detecting the presence of DNA from transgenic maize event LP1141-1 in a sample, characterized in that: include: (1) contacting a sample to be tested with the DNA primer pair described in claim 2 in a nucleic acid amplification reaction; (2) Performing nucleic acid amplification reaction; (3) Detecting the presence of amplification products; The amplified product includes a nucleic acid sequence selected from SEQ ID NO: 1-7 or a complementary sequence thereof, indicating that the DNA of the transgenic corn event LP1141-1 is present in the test sample.

6. A method for detecting the presence of DNA from transgenic maize event LP1141-1 in a sample, characterized in that: include: (1) contacting a sample to be tested with the DNA probe according to any one of claims 3 and / or the marker nucleic acid molecule according to any one of claims 4; (2) hybridizing the sample to be tested with the probe and / or the marker nucleic acid molecule in step (1) under stringent hybridization conditions; (3) Detecting the hybridization of the sample to be detected with the probe and / or the marker nucleic acid molecule described in step (1).

7. A DNA detection kit, characterized in that include: The DNA primer pair according to claim 2, the DNA probe according to claim 3 and / or the marker nucleic acid molecule according to claim 4.

8. A method for obtaining red maintainer seeds and male sterile materials that can be observed with the naked eye, characterized in that: include: (1) Plant at least one corn seed; The genome of the corn seed sequentially comprises the sequences of SEQ ID NO: 1, the nucleic acid sequence at positions 452 to 13757 of SEQ ID NO: 5, and SEQ ID NO: 2; or the genome of the corn seed comprises the sequence of SEQ ID NO: 5; (2) growing the corn seeds into corn plants; (3) The corn plants are hybridized with male sterile plants and / or the corn plants are sprayed with an effective dose of glufosinate-ammonium herbicide, and the maintainer plants and male sterile plants are harvested as offspring, wherein the maintainer plants include red maintainer seeds and yellow male sterile seeds that can be observed with the naked eye, and the red maintainer seeds that can be observed with the naked eye are cultivated to obtain maintainer materials, and the male sterile materials are screened to obtain them.

9. A method for controlling weeds in a field of corn plants, characterized in that The method comprises applying an effective dose of glufosinate herbicide to a field in which at least one transgenic corn plant is planted, wherein the genome of the transgenic corn plant sequentially comprises the sequences SEQ ID NO: 1, the nucleic acid sequence at positions 452 to 13757 of SEQ ID NO: 5, and SEQ ID NO: 2; or the genome of the transgenic corn plant comprises the sequence SEQ ID NO: 5.

Citation Information

Patent Citations

  • Transgenic maize event LP059-1 and detection method thereof

    CN116732063A

  • Utilization of pericarp color1 (P1) and other anthocyanin genes as seed markers for wheat

    US20230183738A1