SgRNA of targeted pig PKHD1 gene locus and application of sgRNA

Abstract

The invention discloses sgRNA of a targeted pig PKHD1 gene locus and application of the sgRNA, and belongs to the technical field of gene editing engineering. The invention designs a long-fragment PKHD1 gene knockout method based on a CRISPR / Cas9 system, and particularly, by screening gRNA targets, it is found that efficient deletion of genes larger than 18,000 bp can be achieved when a sequence at the starting position of a PKHD1 exon 10 and the tail end of a PKHD1 exon 19 is targeted. The method is expected to efficiently delete related gene segments in porcine fibroblasts, and has great potential in ARPKD related research.

Description

Technical Field

[0001] The present invention relates to an sgRNA targeting the porcine PKHD1 locus and an application thereof, belonging to the technical field of gene editing. Background Art

[0002] Autosomal recessive polycystic kidney disease (ARPKD) is a fibrocystic renal and hepatic disease characterized by bilateral renal enlargement and hepatic fibrosis. ARPKD is primarily caused by mutations in the polycystic kidney and hepatic disease 1 (PKHD1) gene, which encodes a single-pass transmembrane receptor-like protein, fibrocystin (FPC). FPC consists of a transmembrane domain, an extensively and heavily glycosylated extracellular N-terminal domain, and a C-terminal cytoplasmic tail.

[0003] Research suggests that FPC may act as a membrane receptor-like protein, transmitting extracellular signals into cells by binding to and regulating the calcium-mediated pathway of TRPP2 (PKD2), thereby regulating the differentiation, proliferation, polarization, and migration of epithelial cells in various ducts throughout the body, thereby contributing to the formation of various physiological ducts. However, the precise function of FPC and the specific pathogenesis of ARPKD caused by PKHD1 gene mutations remain unclear. Therefore, to further understand the mechanisms by which this gene contributes to disease progression, numerous studies have established animal models with PKHD1 gene mutations. However, most PKHD1 knockout mouse models currently lack ARPKD phenotypes, and only one rat model exhibits a renal phenotype. Traditional CRISPR / Cas9 technology is commonly used for the insertion and deletion of single or multiple genes, but its application to the deletion of genes larger than 18 kb is not mature. Furthermore, miniature pigs have become one of the most important experimental animal species due to their similarity to humans. Their small size makes them easy to manipulate, and their close physiological and anatomical similarities to humans have led to their widespread use in disease modeling and xenotransplantation. To this end, the present invention conducted PKHD1 knockout experiments in miniature pigs, hoping to establish a method for efficiently, accurately, and effectively deleting PKHD1, thereby generating an animal disease model with an ARPKD phenotype. This has important implications for studying the function of this gene in mammals and for pig breeding. Summary of the Invention

[0004] To address the above problems, the present invention provides a high-efficiency long-fragment deletion vector based on the CRISPR / Cas9 system, which includes a long gene fragment of at least 18,000 bp designed according to the sgRNA target site; this vector can efficiently and conveniently delete long genes while reducing damage to transfected cells.

[0005] The first object of the present invention is to provide an sgRNA combination for knocking out a long fragment of the PKHD1 gene, wherein the sgRNA combination comprises a nucleotide sequence as shown in SEQ ID NO.1-2.

[0006] SEQ ID NO. 1 is gRNA3: 5′-CTTCTTTGATAACCCTGCCC-3′;

[0007] SEQ ID NO.2 is gRNA5: 5′-CCTGCCTTTGTCTCCGGAGA-3′.

[0008] The second object of the present invention is to provide a recombinant expression vector containing the sgRNA combination.

[0009] The third object of the present invention is to provide a gene editing system for knocking out the gene PKHD1, wherein the gene editing system comprises an expression frame of the sgRNA combination and a Cas9 nuclease expression frame.

[0010] The fourth object of the present invention is to provide a recombinant cell treated with the gene editing system.

[0011] Furthermore, the gene editing system is used to knock out the gene PKHD1 in fibroblasts.

[0012] Furthermore, the sequence in the PKHD1 gene of the recombinant cell is changed from SEQ ID NO. 3 before editing to one of SEQ ID NO. 4-6 after editing.

[0013] Wild type sequence:

[0014] SEQ ID NO.3:

[0015] TTATAGGAGACTTCTTTGATAACCCTGCCCAGGCCTGCCTTTGTCT CCGGAGATGGGCGTGTTCTC;

[0016] After deleting the sequence:

[0017] SEQ ID NO.4:

[0018] TTATAGGAGACTTCTTTGATAACCCTGAGATGGGGCGTGTTCTC;

[0019] SEQ ID NO.5:

[0020] TTATAGGAGACTTCTTTGATGTTCTC;

[0021] SEQ ID NO.6:

[0022] TTATAGGAGACTTCTTTGATAACCCGGAGACAAAGGCAGGAGGACAATCTGATGAACCAGCACTGAGGAGTTCACAGGAGGTGGCTGGATGGGCGTGTTCTC.

[0023] The fifth object of the present invention is to provide a method for knocking out the gene PKHD1 in vivo or in vitro, using the gene editing system for knockout.

[0024] Furthermore, in vitro refers to gene knockout in cells.

[0025] The sixth object of the present invention is to provide a PKHD1 gene knockout model, comprising the recombinant cell.

[0026] The seventh object of the present invention is to provide the application of the sgRNA combination, recombinant expression vector, gene editing system, recombinant cell or PKHD1 gene knockout model in biomedical research related to autosomal recessive polycystic kidney disease.

[0027] Beneficial effects of the present invention:

[0028] By screening gRNA targets, the present invention found that targeting a sequence at the beginning of PKHD1 exon 10 and the end of PKHD1 exon 19 can achieve efficient PKHD1 long fragment (>18,000bp) gene deletion, which will contribute to the development of ARPKD-related research and the exploration of its mechanism. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of pX459 plasmid.

[0030] Figure 2 Schematic diagram of the PKHD1 gene and the positions of the F1 / R1 and F2 / R2 primers.

[0031] Figure 3 Schematic diagram of pX459-gRNA-1 / 2 / 3 / 4 / 5 / 6 plasmids.

[0032] Figure 4The knockout efficiency of different gRNA combinations was verified.

[0033] Figure 5 The genotype identification results of some cells.

[0034] Figure 6 Schematic diagram of long fragment deletion for cloning point.

[0035] Figure 7 This is the cell confluence state before freezing. DETAILED DESCRIPTION

[0036] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0037] Example 1: Construction of gene deletion vector

[0038] The vector used is the gRNA cloning vector pX459 driven by the U6 promoter (see Figure 1 We designed gRNAs targeting both ends of the porcine locus, among which gRNA1 (5'-CTATCTGTGTTTCCAGAAAC-3'), gRNA2 (5'-TGGGGGAAGAACAGACATCA-3'), and gRNA3 (5'-CTTCTTTGATAACCCTGCCC-3') targeted the sequences at the start of PKHD1 exon 10, 5'-GTTTCTGGAAACACAGATAG-3', 5'-TGATGTCTGTTCTTCCCCCA-3', and 5'-GGGCAGGGTTATC AAAGAAG-3'; gRNA4 (5'-CAGTGCTGGTTCATCAGATT-3'), gRNA5 (5'-CCTGCCTTTGTCTCCGGAGA-3'), and gRNA6 (5'-GGAGATGGGCGTGTTCTCTG-3') target the sequences at the end of PKHD1 exon 19, 5'-AATCTGATGAACCAGCACTG-3', 5'-CCATCTCCGGAGACAAAGGC-3', and 5'-CCACAGAGAACACGCCCATC-3', respectively.

[0039] See Figure 2 .

[0040] First, the pX459 vector was linearized using BbsI restriction endonuclease, and then the primers gDNA-PKHD1-F1: 5'-caccgCTATCTGTGTTTCCAGAAAC-3' and gDNA-PKHD1-R1: 5'-aaacGTTTCTGGAAACACAGATAGc-3' were annealed to construct the pX459-gRNA-1 vector; the primers gDNA-PKHD1-F2: 5'-caccgTGGGGGAAGAACAGACATCA-3' and gDNA-PKHD1-R2: 5'-aaacTGATGTCTGTTCTTCCCCCAc-3' were annealed to construct the pX459-gRNA-2 vector. The pX459-gRNA-3 vector was constructed by annealing primers gDNA-PKHD1-F3: 5'-caccgCTTCTTTGATAACCCTGCCC-3' and gDNA-PKHD1-R3: 5'-aaacGGGCAGGGTTATCAAAGAAGc-3'. The pX459-gRNA-4 vector was constructed by annealing primers gDNA-PKHD1-F4: 5'-caccgCAGTGCTGGTTCATCAGATT-3' and gDNA-PKHD1-R4: 5'-aaacAATCTGATGAACCAGCACTGc-3'. The pX459-gRNA-5 vector was constructed by annealing primers gDNA-PKHD1-F5: 5'-caccgCCTGCCTTTGTCTCCGGAGA-3' and gDNA-PKHD1-R5: 5'-aaacTCTCCGGAGACAAAGGCAGGc-3'. The pX459-gRNA-6 vector was constructed by annealing primers gDNA-PKHD1-F6: 5'-caccgGGAGATGGGCGTGTTCTCTG-3' and gDNA-PKHD1-R6: 5'-aaacCAGAGAACACGCCCATCTCCc-3'. The schematic diagram of pX459-gRNA-1 / 2 / 3 / 4 / 5 / 6 is shown in Figure 3 .

[0041] Example 2: Testing of knockout efficiency of different gRNA combinations

[0042] Porcine fibroblasts were revived and passaged in 6-well plates, ultimately with 6 wells for electroporation efficiency verification. When the cell confluence reached 80%, PFFs were electro-transfected using Lonza 4D-Nucleofector. The plasmids electro-transfected in each well were a combination of two pX459-gRNAs, namely 3 μg pX459-gRNA-1 and 3 μg pX459-gRNA-4, 3 μg pX459-gRNA-1 and 3 μg pX459-gRNA-5, 3 μg pX459-gRNA-1 and 3 μg pX459-gRNA-6, 3 μg pX459-gRNA-2 and 3 μg pX459-gRNA-4, 3 μg pX459-gRNA-2 and 3 μg pX459-gRNA-5, 3 μg pX459-gRNA-2 and 3 μg pX459-gRNA-6, and 3 μg pX459-gRNA-3 and 3 μg pX459-gRNA-4. pX459-gRNA-4, 3 μg pX459-gRNA-3 and 3 μg pX459-gRNA-5, 3 μg pX459-gRNA-3 and 3 μg pX459-gRNA-6, which are hereinafter referred to as gRNA1+4, gRNA1+5, gRNA1+6, gRNA2+4, gRNA2+5, gRNA2+6, gRNA3+4, gRNA3+5, and gRNA3+6 (Example 3: Culture and transfection of porcine fetal fibroblasts; no screening step). After 3 days, genomic DNA was extracted using a Genomic DNA Purification Kit (EZBioscoence), and then PCR detection was performed using a high-fidelity polymerase (Thermo Fisher Scientific). The primers used to detect long gene deletions were F1: 5'-GCTTACCTTCTTTTCTCCTCTTGC-3' and R1: 5'-ACTAGGACTATTGAGACCAACTGT-3'; the primers used to detect intact long gene deletions were F2: 5'-TGCTACAGCAACTGGCAGAA-3' and R2: 5'-TGGTGGCCCCATCACAATAC-3'. F1 / R1 flank the designed gRNA1 and gRNA2 sites, with a long PKHD1 gene fragment spanning exons 10 to 19 between them. F2 / R2 were designed based on a 231-bp fragment of the PKHD1 gene.If the long PKHD1 gene fragment is not deleted, the F1 / R1 primers cannot fully amplify the template due to their large amplification span, resulting in no specific bands. However, the F2 / R2 primers can amplify specific bands of a certain size, such as gRNA1+4 (320bp), gRNA1+5 (281bp), gRNA1+6 (266bp), gRNA2+4 (335bp), gRNA2+5 (296bp), gRNA2+6 (281bp), gRNA3+4 (382bp), gRNA3+5 (343bp), and gRNA3+6 (328bp). If the long PKHD1 gene fragment is deleted, the F1 / R1 primers can amplify specific bands, while the F2 / R2 primers will not. A schematic diagram of the PKHD1 gene and the locations of the F1 / R1 and F2 / R2 primers are shown in the figure. Figure 2 (Same as Example 4: Detection of gene modification and exogenous gene integration). The grayscale value analysis of nucleic acid electrophoresis photos was performed using Fiji software. The results of nucleic acid electrophoresis showed that when gRNA1+5, gRNA3+5, and gRNA3+6 were used for efficiency verification, the F2 / R2 primers had visible amplification bands, and gRNA3+5 had the highest knockout efficiency, about 23.97%. Therefore, this gRNA combination was subsequently used for formal gene knockout experiments. The nucleic acid electrophoresis diagram for efficiency verification is shown in Figure 4 , where M represents a protein molecular weight marker, - represents the negative control group, and WT represents the wild-type group. gRNA1+3 indicates that PFFs cells were co-transfected with pX459-gRNA-1 and pX459-gRNA-3 or gRNA1 plasmids for gene editing. All other parameters are the same as above. F1 / R1 and F2 / R2 represent PCR amplification of gene-edited cell DNA using primers F1 / R1 and F2 / R2, respectively. Bands represent amplification results.

[0043]

[0044]

[0045] Example 3: Culture, transfection and screening of porcine fetal fibroblasts

[0046] Porcine fetal fibroblasts (PFFs) were isolated from 32-day-old male Chinese laboratory miniature pig embryos. These primary cells were cultured in high-glucose Dulbecco's Medium Eagle's medium (Gibco, Gaithersburg, DE, USA) supplemented with 20% fetal bovine serum (FBS, Gibco).

[0047] All animal experiments were performed according to the guidelines established by the Chinese Animal Care and Protocol Committee and approved by the Laboratory Animal Welfare Committee of Zhejiang University (Zhejiang Province, China).

[0048] PFFs were transfected with 3 μg of pX459-gRNA-3 and 3 μg of pX459-gRNA-5 using a Lonza 4D-Nucleofector. The day before transfection, PFFs were thawed and cultured. Transfection was then performed using 82 μL of PS solution and 18 μL of supplement using electroporation reagent at DO-113 parameters, resulting in approximately 1×10 6 PFFs cells. Since both pX459-gRNA-3 and pX459-gRNA-5 vectors carry Puro R Because the cells are resistant, puromycin antibiotics are used for subsequent screening. 24 hours after transfection, the monoclonal limiting dilution method is used for cell screening: the cells are plated in a 96-well plate at 50 cells / well. After 24 hours, the cells are cultured in DEME containing 3μg / mL puromycin and 20% FBS for 3 days, and then the DEME medium containing 20% FBS without puromycin is replaced until a single cell clone point grows. Then a single cell clone point is selected and cultured in a 24-well plate. When a clone point appears in the 24-well plate, it is digested and transferred to a 6-well plate for continued culture. The remaining small amount of cells continues to grow in the 24-well plate, and the genome is subsequently extracted to identify mutations. When the cells transferred to the 6-well plate reach confluence, they are frozen and preserved and can be used for subsequent somatic cell nuclear transplantation operations.

[0049] Example 4: Detection of gene modification and exogenous gene integration

[0050] Genomic DNA was extracted using a Genomic DNA Purification Kit (EZBioscoence), and PCR was performed using a high-fidelity polymerase (Thermo Fisher Scientific). The primers for detecting long gene deletions were F1: 5'-GCTTACCTTCTTTTCTCCTCTTGC-3' and R1: 5'-ACTAGGACTATTGAGACCAACTGT-3'; the primers for detecting intact long gene deletions were F2: 5'-TGCTACAGCAACTGGCAGAA-3' and R2: 5'-TGGTGGCCCCATCACAATAC-3'.

[0051] Pure water was used as a negative control. If the positive cell clones were homozygous, a 343 bp band would be detected when using primers F1 / R1 for PCR amplification, but no band would be detected when using primers F2 / R2 for PCR amplification. If the positive cell clones were heterozygous, a 343 bp and 231 bp band would be detected when using primers F1 / R1 and F2 / R2 for PCR amplification, respectively. Figure 5 , where M is the protein molecular standard, - is the negative control group, and the others are the cell sample numbers (all PFFs) that need to be genotyped. From the results, we can see that B1, B2, B3, and C1 are PKHD1 gene long fragment deletion heterozygotes, that is, PKHD1 + / - It is noteworthy that when B2 cells were amplified using the F1R1 primer, two target bands were found between 250 and 500 bp, suggesting that B2 cells were not monoclonal but rather grew from multiple cells with different genotypes.

[0052] After about 3 days of screening, at least 4 correct long fragment deletion clones were identified among the 10 clones, and the genotype was PKHD1 + / - The deletion rate was 40%. The clones were cryopreserved and used as donor cells for somatic cell nuclear transfer. The wild-type PKHD1 locus sequence is 5'-TTATAGGAGA CTTCTTTGATAACCCTGCCC AGG— / / —CCTGCCTTTGTCTCCGGAGATGGGCGTGTTCTC-3'. After sequencing, the site sequence after deleting several cloning sites was: 5'-TTATAGGAGA CTTCTTTGATAACC CTG AGATGGGCGTGTTCTC-3';5'-TTATAGGAGA CTTCTTTGAT GTTCTC-3';5'-TTATAGGAGA CTTCTTT GATAACCC GGAGACAAAGGCAGGAGGACA ATCTGATGAACCAGCACTGAGGAGTTCACAGGAGGTGGCTGGATGGGCGTGTTCTC-3'. The schematic diagram of the long fragment deletion of the four positive clones is shown in Figure 6 The cell confluence status before freezing of positive clones can be seen in Figure 7 .

[0053] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will appreciate that other variations or modifications can be made based on the above description. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. A sgRNA combination for knocking out a long fragment of the PKHD1 gene, characterized in that: The sgRNA combination comprises a nucleotide sequence as shown in SEQ ID NO.1-2.

2. A recombinant expression vector containing the sgRNA combination according to claim 1.

3. A gene editing system for knocking out the gene PKHD1, characterized in that: The gene editing system comprises an expression cassette of the sgRNA combination of claim 1 and a Cas9 nuclease expression cassette.

4. A recombinant cell treated with the gene editing system according to claim 3.

5. The recombinant cell according to claim 4, characterized in that Host cells of the recombinant cells include animal cells.

6. The recombinant cell according to claim 4, characterized in that The gene PKHD1 was knocked out in fibroblasts using a gene editing system.

7. The recombinant cell according to claim 4, characterized in that The sequence in the PKHD1 gene of the recombinant cell is edited from SEQ ID NO. 3 before editing to one of SEQ ID NO. 4-6.

8. A method for knocking out the PKHD1 gene in vivo or in vitro, characterized in that: Knockout is performed using the gene editing system described in claim 3.

9. A PKHD1 gene knockout model, characterized in that: The invention also comprises the recombinant cell according to any one of claims 4 to 7.

10. Use of the sgRNA combination of claim 1, the recombinant expression vector of claim 2, the gene editing system of claim 3, the recombinant cell of any one of claims 4 to 7, or the PKHD1 gene knockout model of claim 9 in biomedical research related to autosomal recessive polycystic kidney disease.

Images