Afatinib derivative-nucleic acid aptamer pincer type capture probe as well as preparation method and application thereof
By designing afatinib-nucleic acid aptamer "clamp" capture probe, the covalent binding of afatinib to the inner part of the EGFR membrane and the high specific binding of the nucleic acid aptamer to the outer part of the membrane is solved, and the stability and efficiency of nucleic acid aptamer is achieved in capturing exosomes, achieving efficient and sensitive detection of exosomes, meeting the detection needs of early cancer screening.
Patent Information
- Application Number
- CN202510676061.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-24
- Publication Date
- 2025-08-19
AI Technical Summary
Existing nucleic acid aptamers have poor stability when capturing exosomes, resulting in low capture efficiency and difficult to meet the detection needs of early cancer screening. Especially when the exosome membrane protein content is low in early tumor patients, missed and missed detection is likely to occur.
A "clamp" capture probe of afatinib-nucleic acid aptamer was designed. By increasing the number of several bases at the 5' end of the aptamer, the spacing between afatinib and nucleic acid aptamer can be increased, so that it can stably recognize and bind to the intra-membrane and extra-membrane sites of the EGFR protein. Afatinib is used to covalently bind the inner part of the EGFR membrane, and the high specific binding of the nucleic acid aptamer to its outer part is formed to form a "close-close" structure to improve the capture efficiency.
It improves the capture efficiency and detection sensitivity of exosomes, enhances the stability and capture efficiency of nucleic acid aptamers, realizes sensitive and specific detection of exosomes, and provides a simple and sensitive detection method for cancer diagnosis.
Smart Images

Figure CN120505319A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of small molecule drug synthesis and nucleic acid aptamer research, and particularly relates to an afatinib-nucleic acid aptamer clamp capture probe and a preparation method and application thereof. Background Art
[0002] Liquid biopsy technology, using exosomes as biomarkers, offers the potential for large-scale early cancer screening and is becoming a research hotspot and trend. Exosomes are lipid bilayer vesicles actively secreted by cells and contain parent cell-specific biomarkers, such as miRNAs, proteins, and lipids. These vesicles are closely associated with the development, progression, and metastasis of tumors, and can serve as a "biomarker library" for multi-dimensional tumor diagnosis. However, the true application of exosomes in clinical cancer early screening currently faces a critical bottleneck: exosome capture, specifically how to efficiently and specifically capture tumor-derived exosomes from complex clinical samples.
[0003] The highly sensitive capture of exosomes relies on recognition probes at the sensing interface. Aptamers have a wide range of applications due to their broad target molecule range, low cost, ease of modification, and programmability. Currently, aptamers with strong and stable binding sites in the extracellular domain have been successfully screened for a variety of membrane proteins highly expressed on the surface of tumor exosomes, such as epithelial cell adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR), and human epidermal growth factor receptor 2 (HER-2). These aptamers are then immobilized on substrates such as magnetic beads and electrodes, enabling the precise capture of exosomes from complex clinical samples.
[0004] However, the selected aptamers can only bind to a single region of the membrane protein, resulting in poor stability. During the subsequent elution step, they may be dislodged due to washing, resulting in low capture efficiency. In particular, the levels of exosome membrane proteins (such as EpCAM, EGFR, and HER-2) in patients with early-stage cancer are low. This low capture efficiency can easily lead to subsequent detection sensitivity failing to meet the requirements of early cancer screening, leading to missed and false positives. Therefore, further improving the stability and capture efficiency of aptamers is crucial for improving the detection rate of early cancer screening. By increasing the number of aptamer recognition targets, allowing them to bind to target proteins at multiple sites, and strengthening the binding force between the two, the capture efficiency of exosomes can be improved. Advances in the research of small molecule targeted drugs offer a solution to this problem. Summary of the Invention
[0005] The present invention aims to provide an afatinib-aptamer "clamp-type" capture probe, its preparation method, and its application. EGFR is a transmembrane protein that, within exosomes, consists of three domains: the extracellular domain, the transmembrane domain, and the intracellular domain. Considering that the thickness of the exosome membrane itself is approximately 3-5 nm, if the distance between the aptamer and afatinib is too small, the probe's capture efficiency will be reduced. Therefore, the distance between the two recognition elements needs to be increased to achieve optimal capture efficiency. By adding several bases to the 5' end of the aptamer, the distance between the aptamer and afatinib is increased, thereby enabling the afatinib-aptamer probe to stably recognize and bind to both intra- and extra-membrane sites of the EGFR protein.
[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: An afatinib-nucleic acid aptamer clamp-type capture probe is provided. The afatinib-nucleic acid aptamer "clamp-type" capture probe consists of a connecting portion, an extramembrane recognition portion, a spacer portion, and an intramembrane recognition portion. The connecting portion is a thiol-modified single-stranded DNA, which is combined with the surface of an SPR sensor chip via an Au-S bond to achieve connection between the capture probe and the SPR sensor. The extramembrane recognition portion is a nucleic acid aptamer, the intramembrane recognition portion is afatinib, and the spacer portion is a single-stranded DNA. The intramembrane and extramembrane recognition portions are covalently linked. The sequence of the single-stranded DNA consists of 5 to 25 consecutive identical bases.
[0007] Furthermore, the structure of the afatinib derivative is as follows: , R1 and R2 are one of F, Cl, OCH3, NH2, CN, OH, and NO2.
[0008] Furthermore, the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO: 1.
[0009] Preferably, the sequence of the thiol-modified single-stranded DNA is TTTTTTTTTTTTTTT-SH.
[0010] Preferably, the sequence of the spacer portion of the single-stranded DNA is TTTTTTTTTT.
[0011] The preparation method of the afatinib-nucleic acid aptamer clamp capture probe comprises the following steps: Mix 10 μL of 5'-end azide-modified aptamer aqueous solution with 100-150 μL of AF in DMF solution in a centrifuge tube. Wrap the centrifuge tube with tin foil and stir in the dark at 4°C for 12 h. After the reaction is completed, add dd H2O to the reaction solution to a total volume of 250-500 μL. Pass the reaction solution through an aqueous filter membrane, and separate and purify the product by preparative high-performance liquid chromatography.
[0012] Furthermore, the concentration of the nucleic acid aptamer aqueous solution is 100 μM.
[0013] Furthermore, the concentration of the AF DMF solution is 1 μM.
[0014] Furthermore, the purification conditions under the high performance liquid chromatography separation are C18 column; flow rate: 2.0 mL / min; mobile phase A: 0.1 MTEAA; mobile phase B: acetonitrile; 65% B, 30 min; detection wavelength: 260 nm; column temperature: 25°C.
[0015] Application of the above-mentioned afatinib-aptamer clamp capture probe in detecting MDA-MB-231 exosomes.
[0016] An SPR sensor comprises the afatinib-nucleic acid aptamer clamp capture probe.
[0017] The present invention also includes the design and fitting of afatinib-nucleic acid aptamer probes: (1) Molecular docking of afatinib derivatives (2) Establishment of a three-dimensional model of nucleic acid aptamers (3) Molecular docking of nucleic acid aptamers and EGFR protein and analysis of binding sites.
[0018] Compared with the prior art, the present invention has the following advantages: (1) The present invention synthesizes an afatinib-aptamer "clamp-type" capture probe, which utilizes the covalent binding of afatinib to the intramembrane portion of EGFR and the highly specific binding of the aptamer to its extramembrane portion, simulating the "crab claw" to form a "ring buckle" structure, firmly anchoring the exosomes and achieving exosome detection. In this method, the modification of afatinib can improve the ability of the aptamer to resist enzyme degradation and enhance its stability in serum samples. At the same time, the aptamer can also improve the targeting of afatinib. The two promote each other, complement each other's strengths, give full play to the advantages of the "combination punch", maximize the capture efficiency of exosomes and improve the sensitivity and specificity of detection.
[0019] (2) Compared with the aptamer alone, the synthesized afatinib-aptamer "clamp" capture probe of the present invention has enhanced binding ability to MDA-MB-231 cells. The present invention provides a capture probe with dual recognition sites, which is expected to achieve sensitive and specific detection of exosomes, providing a simple, sensitive, and specific detection method for cancer diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1Design and docking results of afatinib derivative AF; in the figure: (A) docking result diagram of EGFR protein and afatinib; (B) docking result diagram of EGFR protein and DBCO-modified afatinib derivative.
[0021] Figure 2 (A) and (B) are surface binding models of TuTu22 aptamer and EGFR extracellular segment protein. The residues in the GFR protein are colored cyan, the bases in the aptamer are colored rose pink, and the yellow dotted lines represent hydrogen bond interactions.
[0022] Figure 3 This is the binding site between the TuTu22 aptamer and the EGFR extracellular segment protein. The residues in the EGFR protein are colored cyan, the bases in the aptamer are colored rose pink, and the yellow dotted lines represent hydrogen bond interactions.
[0023] Figure 4 This is the H NMR spectrum of DBCO-modified afatinib derivative (AF).
[0024] Figure 5 Mass spectrum of DBCO-modified afatinib derivative (AF).
[0025] Figure 6 This is the mass spectrum of the afatinib-nucleic acid aptamer probe (AF-TuTu22).
[0026] Figure 7 This is a flow cytometry experiment diagram of afatinib-nucleic acid aptamer targeted binding.
[0027] Figure 8 Feasibility analysis of SPR sensing for exosome detection; (A) AF-TuTu22 probe: (a) Blank; (b) AF-TuTu22; (c) AF-TuTu22+MCH; (d) AF-TuTu22+MCH+exosomes; (B) TuTu22 probe: (e) Blank; (f) TuTu22; (g) TuTu22+MCH; (h) TuTu22+MCH+exosomes.
[0028] Figure 9 Results of the investigation on capture efficiency; (A) Total amount of exosomes captured by TuTu22 and (B) AF-TuTu22 at different times; (C) Comparison of capture efficiency of TuTu22 and AF-TuTu22 probes (*** p < 0.001; two-tailed t test).
[0029] Figure 10 Sensitivity analysis results of the detection method; (A) AF-TuTu22; (B) TuTu22.
[0030] Figure 11 The specificity analysis results of the detection method (* p <0.05, ** p <0.01, **** p < 0.0001; two-tailed t test).
[0031] Figure 12 Schematic diagram of afatinib derivative-nucleic acid aptamer probe. DETAILED DESCRIPTION
[0032] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. The exemplary implementation methods of the present invention and their descriptions are only used to explain the present invention and are not intended to limit the present invention.
[0033] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the reagents used can be purchased commercially.
[0034] Unless otherwise specified, the nucleic acid aptamer referred to below refers to TuTu22.
[0035] Example 1 This example provides a molecular docking method for afatinib derivatives: docking is performed using Autodock software.
[0036] Further provided is a method for molecular docking of nucleic acid aptamers and EGFR protein and analysis of binding sites: (1) After the DNA sequence of the aptamer (TuTu22) was transcribed into an RNA sequence, the secondary structure of the RNA was predicted using the MC-fold web server, and the most stable structure (with the most negative ΔG value) was selected. The tertiary structure of the RNA was then predicted using the MC-sym web server. The file with the lowest energy item was selected based on the energy ranking structure in the MC-sym web server file directory page, and the target item was downloaded as a PDB file.
[0037] The DNA sequence of the aptamer (TuTu22) is: 5'-TACCAGTGCGATGCTCAGTGCCGTTTCTTCTCTTTCGCTTTTTTTGCTTTTGAGCATGCTGACGCATTCGGTTGAC-3' (SEQ ID NO: 1).
[0038] (2) After obtaining the tertiary structure of RNA, it is converted into the corresponding DNA structure. This process is divided into two steps: the first step is nucleotide mutation; the second step is structure optimization. First, the Discovery Studio Visualizer software is used to replace each ribonucleotide molecule in the RNA structure with the corresponding deoxyribonucleotide molecule, and then an overlap operation is performed. The overlapping atoms only include the base part. After the above overlap operation, the obtained DNA molecule may have some covalent bond breaks or atomic overlaps, so the structure needs to be optimized. Here, the NAMD (NAnoscale Molecular Dynamics) software is used to optimize the modified nucleic acid aptamer structure using a 30,000-step gradient energy minimization method to obtain the most reliable structure.
[0039] (3) After obtaining the three-dimensional structures of the EGFR protein and the aptamer, the two molecules were docked using the HDOCK online server. Submit the EGFR protein PDB file in the Input Receptor Molecule of the HDOCK online server and the predicted aptamer PDB file in the Input Ligand Molecule and submit them for docking. The prediction results will be sent to the email address you provided within a limited time. Finally, the docking configuration file is output in order of optimal energy. Select the best configuration provided on the page and download the PDB format file.
[0040] (4) PyMOL software was used for analysis, and 8 Å was defined as the distance threshold for binding residues. That is, for an amino acid residue in the protein in the complex, if the distance between at least one atom it contains and any atom of the nucleic acid sequence in the complex is less than 8 Å, then this amino acid residue is defined as a nucleotide-binding residue.
[0041] See the results Figure 1-Figure 3 , Figure 1 The results indicate that the designed DBCO-modified afatinib derivatives can match the active center of the EGFR protein membrane. The results show that the DBCO-modified afatinib derivatives designed in this paper can bind to the membrane part of the target protein and still have good target binding. Figure 2-3The aptamer TuTu22 binds to the extracellular portion of the EGFR protein across two monomeric proteins, including residues ASN-91, SER-92, ASP-147, and ASN-151 in region I, LYS-375 and ARG-479 in region III, and ARG-507, GLU-510, ARG-550, and GLU-578 in region IV. The results demonstrate that the aptamer TuTu22 binds strongly to the extracellular portion of the EGFR protein.
[0042] Example 2 Synthesis of DBCO-modified afatinib derivative (AF) (1) Synthesis of intermediate AF2: 7-Fluoro-6-nitro-4-hydroxyquinazoline (1.000 g, 4.78 mmol), toluene (30 mL), triethylamine (0.5790 g, 5.72 mmol) and phosphorus oxychloride (1.0900 g, 7.10 mmol) were added to a 100 mL round-bottom flask and reacted at 80°C for 3 h. After cooling to 60°C, 4-fluoro-3-methoxyaniline (0.6950 g, 4.92 mmol) was added and the temperature was continued to rise to 80°C for reaction. The reaction progress was monitored by TLC. After the reaction was completed, the toluene was removed by concentration under reduced pressure, and the mixture was washed with water by stirring and filtered to remove phosphorus oxychloride. The filter cake was dissolved in ethyl acetate (50 mL) and transferred to a flask. Silica gel powder was added to disperse the mixture evenly and the mixture was dried by rotary evaporation. The crude product was purified by silica gel column chromatography and characterized by ¹H NMR.
[0043] Chemical formula of intermediate AF2: C 15 H 10 F2N4O3, hydrogen spectrum: 1 H NMR (400 MHz, DMSO) δ 10.67 (s, 1H),9.71 (s, 1H), 8.66 (s, 1H), 7.79 (d, J = 12.5 Hz, 1H), 7.73–7.60 (m, 1H), 7.46(m, 1H), 7.24 (dd, J = 11.3, 8.9 Hz, 1H), 3.86 (s, 3H).
[0044] (2) Synthesis of intermediate AF3: 3-Boc-aminopropanol (0.5020 g, 2.86 mmol) was dissolved in tetrahydrofuran (15 mL) and added to a 100 mL round-bottom flask. Sodium hydroxide (0.1390 g, 3.50 mmol) was added under nitrogen protection and stirred at room temperature for 30 min. Intermediate AF2 (0.8000 g, 2.40 mmol, dissolved in THF) was added dropwise over 1 h using a syringe pump. The reaction was continued at room temperature for 3 h and the reaction progress was monitored by TLC. After the reaction was completed, the mixture was quenched with saturated sodium bicarbonate solution (5 mL), diluted with ethyl acetate (50 mL), and separated and extracted. The mixture was washed with saturated sodium bicarbonate solution three times, and the organic phase was retained. The organic phase was dried over anhydrous Na2SO4, filtered, and the solvent was dried by rotary evaporation. The crude product was separated and purified by silica gel column chromatography, and the product was characterized by ¹H NMR.
[0045] Chemical formula of intermediate AF3: C 23 H 26 FN5O6, hydrogen spectrum: 1 H NMR (400 MHz, DMSO) δ 10.09 (s, 1H),9.23 (s, 1H), 8.62 (s, 1H), 7.62 (dd, J = 8.0,2.3 Hz, 1H), 7.48-7.43 (m, 1H),7.42 (s, 1H), 7.24 (dd, J = 11.3,8.8Hz, 1H), 6.93 (s, 1H), 4.30 (m, 2H), 3.87(s, 3H), 3.13 (m, 2H), 1.90 (m, 2H), 1.37 (s, 9H).
[0046] (3) Synthesis of intermediate AF4: Intermediate AF3 (0.5000 g, 1.02 mmol) was dissolved in acetone (30 mL) and added to a 100 mL round-bottom flask. Saturated aqueous ammonium chloride solution (6 mL) and zinc powder (0.5330 g, 8.16 mmol) were added in sequence. After stirring at room temperature for 2 h, the zinc powder was removed by filtration, and the filter cake was washed with ethyl acetate. The organic layers were combined and washed with saturated sodium bicarbonate solution, and the aqueous layer was extracted with ethyl acetate. The organic phases were combined, dried over anhydrous Na2SO4, filtered, and dried by spin drying. The crude product was separated and purified by silica gel column chromatography, and the product was characterized by ¹H NMR.
[0047] Chemical formula of intermediate AF4: C 23 H 28 FN5O4, hydrogen spectrum: 1 H NMR (400 MHz, DMSO) δ9.22 (s, 1H),8.34 (s, 1H), 7.70 (dd, J = 8.1, 2.4 Hz, 1H), 7.54–7.43 (m, 1H), 7.41 (s, 1H), 7.17 (dd, J = 11.4, 8.9 Hz, 1H), 7.06 (s, 1H), 6.95 (t, J = 5.7 Hz, 1H), 5.29 (s,2H), 4.17 (m, 2H), 3.85 (s, 3H), 3.17 (m, 2H), 1.95 (m,2H), 1.38 (s, 9H).
[0048] (4) Synthesis of intermediate AF5: N,N'-carbonyldiimidazole (0.1400 g, 0.863 mmol) and tetrahydrofuran (30 mL) were added to a 500 mL round-bottom flask and stirred at 40°C until clear. Diethylphosphinoacetic acid (0.3430 g, 1.74 mmol) was added and stirred at 40°C for 30 min. Intermediate AF4 (0.4000 g, 0.875 mmol) was then added and the reaction was refluxed at 75°C (TLC monitoring). After the reaction, silica gel powder was added and the solvent was dried. The crude product was separated and purified by silica gel column chromatography and characterized by ¹H NMR.
[0049] Intermediate AF5 Chemical formula: C 29 H 39 FN5O8P, hydrogen spectrum: 1 H NMR (400 MHz, DMSO) δ 9.76 (s, 1H),9.55 (s, 1H), 8.88 (s, 1H), 8.47 (s, 1H), 7.56 (m, 1H), 7.35 (m, 1H), 7.24(s, 1H), 7.18 (dd, J =11.4, 8.8 Hz, 1H), 6.96 (m, 1H), 4.23 (t, J =6.1 Hz, 2H),4.15–4.06 (m, 4H), 3.85 (s, 3H), 3.37 (d, J =21.3 Hz, 2H), 3.19 (m, 2H), 1.96(m, 2H), 1.33 (s, 9H), 1.22 (t, J = 7.0 Hz, 6H).
[0050] (5) Synthesis of intermediate AF6: Dimethylaminoacetaldehyde diethyl acetal (0.2200 g, 1.36 mmol) was slowly added dropwise to a 100 mL round-bottom flask containing 37% concentrated hydrochloric acid (2 mL) and water (2 mL). After stirring in an ice bath for 10 min, the mixture was heated to 30 °C and reacted for 4 h. The mixture was then cooled to 5 °C to obtain solution B. Potassium hydroxide (1.150 g, 20.5 mmol) was dissolved in water (5 mL) and stored in an ice bath as solution C. Intermediate AF5 (0.3000 g, 0.472 mmol), lithium chloride (0.5000 g, 11.7 mmol) and DMF (15 mL) were added to a 250 mL round-bottom flask. After stirring for 30 min, solution C was added. Stirring was continued for 10 min, and solution B was added dropwise. The reaction progress was monitored by TLC. After the reaction was completed, the mixture was diluted with dichloromethane (100 mL) and washed with 10% sodium bicarbonate solution and water. The obtained crude product was separated and purified by silica gel column chromatography, and the product was characterized by ¹H NMR.
[0051] Intermediate AF6 Chemical formula: C 29 H 37 FN6O5 hydrogen spectrum: 1 H NMR (600 MHz, DMSO) δ 10.62 (s, 1H),9.58 (s, 1H), 8.97 (s, 1H), 8.74 (s, 1H),8.42 (s, 1H), 7.56 (dd, J = 8.0, 2.1Hz, 1H), 7.45–7.31 (m, 2H), 7.20 (s, 1H), 7.15 (dd, J = 11.2, 8.8 Hz, 1H), 6.95(m, 1H), 4.21 (t, J = 6.4 Hz, 2H), 3.81 (s, 3H), 3.11 (m, 2H), 3.02 (m, 1H), 2.58 (m, 1H), 2.13 (s, 6H), 1.93 (m, 2H), 1.34 (s, 9H).
[0052] (6) Synthesis of intermediate AF7: Intermediate AF6 (0.1000 g, 0.176 mmol) was added to 15 mL of dichloromethane and 5 mL of trifluoroacetic acid, and stirred at room temperature for 2 h. After the reaction, the mixture was concentrated under reduced pressure using an oil pump, and the residue was recrystallized to obtain a light yellow solid. The product was characterized by H NMR spectroscopy.
[0053] Chemical formula of intermediate AF7: C 24 H 29FN6O, hydrogen spectrum: 1 H NMR(600 MHz, DMSO) δ 9.99 (s, 1H),9.07 (s, 1H), 8.74 (s,1H), 8.04 (s, 2H), 7.57–7.39 (m, 2H), 7.26 (m, 2H),6.80 (s, 1H), 4.31 (m, 2H), 3.94 (m, 2H), 3.82 (s, 3H), 3.07 (m,2H), 2.77 (s,6H), 2.13 (m, 2H), 1.19 (s, 2H).
[0054] (7) Synthesis of AF: The intermediate AF7 (0.4800 g, 1.02 mmol) was added to a 100 mL round-bottom flask and dissolved in 15 mL of anhydrous DMF. Diphenylcyclooctyne-carboxylic acid (0.3800 g, 1.24 mmol), (2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU) (0.7090 g, 1.86 mmol), and N,N-diisopropylethylamine (DIPEA) (0.2412 g, 1.87 mmol) were added, and then reacted at 80 °C for 12 h in an oxygen-free environment. After the reaction, 20 mL of deionized water was added for dilution, and the product was filtered through a 0.22 μM organic filter membrane and purified by preparative high performance liquid chromatography to obtain the final product. HPLC purification was performed under the following conditions: C18 column; mobile phase was dd H2O and 65% acetonitrile; flow rate: 2.0 mL / min; detection wavelength: 260nm; column temperature: 25℃. The separated product was lyophilized in a low-temperature freeze dryer to obtain the dry target product AF, the structure of which is shown below. It was characterized by nuclear magnetic resonance spectroscopy and mass spectrometry ( Figure 4 、 5 ).
[0055] Afatinib derivatives (AF) chemical formula: C 43 H 42 FN7O5, 1H NMR (600 MHz, DMSO-d6) δ 8.44(s, 2H), 8.34 (s, 2H), 8.24 (s, 1H), 7.82 (s, 1H), 7.67 (s, 1H), 7.49 (m,2H), 7.31 (m, 2H), 7.21 (s, 2H), 6.77 (s, 1H), 4.23 (s,1H), 3.94 (s, 1H), 3.81 (s, 1H), 3.57 (m, 8H), 3.13–3.04 (m, 8H), 2.77 (s, 3H), 2.51 (s, 3H), 2.50 (s, 3H).
[0056] .
[0057] Example 3 Synthesis of Afatinib-Aptamer Capture Probe (AF-Aptamer) An aqueous solution (100 μM, 10 μL) of a 5'-terminally azide-modified aptamer (N3-TuTu22) and a DMF solution (1 μM, 150 μL) of AF were added to a 2 mL centrifuge tube, mixed, and wrapped with tin foil. The mixture was stirred at 4°C in the dark for 12 h. After the reaction, dd HO was added to a total volume of 250 μL, filtered through an aqueous filter, and purified by preparative high-performance liquid chromatography. The purified product was freeze-dried in a vacuum freeze dryer and dissolved in ultrapure water. The DNA strand concentration was measured and calculated using a UV spectrophotometer. The relative molecular mass was determined by mass spectrometry to obtain the target product, AF-Aptamer (i.e., AF-TuTu22). HPLC purification was performed using the following conditions: C18 column, flow rate: 2.0 mL / min, mobile phase A: 0.1 M TEAA, mobile phase B: acetonitrile, 65% B, 30 min, detection wavelength: 260 nm, column temperature: 25°C. Figure 6 This is the mass spectrum of the afatinib-nucleic acid aptamer probe (AF-TuTu22).
[0058] Example 4 Cell Binding Experiment To investigate whether afatinib-aptamer capture probe (AF-TuTu22) has a better binding effect on MDA-MB-231 cells, flow cytometry was used to test it.
[0059] The composition of the following BB buffer is: DPBS containing 4.5 mg / mL glucose, 5 mM MgCl2, 1 mg / mL BSA, and 1 mg / mL herring sperm DNA (HsDNA).
[0060] The composition of WB buffer is: 4.5 mg / mL glucose and 5 mM MgCl2 in DPBS.
[0061] The flow cytometry experiment is performed as follows: (1) Preparation of ssDNA: Take 10 μL, 10 μM single-stranded TuTu22-Cy3, AF-Lib-Cy3 (the synthesis steps of AF-Lib3 are the same as AF-TuTu22, the difference is that the sequence of Lib is ACAGAGAGACAACACGTGCCCAAC), AF-TuTu22-Cy3 with Cy3, add 45 μL of BB buffer respectively, denature at 95℃ for 5 minutes, and immediately place on ice to cool for 10 minutes after denaturation. After cooling, add 150 μL of BB buffer, mix gently, and place on ice for use.
[0062] (2) Cell preparation: Discard the culture medium of the culture flask containing MDA-MB-231 cells, add an appropriate amount of PBS (pH = 7.4) to wash twice, then add 1 mL of 0.2% EDTA solution and shake slowly. After the cells are completely digested, discard the EDTA solution and add 1 mL of PBS. Pipet several times to detach the cells to form a suspension. Transfer the suspension to a centrifuge tube, mix well, and count using a cell counter. Take a certain number of cells in a 1.5 mL centrifuge tube, centrifuge at 1500 rpm at 4°C for 5 min, discard the supernatant, and retain the cells that have settled to the bottom of the centrifuge tube for later use.
[0063] (3) Incubation of ssDNA with cells: Add the prepared 200 μL TuTu22-Cy3, 200 μL AF-Lib-Cy3, and 200 μL AF-TuTu22-Cy3 to the corresponding cells, gently pipette to mix, and incubate on a shaker in the dark for 1 hour. After incubation, centrifuge at 1500 rpm for 5 minutes, discard the BB buffer, and then add 200 μL WB buffer and pipette to mix evenly. After centrifugation, discard the supernatant and repeat the washing twice. Finally, add 500 μL WB solution to the centrifuge tube, vortex evenly, and transfer to a flow tube for flow cytometry experiments.
[0064] like Figure 7 As shown in the data, in the MDA-MB-231 cell experimental group, TuTu22-Cy3 exhibited a binding effect similar to that of AF-Lib-Cy3, and the binding ability of AF-TuTu22-Cy3 to MDA-MB-231 cells was enhanced. This may be because the afatinib-nucleic acid aptamer can form covalent bonds with the intramembrane amino acid residues in the target protein, resulting in irreversible covalent binding, thereby further enhancing the binding ability of the aptamer to the target protein.
[0065] Example 5 Verification of the feasibility of exosome detection 1. Human breast cancer MDA-MB-231 cell line was purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences; 2. Isolation and extraction of exosomes: When MDA-MB-231 cell density exceeded 80%, the cells were starved for 48 hours in culture medium without fetal bovine serum. The cell culture supernatant was collected and exosomes were extracted by differential centrifugation and ultracentrifugation at 4°C. First, a series of low-speed centrifugation steps (300 × g for 10 minutes, 2,000 × g for 20 minutes, and 11,000 × g for 45 minutes) were performed to remove impurities such as dead cells, cell debris, and large proteins. The supernatant was then collected. Finally, ultracentrifugation was performed at 100,000 × g for 70 minutes. The supernatant was discarded and the pellet, which is the exosome, was collected. The collected exosome pellet was resuspended in PBS and used directly for downstream experiments or stored at -80°C.
[0066] 3. SPR chip pretreatment: Soak the SPR chip in piranha wash solution for 1 min, rinse with deionized water, repeat three times, and blow dry with nitrogen after washing. The SPR chip is now cleaned and activated.
[0067] 4. Testing process: A PDMS liquid pool was attached and an appropriate amount of deionized water was added. A coverslip was placed on the pool and the reflectance spectrum was measured in the SPR sensing detection system. The obtained spectrum was the blank signal. Then, 2 μM nucleic acid aptamer was added to the PDMS liquid pool and incubated for 1.5 h. Subsequently, the aptamer was repeatedly rinsed with deionized water and the reflectance spectrum was recorded. Next, 1 mM MCH solution was added to the thin film pool and incubated for 0.5 h. The aptamer was repeatedly rinsed with anhydrous ethanol and deionized water and the reflectance spectrum was recorded. Finally, MDA-MB-231 exosomes (1.16×10 6 particles μL -1 ) and incubated for 2.5 h, then rinsed with deionized water and the reflectance spectrum was recorded.
[0068] The feasibility of this detection method was verified. The sulfur-substituted nucleic acid aptamer can be effectively fixed on the surface of the gold substrate through the Au-S bond. When the exosomes are captured, the interaction between the molecules will cause a slight change in the surface refractive index, thereby achieving detection. Figure 8 As shown in A. When the afatinib-nucleic acid aptamer probe modified with thiol groups synthesized by the commissioned company was incubated with the chip, the SPR spectrum showed a significant red shift of the resonance peak from curve a to curve b ( Δ λ = 0.422 nm), indicating that AF-TuTu22 can be successfully assembled on the chip. Subsequently, the chip was sealed with mercaptohexanol (MCH), which led to a further red shift in the spectral resonance peak (curve c, Δ λ = 0.201 nm). Next, when MDA-MB-231 exosomes were incubated with AF-TuTu22 assembled on the chip, the SPR spectrum further red-shifted from curve c to curve d, and a significant Δ λ changes ( Δ λ = 0.559nm), the results show that the AF-TuTu22 probe assembled on the chip can successfully capture MDA-MB-231 exosomes. Figure 8 As shown in B, TuTu22 probes can also be successfully assembled on the chip and capture MDA-MB-231 exosomes ( Δ λ = 0.258 nm). In addition, when the detection concentration was the same, the AF-TuTu22 probe showed a larger peak red shift before and after capturing exosomes compared with the aptamer TuTu22 alone, indicating that the afatinib-aptamer probe has a higher capture efficiency.
[0069] Example 6 Investigation of capture efficiency In order to further investigate the capture efficiency of the probe, the total amount of exosomes captured by AF-TuTu22 and TuTu22 at different times was measured, and the capture efficiency was calculated. The experimental steps were similar to the detection process in Example 5. The total amount of exosomes captured by the probe was further investigated at different capture times, and the capture efficiency was calculated: capture efficiency (%) = (total amount captured / capture time) × 100. Figure 9 As shown in A, Δλ in the TuTu22 group increased with the increase of exosome capture time. When the exosome capture time reached 2.5 h, Δ When λ reaches a plateau and the exosome capture time continues to increase Δ The λ value had almost no significant change, which was close to saturated adsorption. Δ λ also increases with the increase of exosome capture time. When the capture time is 1.5 h, Δ λ reaches a plateau value ( Figure 9 B). The experimental results showed that the capture time of afatinib-aptamer capture probe was 1 hour earlier than that of aptamer alone, effectively shortening the detection time of exosomes. Figure 9 As shown in Figure C, the capture efficiency of AF-TuTu22 was approximately 31.5%, significantly higher than that of TuTu22 (11.6%), further validating the higher capture efficiency of the afatinib-aptamer capture probe. In subsequent experiments, capture times of 2.5 h and 1.5 h were used for TuTu22 and AF-TuTu22, respectively.
[0070] Example 7 Sensitivity of the Detection Method The sensitivity of the method for detecting MDA-MB-231 exosomes was investigated using an SPR sensor under the conditions of 2.5 h and 1.5 h capture time for TuTu22 and AF-TuTu22, respectively. The sensitivity of the method was investigated under the above-mentioned MDA-MB-231 exosome incubation time conditions. First, MDA-MB-231 exosomes (1.45×10 5 , 2.90×10 5 5.80×10 5 , 1.16×10 6 , 2.32×10 6 particles μL -1 ) and incubated for 1.5 h, then rinsed with deionized water and the reflectance spectra were recorded. Figure 10 As shown in A, when the AF-TuTu22 probe is used, the shift difference of the SPR spectrum increases with the increase of the concentration of MDA-MB-231 exosomes. Δ λ gradually increases, Δ There is a good linear relationship between λ and the logarithm of exosome concentration (logC), and the linear regression equation is: Δ λ=0.4788 lgC-2.354, correlation coefficient R 2 =0.9611, the peak position fluctuation is 3 times of the blank baseline Δ Substituting λ=0.03 into the equation, the LOD value is calculated to be 7.94×10 4 particles μL -1 Similarly, when using the TuTu22 probe, Δ There is a good linear relationship between λ and the logarithm of exosome concentration (logC) ( Figure 10 B), the linear regression equation is Δ λ=0.2736lgC-1.382, correlation coefficient R 2 =0.9688, and the LOD value is 1.58×10 5 particles μL -1 The concentration of exosomes in peripheral blood is approximately 10 6 -10 7 particles μL -1 , 10 6 particlesμL -1 This is the lowest detection limit for exosome detection in clinical practice. These experimental results demonstrate that the afatinib-aptamer capture probe meets the needs of clinical practice, and its sensitivity and detection limit are approximately 2-fold higher than those of the aptamer alone.
[0071] Example 8 Specificity of the Detection Method BSA protein and PTK7 protein were selected to investigate the selectivity of the detection method. The results are shown in Figure 2. Figure 11 As shown in the figure, since the aptamer can specifically recognize EGFR protein, the signal change generated by exosomes is significantly greater than the signal change caused by BSA protein and PTK-7 protein, indicating that this method has good selectivity for MDA-MB-231 exosomes.
[0072] In addition, in the BSA and PTK-7 protein groups, the amount of protein captured by the AF-TuTu22 probe was significantly less than that of the TuTu22 probe. However, in the Exosomes group, the amount of exosome capture was higher than that of the TuTu22 probe, with a p-value < 0.05, indicating that the difference was statistically significant. This shows that the tight covalent binding of afatinib to the intracellular tyrosine kinase domain of the EGFR protein can further eliminate interference from other proteins and effectively improve the specificity of the detection method. Using SPR sensing technology based on afatinib-aptamer capture probes, it is expected to distinguish between tumor exosomes and non-tumor exosomes by detecting EGFR protein on the surface of the exosome membrane.
[0073] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.
Claims
1. An afatinib derivative-nucleic acid aptamer clamp capture probe, characterized by: The afatinib derivative-nucleic acid aptamer clamp capture probe consists of a connecting part, an extramembrane recognition part, a spacer part and an intramembrane recognition part; the connecting part is a thiol-modified single-stranded DNA, the extramembrane recognition part is a nucleic acid aptamer, the intramembrane recognition part is an afatinib derivative, the spacer part is a single-stranded DNA, and the intramembrane and extramembrane recognition parts are covalently connected; the sequence of the single-stranded DNA is 5 to 25 consecutive identical bases.
2. The afatinib derivative-nucleic acid aptamer clamp capture probe according to claim 1, characterized in that: The structure of the afatinib derivative is as follows: , R1 and R2 are one of F, Cl, OCH3, NH2, CN, OH, and NO2.
3. The afatinib-aptamer clamp capture probe according to claim 1, characterized in that: The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO:
1.
4. The afatinib-aptamer clamp capture probe according to claim 1, wherein: The preparation steps are as follows: the nucleic acid aptamer aqueous solution and the afatinib derivative DMF solution are mixed in a centrifuge tube and placed in a dark place at 4°C with stirring for 12 to 24 hours. After the reaction is completed, dd H2O is added to the reaction solution to a total volume of 250 to 500 μL, and the reaction solution is filtered through an aqueous phase filter membrane, and the product is separated and purified by preparative high-performance liquid chromatography.
5. The preparation method according to claim 4, characterized in that: The concentration of the nucleic acid aptamer aqueous solution is 100 μM.
6. The preparation method according to claim 4, characterized in that: The concentration of the AF DMF solution was 1 μM.
7. The preparation method according to claim 4, characterized in that: The volume ratio of the nucleic acid aptamer aqueous solution to the afatinib derivative DMF solution is 1:10-15.
8. The preparation method according to claim 4, characterized in that: The purification conditions of the HPLC separation were as follows: C18 column; flow rate: 2.0 mL / min; mobile phase A: 0.1 M TEAA; mobile phase B: acetonitrile; 65% B, 30 min; detection wavelength: 260 nm; column temperature: 25°C.
9. Use of the afatinib derivative-nucleic acid aptamer clamp capture probe according to claim 1 in detecting MDA-MB-231 exosomes.
10. An SPR sensor, characterized in that: The sensor comprises the afatinib derivative-nucleic acid aptamer clamp capture probe according to claim 1.