Triplophysa siluroides microsatellite marker as well as amplification primer and application thereof

By screening and providing microsatellite molecular markers and their amplification primers, the problem of microsatellite markers of microsatellite markers of microsatellites was solved, and efficient population genetic diversity assessment and population genetic structure analysis were achieved, supporting germplasm resource protection and artificial breeding.

CN120485386APending Publication Date: 2025-08-15GANSU AQUATIC PROD INST
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510638544.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-19
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

At this stage, no screening of microsatellite markers for the proposed catfish plateau loach has been carried out, resulting in insufficient assessment of its germplasm resource and genetic characteristics research, and it is unable to effectively support the protection and artificial breeding of germplasm resources.

Method used

15 microsatellite molecular markers and their amplification primers were screened and provided to evaluate the genetic diversity of the population of phthalidae, including 15 marker sites and corresponding upstream and downstream primer sequences, and genotyping was performed by PCR amplification and capillary electrophoresis.

Benefits of technology

Accurate assessment of the genetic diversity and population genetic structure of the quasi-cat plateau loach population is achieved, providing molecular tools with high polymorphism and high reading accuracy, supporting germplasm resource protection and artificial breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485386A_ABST
    Figure CN120485386A_ABST
Patent Text Reader

Abstract

The invention discloses a triplophysa siluroides microsatellite marker as well as an amplification primer and application of the triplophysa siluroides microsatellite marker. According to the invention, 15 pairs of microsatellite molecular markers with high polymorphism are screened from triplophysa siluroides genome DNA for the first time, so that the problem of blank of triplophysa siluroides microsatellite markers is made up; in the provided 15 microsatellite molecular marker sites, 14 microsatellite molecular marker sites are 4-6 base repeated microsatellite molecular marker sites, slip bands and allele loss are not easy to occur, and during capillary electrophoresis typing, impure peaks are few, allele difference is obvious, reading is accurate, and mutation rate is higher. The microsatellite molecular marker screened by the invention can be used for analyzing the population genetic diversity and population genetic structure of triplophysa siluroides, and can provide a candidate molecular tool for the evaluation of the population genetic diversity of triplophysa siluroides, the development and protection of germplasm resources and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biological DNA markers, in particular to a microsatellite marker of Triplophysa siliqua. The present invention also relates to amplification primers of the microsatellite marker and application in evaluating the genetic diversity of Triplophysa siliqua. Background Art

[0002] The Triplophysa siluroides, commonly known as dogfish, earth catfish, or catfish-like loach, belongs to the order Cypriniformes, family Cobitidae, subfamily Nemacheilinae, and genus Triplophysa. It is the largest species of Cobitidae fish and is primarily found in the mainstream of the Yellow River and its major tributaries in Gansu, Sichuan, and Qinghai. It is endemic to the upper reaches of the Yellow River. In recent years, due to overfishing and ecological degradation, its wild population has rapidly declined. It is listed as vulnerable in the China Red List of Endangered Animals - Fishes and as a Class II protected species in the National List of Key Protected Wildlife. Currently, research on the Triplophysa siluroides primarily focuses on its individual biology, ecology, and muscle nutritional composition, while molecular studies have limited to mitochondrial gene markers.

[0003] Microsatellite markers, also known as simple sequence repeats (SSR) or short tandem repeats (STR), are composed of tandem repeat segments of 2 to 6 nucleotides and are evenly distributed in the genomes of eukaryotic organisms. They have outstanding advantages such as a large number of repeat sequences, relatively rich polymorphism, strong variability, high sensitivity, and easy operation. They are widely used in fish population diversity, genetic structure, genetic map construction, animal paternity testing, genetic breeding, and other aspects.

[0004] Although microsatellite markers have been developed for some other Triplophys species, such as Triplophys slendertail, screening for Triplophys sylvaticus (Triplophys sylvaticus), a Class II protected species, has yet to be conducted due to the poor interoperability of these markers across species. However, to address the challenges facing Triplophys sylvaticus, such as habitat fragmentation and declining resource abundance, an assessment of its germplasm resources is urgently needed. Furthermore, screening for polymorphic microsatellite markers is crucial to further understand the genetic characteristics of different populations and provide relevant genetic background information for subsequent germplasm conservation efforts. Summary of the Invention

[0005] The purpose of the present invention is to provide microsatellite markers and amplification primers of the plateau loach for evaluating the genetic diversity of the plateau loach population, aiming to provide molecular tools for the protection of the germplasm resources of the plateau loach, and at the same time provide technical support for the subsequent artificial breeding, proliferation and release of the plateau loach.

[0006] To achieve its purpose, the present invention adopts the following technical solutions:

[0007] The microsatellite molecular markers for Triplophys siliqua provided by the present invention include 15 marker sites, designated NN01-NN15, and their nucleotide sequences are shown in SEQ ID NOs. 1-15, respectively. Specifically:

[0008] SEQ ID NO.1:

[0009] CACCCACTCCCTCTTTTGCTTTGCTGGATTCTGAAGGTTAAAGGAATAGTCAATCTGTACAAAAGAGAGTCAACGTGTAACAAAGAGGAACCAAGCAGAGAGTAGATCCAAATGGAGTTTATAAATGAAAATGAAAATGAAAATGAAAATGAAAATGAAAATGAAAATGAAAATGAAAATGAAAATGAAAATGAAAATGAAAATGAAAATCCTCGAGCAACACAGGAAC;

[0010] SEQ ID NO.2:

[0011] SEQ ID NO.3:

[0012] AATGCGAAACCAGTGTCCCAGTCGAGGGAATCCATCCAGCTCAACATTCCGCTCCTGTAAGGGCACTTTACACTTGTATGAGAGCTGCCGACTAAAATACTTCACCAGCTTACCCTGAAAAAAAGAAAGAAAGAAAGAAAGTTGTGTTAACAGGATTTAACAGGTTAACAGGTTGTGTATTTGTAGTCAAATCTTTTTGTAAAATGACCATAAAACTCAAATATACTTTGTCCCCCTGTTGGGCTAAGGACTT;SEQ ID NO.4:

[0013] CGGTAGACCTCCGCAAACAATCAATAACTGTTGAGTAGTTTTTAATTAAATAATTTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTA ATTTATAAATTTAATTTAATTTAATTTGTTATGGAGAGCTCTAATCTTAACTTTAGGTCACTGACGCATTGTTTCACATGTTTAGGTACAGATGTGCCATGCATTATGTATGTTAGCTCGTAAATCCCAGTGTGCCG;

[0014] SEQ ID NO.5:

[0015] GAGGAGACAGCACTGCCTACATTGTAGATTGATTGGCTGAGAGGAAAAACAAGAAGAGAGAGAACACGCAAACAATCCAATGAGGTTGAGCGAACTGGCAAATGTTCCGATTCACAGAGGGTGATAGATAGATAGATAGATAGATACTCATCAGGCGCAGCGCTGCTCTTCCGCTCGGAGAGAAAAAGAGGGAGAAACATTTGTGTGACGTGAGTGTGTGTGTGACAGCGTT;

[0016] SEQ ID NO.6:

[0017] GCCCTAACCAAACCCCAACACGTGCAAGACAGTTTTATAGACTGAATTATGAGCCTTTTTTAGTGAGGACCTGTAAAATGTTCTGACAGGTCAGTTGTAATGATAATTCACTGTATTACTAAGGACATTTGG CCCTCACAAATATAGCTCAAATTTGCATGCACTCACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCACACACACACAAACACACTTGATGCCTCGCATGCTTGTGTCAGTGACGCACAGAACCTC;

[0018] SEQ ID NO.7:

[0019] CCTTCATTCCCGTGTCTGCTTGCACTTGGGTTCTTCCCCTTCACATACATACATACATACATACATACATACATATACATACAATACTATAATCCACACCAGACAACTGAACACAAGGGCTATATATACACAGATCATGGGACAGACAGGTAATGAGACACAGTCTCGTTATCATGTATTGTTTTCACCTAAGAATGATGGGTACTGGAGTCCTTACAAAACATAGACAGAACACTGAGTGGAACGGC;SEQ ID NO.8:

[0020] AACGTGTCCGGATAGCAACACAATGCATCATTGTACTCTAAGTTTACACATTGATATATTATTGTACAATTTGAAAAGACGATATACAGCTGGACTCCTGAGATGACCCGAGGTAGTTCGGACAAGCGGTAGAAAATGGATGGATGGATGGATGGATATACAGCTGTGGGAAAAAGTAAGAGACCATGCTGCTTTTAAAAGCATTTGTGCTTGTATTGTGTTGAATTTTTTTAACGGAAACAAACTTCAGGAATGGAAGGATGGATGGAAGGAAGGCA;

[0021] SEQ ID NO. 9:

[0022] CGGTTCAGAACACATAGCCTATTCTATTCTATTCCATTCCATTCCATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATAAAAACATTATTTGTATTATAACAACAACGCCTGTTACTTAATTAACTGAGAAGAAACAGCATCAGTGCAATAAAATAAAAACATACAAACAAAAATCAAAATATTTTAAGTATTCACAGAGTGACATCTAGCGATGTAGTTCATCATCATAGTATGTATAATTATTGAGTTTCTGTCGCTGCC;

[0023] SEQ ID NO.10:

[0024] TGTGTCAGGCTGTGTCGTTTCCGTGTCACATTGCATATCATATCATATCATATCATATCATATCATATCATATCATATCATATCATATCATATCACATCACATCACATCATATAATTTACCGTACCTTGGTGT ATTATATATAAATATCTTATAAATATAGTATCATATTATATCGTACCATATAAATACAGCTTTCCTGTGGCGCAGTGGTTAGAGCACGGCACTAGAAAAGGTCATGGGTTTGGCCCCAGGGGATTGCATGTAG;

[0025] SEQ ID NO.11:

[0026] GGTCTCCCAGACAAAACGTGTTTTTAACAGTTGTATTACATTCAAAACACATTTTGTGTTCAGTTAAGGTGTGTTATTTTATATAATAATAATAATAATAATAATAAGTTTTCATGTTTTGTGTTAACGATGTGTTAAAATTAACATATCCAGTGTATAGTGTAGAAAATAAAATGCTCCCTTGATTATTTCTTCGAGCTTTTGTTACAAATGTAGTATTTTAAGCCAAAATAAATACGTCAATGTCCTCCTTCAAATATCACGGTCAACAGAACTGCT;

[0027] SEQ ID NO.12:

[0028] CCCTTTCTGTCGGTCTCTCGACGTTGTGTCGAAGACTCAACTCAACTCAACTCAACTCAACTCAACTCAACTCAACTTTATTTTTTATAGCTTTTTTTTTACAATTTTCATTGTTACAAAGCAGCTGTACATGAGACGCATTGAATACAAGAAAAACAACTAAAGTCATATACCTGTAAAAACAAGAAAAAGATGAAAACAACAAAAGACAGACATACAAATGCTCCACACACACAATATGCATACATACTTACACACATTGACATAAACGCACACACGC;

[0029] SEQ ID NO.13:

[0030] GGCACAGGTGGACCTCATTTCCCATGATGCATTTCACCCATGACGAACACAGCGGGAGGAGCGTCCCTATTTTTCACTCTCCATTTTTTATATTTACCATATTTATTTATTTATTTATTTGATTTTTCCAGCAGCAGTATGAAGCGCGTTGGCGTCGGGATTATTTAGCATCAGTATTGTGTGACCACTGGAACCTTACGCGTTATTTTACATGACACACACTCTCTCACACACACACACACACACACACCTACAGCAGAGCA;

[0031] SEQ ID NO.14:

[0032] GGGATTGAATGGCTGCAACCTTTTCTCGTTGTGTTTCATGTTTTTTGGCTTTCATGCTGAAAAATAGAAGCCGTGAATAAGAGACTGGAGACAAAGACAGCTGCAACCAGTATCATGAGATATTCACATATCATGTTATTTGGCTGTTGATTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTTTTCTTTCTTTCTTTCTTTATACACTGATCTTTGAGTGACTGCTTTTTTCACCAAGAAAGTTTGAGAAGAGACCTGAGGCAGAAAGACCACA;

[0033] SEQ ID NO.15:

[0034] ATCATCGGCGGTACCCATTCACATCTATTGTATTGTATTGTATTGTATTGTATTGTATTGTATTGTATCTATTGTAAGACGAAAGAAAGAAAGTCATACAGATTTGAAATGAGAAGAGAGCGAGTAAAATAATGACA GAATTTTTTGGGTGAACTATCCCTAAATCCACTAAAAATGACTTTGCGACCTGTTGTTAAAAGTATGAGAAGAAACATATTTCAGCCTAATTTGTTTGCATATACTTAGTGTTGTATTTTGTTATCCAGCGCAGCG.

[0035] The amplification primers for the microsatellite molecular marker of the above-mentioned Triplophys siluriformis provided by the present invention are as follows:

[0036] The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.1 are SEQ ID NO.16-17 respectively;

[0037] The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.2 are SEQ ID NO.18-19 respectively;

[0038] The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.3 are SEQ ID NO.20-21 respectively;

[0039] The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.4 are SEQ ID NO.22-23 respectively;

[0040] The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.5 are SEQ ID NO.24-25 respectively;

[0041] The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.6 are SEQ ID NO.26-27 respectively;

[0042] The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.7 are SEQ ID NO.28-29 respectively;

[0043] The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.8 are SEQ ID NO.30-31 respectively;

[0044] The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.9 are SEQ ID NO.32-33 respectively;

[0045] The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.10 are SEQ ID NO.34-35 respectively;

[0046] The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.11 are SEQ ID NO.36-37 respectively;

[0047] The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.12 are SEQ ID NO.38-39 respectively;

[0048] The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.13 are SEQ ID NO.40-41 respectively;

[0049] The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.14 are SEQ ID NO.42-43 respectively;

[0050] The upstream and downstream primer sequences for amplifying the microsatellite molecular marker with the nucleotide sequence of SEQ ID NO.15 are SEQ ID NO.44-45 respectively.

[0051] The above-mentioned microsatellite molecular markers of Pseudo-catfish can be used to evaluate the genetic diversity of Pseudo-catfish and analyze the genetic structure of Pseudo-catfish populations.

[0052] The above-mentioned microsatellite molecular marker amplification primers for the plateau loach can also be used for the genetic diversity assessment of the plateau loach. The application method comprises the following steps:

[0053] (1) Extract genomic DNA from Triplophysa siliqua and store it at -20°C for future use;

[0054] (2) Microsatellite PCR amplification: using fluorescently labeled primers with SEQ ID NO. 16-45, PCR amplification was performed using the genomic DNA of Triplophysa siliqua obtained in step (1) as a template;

[0055] (3) Amplification product detection: performing capillary electrophoresis and population genetic structure analysis on the amplified products in step (2);

[0056] (4) Genetic diversity analysis: Based on the capillary electrophoresis amplification band information, the amplified products were genotyped and the genetic diversity parameters were calculated.

[0057] Preferably, in the above step (2), the PCR amplification system includes: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, gradient annealing at 62-52°C for 30 s, extension at 72°C for 30 s, and 10 cycles; denaturation at 95°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, and 25 cycles; extension at 72°C for 20 min.

[0058] The present invention also provides a kit for genetic diversity analysis of Triplophysa siliqua, which comprises the primers with the nucleotide sequences of SEQ ID NOs. 16-45.

[0059] The beneficial effects of the present invention are:

[0060] (1) The present invention screened 15 pairs of highly polymorphic microsatellite molecular markers from the genomic DNA of the plateau loach for the first time, filling the problem of a blank microsatellite marker for the plateau loach. (2) Of the 15 microsatellite molecular marker sites provided by the present invention, 14 are microsatellite molecular marker sites with 4-6 base repeats, which are not prone to slip bands and allele loss. During capillary electrophoresis typing, there are few miscellaneous peaks, obvious allele differences, accurate readings, and a higher mutation rate. (3) The microsatellite molecular markers screened by the present invention can be used for the analysis of the genetic diversity and population genetic structure of the plateau loach population, and can provide candidate molecular tools for the evaluation of the genetic diversity of the plateau loach population, the development and protection of germplasm resources, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 Capillary electrophoresis peak diagram of some individuals of Triplophysa siliqua at the WT002 site provided in the examples;

[0062] Figure 2 A K value variation diagram drawn using the ΔK method based on STRUTURE analysis provided in the embodiment;

[0063] Figure 3 The clustering results of the Triplophysa siliqua population by STRUCTURE when the K value is 2 provided in the embodiment. DETAILED DESCRIPTION

[0064] In order to better understand the content of the present invention, the present invention is described in detail through the following specific embodiments in conjunction with the accompanying drawings.

[0065] Example 1: Development of microsatellite markers for Triplophysa siliqua

[0066] (1) Extraction of genomic DNA from Triplophysa siliqua. Genomic DNA from Triplophysa siliqua was extracted using a magnetic bead method animal tissue genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd.) and stored at -20°C for later use.

[0067] (2) Microsatellite locus screening. SRearch software was used to search for microsatellite loci in the genome data of Triplophys sphenodon (NCBI ID: 422203). The search criteria were: microsatellite repeat unit length 3-6 bp, repeat unit number > 5, and microsatellite locus flanking sequence > 300 bp. A 3-6 bp microsatellite locus information library was obtained.

[0068] (3) Primer synthesis and initial screening. From the screened microsatellite locus database, 100 loci with a high number of repetitions were selected. Primers were designed using the software Primer 5.0, resulting in a total of 100 pairs of microsatellite primers. DNA from five randomly selected Triplophysa siliquae was used as templates, and the 100 synthesized microsatellite primer pairs were screened. Forty-five primer pairs were screened that could stably amplify clear target bands.

[0069] (4) Synthesis of typing primers and detection of microsatellite polymorphisms. Fluorescent groups were added to the 5' ends of the forward primers of the 45 primer pairs screened. Genomic DNA from 10 Triplophysa siliqua was amplified by PCR and allelic typing was performed by capillary electrophoresis. Fifteen primer pairs with high polymorphisms were obtained (Table 1).

[0070] Table 1 Microsatellite markers and primers of Triplophysa siliqua

[0071]

[0072] (5) Microsatellite PCR amplification. PCR amplification was performed using modified forward primers and corresponding reverse primers with 38 genomic DNAs of Triplophys siliqua as templates. The PCR amplification system included: pre-denaturation at 95°C for 5 min; 10 cycles of denaturation at 95°C for 30 s, gradient annealing at 62-52°C for 30 s, and extension at 72°C for 30 s; 25 cycles of denaturation at 95°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 30 s; and extension at 72°C for 20 min.

[0073] (6) Genotyping of amplified products. The amplified products were typed using an ABI3730XL genetic analyzer, and the results were analyzed using GeneMarker software to obtain the genotype of each sample. Figure 1 This is the capillary electrophoresis peak diagram of some individuals of Triplophysa sylvaticus at the WT002 site (abscissa: allele size / bp; ordinate: fluorescence intensity). It can be seen that the WT002 site shows a high polymorphism in Triplophysa sylvaticus samples.

[0074] Example 2: Application of microsatellite markers in Triplophysa siliqua

[0075] Using the developed 15 pairs of microsatellite markers and synthesized fluorescent primers labeled with FAM fluorescent dye, capillary electrophoresis was performed on 38 samples of Pseudo-siluriformis. Based on the amplified band information obtained from the 38 Pseudo-siluriformis individuals, the genotypes of the microsatellite loci of the Pseudo-siluriformis individuals were determined. The genetic diversity indicators of the 15 pairs of microsatellite loci of Pseudo-siluriformis were calculated using GenAlEx version 6.501 software, including the number of observed alleles (N a ), effective number of alleles (N e ), Shannon index (I), observed heterozygosity (H o ), expected heterozygosity (H e ) and polymorphism information index (PIC), the results are shown in Table 2.

[0076] Table 215 Genetic diversity analysis results of microsatellite loci

[0077]

[0078]

[0079] The population genetic structure of 38 samples of Triplophysa siliqua was analyzed using STRUCTURE 2.3.4 software. K (number of subpopulations) was set to 1-20, and the burn-in cycle was 1×10 4 , MCMC (Markov Chain Monte Carlo) is set to 1×10 5 Each K value was run 20 times, and the optimal △K value (i.e., the optimal population stratification) was calculated. Based on the optimal K value result, the Clummp results were visualized using Distruct software.

[0080] A total of 149 alleles were observed at 15 microsatellite loci, ranging from 4 to 22, with an average of 9.933. The effective number of alleles ranged from 2.542 to 12.588, with an average of 5.193. The observed heterozygosity ranged from 0.432 to 0.789, with an average of 0.634; the expected heterozygosity ranged from 0.607 to 0.921, with an average of 0.766. The Shannon index ranged from 1.120 to 2.778, with an average of 1.775. The polymorphism information index ranged from 0.559 to 0.915, with an average of 0.735. All primer polymorphism information indices were greater than 0.25, indicating high polymorphism information, indicating that all 15 microsatellite marker pairs were highly polymorphic. Seven of these microsatellite loci deviated from Hardy-Weinberg equilibrium.

[0081] At the same time, 15 pairs of microsatellite markers were used to analyze the population genetic structure of 38 samples of Triplophysa siliqua. According to the principle of maximum likelihood value, when K=2, the △K value is the largest ( Figure 2 ),

[0082] At this time, the 38 samples of Triplophysa siliqua can be divided into two subgroups ( Figure 3 ).

Claims

1. Microsatellite molecular markers of Triplophys siluriformis, characterized in that: The microsatellite molecular marker includes 15 marker sites, which are marked as NN01-NN15, and their nucleotide sequences are shown as SEQ ID NO.1-15 respectively.

2. The amplification primer for the microsatellite molecular marker of Triplophys siluriformis according to claim 1, wherein: The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.1 are SEQ ID NO.16-17 respectively; The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.2 are SEQ ID NO.18-19 respectively; The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.3 are SEQ ID NO.20-21 respectively; The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.4 are SEQ ID NO.22-23 respectively; The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.5 are SEQ ID NO.24-25 respectively; The upstream and downstream primer sequences for amplifying the microsatellite molecular marker with the nucleotide sequence of SEQ ID NO.6 are SEQ ID NO.26-27 respectively; The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.7 are SEQ ID NO.28-29 respectively; The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.8 are SEQ ID NO.30-31 respectively; The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.9 are SEQ ID NO.32-33 respectively; The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.10 are SEQ ID NO.34-35 respectively; The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.11 are SEQ ID NO.36-37 respectively; The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.12 are SEQ ID NO.38-39 respectively; The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.13 are SEQ ID NO.40-41 respectively; The upstream and downstream primer sequences for amplifying the microsatellite marker with the nucleotide sequence of SEQ ID NO.14 are SEQ ID NO.42-43 respectively; The upstream and downstream primer sequences for amplifying the microsatellite molecular marker with the nucleotide sequence of SEQ ID NO.15 are SEQ ID NO.44-45 respectively.

3. Use of the microsatellite molecular marker of Triplophysa siluriformis as claimed in claim 1 in assessing the genetic diversity of Triplophysa siluriformis.

4. Use of the microsatellite molecular marker of Triplophysa siluriformis as claimed in claim 1 in analyzing the genetic structure of Triplophysa siluriformis populations.

5. The use of the microsatellite molecular marker amplification primers of Triplophysa siluriformis as claimed in claim 2 in evaluating the genetic diversity of Triplophysa siluriformis, characterized in that: The application method comprises the following steps: (1) Extract genomic DNA from Triplophysa siliqua and store it at -20°C for future use; (2) Microsatellite PCR amplification: using fluorescently labeled primers with SEQ ID NO. 16-45, PCR amplification was performed using the genomic DNA of Triplophysa siliqua obtained in step (1) as a template; (3) Amplification product detection: performing capillary electrophoresis and population genetic structure analysis on the amplified products in step (2); (4) Genetic diversity analysis: Based on the capillary electrophoresis amplification band information, the amplified products were genotyped and the genetic diversity parameters were calculated.

6. The use of the microsatellite molecular marker amplification primers of Triplophysa siluriformis according to claim 5 in evaluating the genetic diversity of Triplophysa siluriformis, characterized in that: In step (2), the PCR amplification system includes: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, gradient annealing at 62-52°C for 30 s, extension at 72°C for 30 s, and 10 cycles; denaturation at 95°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, and 25 cycles; and extension at 72°C for 20 min.

7. A kit for analyzing genetic diversity of Triplophysa siliqua, characterized in that: Comprising the amplification primers as described in claim 2.