Brucella typing detection kit and detection method thereof

Abstract

The invention relates to a Brucella typing detection kit and a detection method thereof, and relates to the technical field of biological detection, the Brucella typing detection kit comprises the following components: a reaction solution, a detection solution, an enzyme mixed solution, a quantitative standard substance, a typing standard substance and a blank reference substance; the reaction liquid comprises 5 * PCR buffer, 50 mM of MgCl2, 0.5 Mm of dNTP, 0.1 to 0.3% (v / v) of a surfactant, 0.5 to 2 mol / L of a reinforcing agent, 1 to 5% (w / v) of trehalose, 0.1 to 1% (w / v) of BSA, 0.1 to 1 [mu] g / [mu] L of SSB and 0.1 to 1 mM of MnCl2. The kit and the detection method thereof have excellent signal intensity, complex sample tolerance, detection sensitivity and specificity.

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection, in particular to a Brucella typing detection kit and a detection method thereof. Background Art

[0002] Brucellosis, a zoonotic disease caused by the bacterium Brucella, poses a serious threat to livestock production and human health. Brucella species are numerous, and different strains and biotypes vary in pathogenicity, transmission routes, and treatment. Therefore, accurate typing and detection are crucial for disease prevention, control, and treatment. It not only provides a deeper understanding of its biological characteristics and pathogenic mechanisms, but also provides a crucial basis for epidemic tracking, clinical diagnosis, epidemiological research, and prevention and control.

[0003] Traditional Brucella typing detection methods mainly include bacterial culture method and serological detection method. Although the bacterial culture method is the "gold standard" for diagnosing brucellosis, its detection cycle is long, and it has high requirements for the experimental environment and operators. It is easily contaminated by foreign bacteria, which affects the accuracy of the test results. Serological detection methods, such as the tiger red plate agglutination test and the test tube agglutination test, although relatively simple to operate, have low specificity and sensitivity, and cannot accurately distinguish different types of Brucella. It is prone to false positive and false negative results. With the development of molecular biology technology, nucleic acid-based detection methods have gradually been applied to Brucella typing detection, but the existing nucleic acid-based detection technology still has defects in signal intensity and adaptability to complex samples.

[0004] In existing Brucella detection, the performance of the marker significantly impacts the test results. Conventional markers suffer from weak signals and quenching, making them difficult to detect in minute quantities. Furthermore, actual test samples come from a wide range of sources and are complex in composition, often containing various inhibitors, such as hemoglobin in blood and proteases in tissues. These inhibitors can interfere with the activity of the detection reagents, leading to inaccurate test results. Existing detection kits have poor tolerance for complex samples and cannot meet actual testing needs.

[0005] For example, the Chinese invention patent with the authorization publication number CN105624303B discloses a fluorescent PCR detection kit for typing Brucella in cattle, sheep, pigs and dogs, as well as its preparation and application. The kit includes primers and probes for detecting Brucella bovis, Brucella ovis, Brucella suis and Brucella canis. The kit has high detection sensitivity, with a minimum detection limit of 1×10 3 The accuracy and positive rate of the kit were both as high as 100%. However, the signal intensity and tolerance of complex samples of the kit and its application method still need to be further improved.

[0006] It can be seen that the development of a Brucella typing detection kit and its detection method that are significantly superior to traditional detection methods in terms of signal intensity, tolerance to complex samples, detection sensitivity and specificity, and can more accurately and efficiently realize the typing detection of Brucella meet market demand, have broad market value and application prospects, and are of great significance to promoting the development of accurate Brucella typing technology. Summary of the Invention

[0007] The purpose of the present invention is to overcome the shortcomings of the existing technology and provide a Brucella typing detection kit and a detection method thereof, which are significantly superior to traditional detection methods in terms of signal intensity, complex sample tolerance, detection sensitivity and specificity, and can more accurately and efficiently realize Brucella typing detection.

[0008] To achieve the above-mentioned purpose, the technical solution adopted by the present invention is: a Brucella typing detection kit, comprising the following components: a reaction solution, a detection solution, an enzyme mixture, a quantitative standard, a typing standard, and a blank control; the reaction solution contains: 5×PCR buffer, 50mM MgCl2, 0.5Mm dNTP, 0.1-0.3% (v / v) surfactant, 0.5-2mol / L enhancer, 1-5% (w / v) trehalose, 0.1-1% (w / v) BSA, 0.1-1μg / μL SSB, and 0.1-1mM MnCl2.

[0009] Preferably, the surfactant is Tween-20; and the enhancer is betaine.

[0010] Preferably, the quantitative standard is: Brucella BCSP31 gene fragment connected to a pUC57 plasmid vector, diluted to 10 7 copies / ml, 10 6 copies / ml, 10 5 copies / ml, 10 4 copies / ml, as a quantitative standard.

[0011] Preferably, the typing standard is: 4 amplified product fragments of Brucella are connected to 4 pUC57 plasmid vectors respectively, and diluted to 10 6 copies / ml, as typing standards.

[0012] Preferably, the blank control substance is sterile purified water.

[0013] Preferably, the enzyme mixture comprises: 5 U / μl hot start Taq enzyme, 5 U / μl DNA UDG enzyme, and 0.1 U / μl ExoIII exonuclease.

[0014] Preferably, the detection solution comprises: a Brucella quantitative primer pair and probe P0, a bovine Brucella amplification primer pair and probe P1, a sheep Brucella amplification primer pair and probe P2, a porcine Brucella amplification primer pair and probe P3, and a canine Brucella amplification primer pair and probe P4.

[0015] Preferably, the Brucella quantitative primer pair includes an upstream primer F0 and a downstream primer R0; the bovine Brucella amplification primer pair includes an upstream primer F1 and a downstream primer R1; the ovine Brucella amplification primer pair includes an upstream primer F2 and a downstream primer R2; the porcine Brucella amplification primer pair includes an upstream primer F3 and a downstream primer R3; the canine Brucella amplification primer pair includes an upstream primer F4 and a downstream primer R4.

[0016] Preferably, the sequence of F0 is GATATTGGCAACCGAGCCAT, and the concentration is 400uM.

[0017] Preferably, the sequence of R0 is TATTATCCGATTGGTGGTCT, and the concentration is 400uM.

[0018] Preferably, the sequence of P0 is 5'-fluorescent reporter group-GAAATCGCGTTCGCGAT-fluorescent quencher group-3', the fluorescent reporter group labeled at the 5' end is ROX PLUS, and the fluorescent quencher group labeled at the 3' end is BHQ1, with a concentration of 80 uM.

[0019] Preferably, the sequence of F1 is CACACTCACCTTCCACAACA, and the concentration is 100 uM.

[0020] Preferably, the sequence of R1 is CCCGTTCTGCACCAGAC, and the concentration is 500 uM.

[0021] Preferably, the sequence of P1 is 5'-fluorescent reporter group-ACAAGGGTGGAACGACCTTTGCAGGC-fluorescent quencher group-3', the fluorescent reporter group labeled at the 5' end is ROX PLUS, and the fluorescent quencher group labeled at the 3' end is BHQ1, with a concentration of 500 uM.

[0022] Preferably, the sequence of F2 is TCGYATCGGCAGTTTCAA, and the concentration is 120uM.

[0023] Preferably, the sequence of R2 is CAGCTTTTGGCCTTTTCC, and the concentration is 500uM.

[0024] Preferably, the sequence of P2 is 5'-fluorescent reporter group-CATGGCCCGCAATCTGGAAAAGG-fluorescent quencher group-3', the fluorescent reporter group labeled at the 5' end is ROX PLUS, and the fluorescent quencher group labeled at the 3' end is BHQ1, with a concentration of 500 uM.

[0025] Preferably, the sequence of F3 is CAAATATCCATGCGGGAAG, and the concentration is 120uM.

[0026] Preferably, the sequence of R3 is TGGGCATTCTCTACGGTG, and the concentration is 650uM.

[0027] Preferably, the sequence of P3 is 5'-fluorescent reporter group-CCATAAAGCGCAAAGATCACACCGTAGAGA-fluorescent quencher group-3', the fluorescent reporter group labeled at the 5' end is ROX PLUS, and the fluorescent quencher group labeled at the 3' end is MGB, with a concentration of 650 uM.

[0028] Preferably, the sequence of F4 is GCACAGGCAGGCGA, and the concentration is 100 uM.

[0029] Preferably, the sequence of R4 is GACATCACCGTTCACGC, and the concentration is 500 uM.

[0030] Preferably, the sequence of P4 is 5'-fluorescent reporter group-TCTATCTGGCCAAATATCGCGTGAACGGTGAT-fluorescent quencher group-3', the fluorescent reporter group labeled at the 5' end is ROX PLUS, and the fluorescent quencher group labeled at the 3' end is BHQ1, with a concentration of 500 uM.

[0031] Preferably, the detection target sequence of the Brucella quantitative primer pair and probe P0 is: GATATTGGCAACCGAGCCATTCGACGAAACGGCCGTCGCGACGAGACCCGGCACGCCCTTTTCGCCTGCGCCGGAAATCGCGTTCGCGATCAGACCACCAATCGGATAATA.

[0032] Preferably, the detection target sequence of the bovine Brucella amplification primer pair and probe P1 is: TTGCGAGCGGCAGCACGCTGCAGCTTGGCGATGGCAGGCTTGCGGGCAATGTGGCCAATGCGGGCACACTCACCTTCCACAACAAGGGTGGAACGACCTTTGCAGGCGAGATCTCCGGCACTGGCAGTCTGGTGCAGAACGGGGCGGGTGCACTGACGCTGAGCGGTGACAGCCAAGGTTTTGCCGGT.

[0033] Preferably, the detection target sequence of the Brucella capitis amplification primer pair and probe P2 is: GGCGCGGTGTTGCCGAAAACGTGAAAGAAGCGGCGAAATGGTATCAGCTTGCCGCCGATCAGGGCTTTGCGCCTGCGCAATATCGCATCGGCAGTTTCAATGAAAAGGGCCTCGGCATGGCCCGCAATCTGGAAAAGGCCAAAAGCTGGTATCAGCTTGCCGCAGATCAGGGCAATGCAAGCGCCATGCACAATCTTGCCGTGCTTTTTGCCACAGGTACAAACGGCACGCCGGATAATGCTGCCGCTGT.

[0034] Preferably, the detection target sequence of the Brucella suis amplification primer pair and probe P3 is: TCCAAGGCCCGGTTGCAGCAGGAACCAGCCAGCCGCAATGGTCAATATGCCAAATATCCATGCGGGAAGGAAGATTGGGTTCGCAAACCATGCCGCGCCGCCATAAAGCGCAAAGATCACAAAAGCGCAAAGATCACACCGTAGAGAATGCCCACTGCATAGTGGCCGATCCAGCCCAGCGCCACTTCATGACGACAGGG.

[0035] Preferably, the detection target sequence of the canine Brucella amplification primer pair and probe P4 is: GATGAATTTCCGCAGGGCCGTAATGTTCACGGTGGCGGCCATCGGCCTTGCCGCCTCCCCGCTTTTCACTGCGCCGGCACAGGCAGGCGAGGCTCGCAAATCCAGAGAGGTCTATCTGGCCAAATATCGCGTGAACGGTGATGTCCGCTATTCCAAGCAGCCGAGAGGCAAACTGATGCGAGTTTCGGTCTCACAATATAGGACCAGCAATTCCTATGTCTGTACGCCAAGCGGCTTCGGCCAGAAATCG.

[0036] Another object of the present invention is to provide a detection method that adopts above-mentioned Brucella typing detection kit to carry out typing detection to Brucella, comprising the steps of:

[0037] Step S1, using the DNA sample extracted from whole blood as the DNA specimen to be tested, and using a positive control substance and a blank control substance, PCR detection is performed using a Brucella typing detection kit;

[0038] S2. Data processing: After the reaction is completed, the results are determined by the melting curve of the sample.

[0039] Preferably, the amplification system of the fluorescent quantitative PCR detection in step S1 is as follows: 15 μL of reaction solution, 4 μL of detection solution, 1 μL of enzyme mixture, and 5 μL of the DNA sample to be tested.

[0040] Preferably, the DNA sample to be tested is any one of a quantitative standard, a typing standard, a blank control, and a sample DNA.

[0041] Preferably, the reaction conditions for the PCR detection of fluorescent quantitative PCR in step S1 are: pre-denaturation at 95°C for 3 min; denaturation at 98°C for 10 s, annealing and extension at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 50 cycles; followed by melting curve scanning at 95°C for 1 min, 45°C for 3 min, and scanning from 45°C to 85°C at intervals of 1°C, and the fluorescence channel selects the detection channel corresponding to the ROX PLUS dye.

[0042] Preferably, the PCR detection in step S1 adopts a segmented temperature change strategy during the PCR reaction process, appropriately increasing the annealing temperature to 62°C in the early 1-20 cycles to promote specific binding; and lowering the annealing temperature to 58°C in the later 21-50 cycles to improve the amplification efficiency and further enhance the detection signal intensity.

[0043] The present invention relates to a Brucella quantitative and typing detection kit, and the principle of quantitative detection is based on fluorescent quantitative PCR technology. Fluorescent quantitative PCR (Quantitative Real-time PCR, qPCR) is a highly sensitive molecular biology technology that monitors changes in fluorescent signals in real time during the PCR amplification process, thereby performing quantitative analysis of target nucleic acids. Its core principle is to combine fluorescent markers with amplified products, and accurately calculate the concentration of the initial template by detecting the dynamic changes of fluorescence intensity with the number of amplification cycles, combined with a standard curve or relative quantitative method. The key to this technology is to achieve the combination of "real-time monitoring" and "quantitative analysis": after each cycle of the PCR reaction, the fluorescent signal in the reaction system is collected by a fluorescent detection system, and its intensity is proportional to the accumulated amount of the amplified product. According to the way the fluorescent signal is generated, qPCR is mainly divided into two categories: non-specific fluorescent dye method (such as SYBR Green I) and specific probe method (such as TaqMan probe, molecular beacon). SYBR Green I emits fluorescence by embedding into the minor groove of double-stranded DNA. Its advantages are low cost and simple operation, but nonspecific amplification products (such as primer dimers) may interfere with the results. The probe method relies on nucleic acid probes labeled with fluorescent groups and quenching groups. After the probe specifically binds to the target sequence, the fluorescent group and the quenching group are separated by hydrolysis or conformational changes, releasing the fluorescent signal, thereby ensuring the specificity of the detection. The basis of quantitative analysis is the Ct value (threshold cycle number), that is, the number of amplification cycles required for the fluorescent signal to reach the preset threshold. The greater the initial template amount, the smaller the Ct value. By establishing a logarithmic linear relationship between the Ct value and the template concentration (standard curve) after the gradient dilution of a standard sample of known concentration, the absolute copy number of the unknown sample can be inferred. Relative quantification uses internal reference genes (such as housekeeping genes) to correct for differences between samples and calculate the expression fold change of the target gene.

[0044] The principle of typing detection in this kit is based on the probe-based melting curve technology. Probe-based melting curve analysis is a highly sensitive molecular detection technology based on the specific binding of fluorescent probes to target DNA sequences. Its core principle is to verify PCR products, detect mutations, or type single nucleotide polymorphisms (SNPs) by monitoring the changes in the fluorescent signal during the melting process of the probe and the target sequence, combined with melting temperature (Tm value) analysis. This technology relies on a dual-labeled fluorescent probe (such as a TaqMan probe or a molecular beacon), which is labeled with a fluorescent group (such as ROX-Plus) at the 5' end and a quencher group (such as TAMRA) at the 3' end. In the free state, the probe's own stem-loop structure or spatial folding brings the fluorescent group and the quencher group close together, and the fluorescence is quenched; when the probe specifically binds to a single strand of target DNA, its conformation unfolds, the fluorescent group and the quencher group separate, and the fluorescent signal is released. After PCR amplification is complete, the system is slowly heated (e.g., from 60°C to 95°C) and the changes in fluorescence intensity are monitored in real time: at low temperatures, the probe and target sequence are stably bound, and the fluorescence signal is high; as the temperature approaches the melting temperature (Tm value) of the probe-target sequence complex, the double strands gradually dissociate, the probe detaches from the target sequence, and the fluorescence signal drops sharply; at high temperatures, the probe is completely free, and the fluorescence signal returns to the baseline. By plotting a curve of fluorescence intensity versus temperature (melting curve) and calculating its negative derivative (-dF / dT), a characteristic melting peak can be obtained, and the temperature corresponding to the peak is the Tm value. The Tm value is determined by factors such as the complementarity between the probe and target sequence, the GC content, the probe length, and the salt ion concentration: a perfectly matched probe has a high Tm value, while a single base mismatch significantly reduces the Tm value. Therefore, by analyzing the number of melting peaks and the difference in Tm values, we can determine product specificity (a single peak indicates specific amplification, while multiple peaks indicate the presence of nonspecific products or mutations), detect point mutations (such as the difference in Tm values between wild type and mutant types), or achieve SNP typing (different allele probe designs can produce different Tm values).

[0045] Due to the application of the above technical solution, the present invention has the following beneficial effects:

[0046] (1) The Brucella typing detection kit and detection method disclosed in the present invention are innovative in completing quantitative detection and typing detection in a single tube of reagent. The Brucella in the sample is quantitatively detected by the Taqman probe method. After the PCR amplification is completed, the product is typed and analyzed by the probe melting curve method. This can achieve accurate quantification and accurate typing detection of the sample without cross-reaction.

[0047] (2) The Brucella typing detection kit disclosed in the present invention is a single-tube, single-channel, five-plex PCR detection reagent. The single-channel fluorescent PCR reagent achieves multi-index detection through innovative detection methods, reducing overall costs and providing an efficient and reliable molecular detection solution for remote areas. It is an important tool for narrowing the gap in urban and rural medical resources. It does not require multiple channels for interpretation, the results are accurate, and it is easy to use.

[0048] (3) The Brucella typing detection kit and detection method disclosed in the present invention, the reaction solution contains: 5×PCR buffer, 50mM MgCl2, 0.5Mm dNTP, 0.1-0.3% (v / v) surfactant, 0.5-2mol / L enhancer, 1-5% (w / v) trehalose, 0.1-1% (w / v) BSA, 0.1-1μg / μL SSB, 0.1-1mM MnCl2. Trehalose protects the structure and activity of enzymes and nucleic acids under extreme conditions such as high temperatures. It forms hydrogen bonds with enzymes and nucleic acid molecules, replacing water molecules to maintain the structure of biomacromolecules, preventing denaturation and inactivation of Taq DNA polymerase, stabilizing the structure of nucleic acid molecules, ensuring smooth PCR reactions, and improving detection stability. BSA blocks sites in the reaction system that may nonspecifically adsorb nucleic acids or antibodies, and surfactants reduce nonspecific interactions between molecules. Together, these two agents reduce background signal, enhance detection signal prominence, and improve detection accuracy. SSB binds tightly to single-stranded DNA, preventing it from reannealing to form double strands and protecting it from nuclease degradation. This improves the accessibility of template DNA in PCR reactions, accelerates primer-template binding, significantly increases amplification efficiency, and shortens reaction time. MnCl2 can alter the activity and specificity of Taq DNA polymerase and, in some cases, enhances the enzyme's ability to amplify difficult templates (such as GC-rich sequences), facilitating the detection of complex sequence regions in Brucella and improving the comprehensiveness of detection. By rationally selecting the reaction solution composition formula, the components cooperate with each other and work together, enabling the kit to maintain stable performance in complex samples containing high concentrations of interfering substances such as proteins and polysaccharides, thereby effectively improving detection accuracy.

[0049] (4) The Brucella typing detection kit and detection method disclosed in the present invention have the 5' end of the P0 / P1 / P2 / P3 / P4 probes labeled with the reporter fluorescent dye ROX-Plus to improve the fluorescent labeling efficiency. Combined with the segmented temperature change strategy and the elimination effect of ExoIII exonuclease on nonspecific products, the background signal is effectively reduced and the detection signal intensity is improved. Through the optimized reaction system and detection process, combined with high-sensitivity fluorescent labeling, the detection sensitivity can be effectively improved.

[0050] (5) The Brucella typing detection kit and detection method disclosed in the present invention, the degradation effect of ExoIII exonuclease on nonspecific products, and the promotion of primer specific binding by the segmented temperature change strategy effectively avoid cross-reaction between primers. In the detection of mixed samples of multiple microorganisms, the specificity reaches 100%. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 This is the melting curve effect diagram for typing detection of Brucella ovis;

[0052] Figure 2 This is the melting curve effect diagram for typing detection of bovine Brucella;

[0053] Figure 3 This is the melting curve effect diagram for typing detection of Brucella canis;

[0054] Figure 4 This is the melting curve effect diagram for typing detection of Brucella suis;

[0055] Figure 5 This is the result of the Brucella quantitative standard test;

[0056] Figure 6 This is the standard curve, fitting formula and correlation coefficient for Brucella quantification. DETAILED DESCRIPTION

[0057] The following description is intended to disclose the present invention so that those skilled in the art can implement the present invention. The preferred embodiments described below are merely examples, and those skilled in the art may conceive of other obvious variations.

[0058] Example 1: A Brucella typing detection kit

[0059] A Brucella typing detection kit comprises the following components: a reaction solution, a detection solution, an enzyme mixture, a quantitative standard, a typing standard, and a blank control; the reaction solution contains: 5×PCR buffer, 50mM MgCl2, 0.5MmdNTP, 0.2% (v / v) surfactant, 1mol / L enhancer, 3% (w / v) trehalose, 0.5% (w / v) BSA, 0.5μg / μL SSB, and 0.3mM MnCl2; the surfactant is Tween-20; and the enhancer is betaine.

[0060] Table 1 Primer and probe sequences

[0061]

[0062] The quantitative standard is: Brucella BCSP31 gene fragment connected to a pUC57 plasmid vector, diluted to 10 with sterile purified water. 7 copies / ml, 10 6 copies / ml, 10 5 copies / ml, 10 4 The typing standard was: 4 amplified product fragments of Brucella were connected to 4 pUC57 plasmid vectors, and diluted to 10 with sterile purified water. 6 copies / ml, as typing standard; the blank control is sterile purified water; the enzyme mixture includes: 5U / μl hot start Taq enzyme, 5U / μl DNA UDG enzyme, and 0.1U / μl ExoIII exonuclease.

[0063] The detection solution contains: Brucella quantitative primers F0, R0 and probe P0, with concentrations of 400uM, 400uM and 80uM respectively; bovine Brucella amplification primers F1, R1 and probe P1, with concentrations of 100uM, 500uM and 500uM respectively; ovine Brucella amplification primers F2, R2 and probe P2, with concentrations of 120uM, 500uM and 500uM respectively; porcine Brucella amplification primers F3, R3 and probe P3, with concentrations of 120uM, 650uM and 650uM respectively; canine Brucella amplification primers F4, R4 and probe P4, with concentrations of 100uM, 500uM and 500uM respectively. The 5' ends of the P0 / P1 / P2 / P3 / P4 probes were labeled with the reporter fluorescent dye ROX-Plus, and the 3' ends of the P0 / P1 / P2 / P3 / P4 probes were labeled with the quencher groups BHQ1 / BHQ1 / BHQ1 / MGB / BHQ1, respectively. The primer and probe sequences are shown in Table 1.

[0064] Example 2: A Brucella typing detection method

[0065] A detection method for Brucella typing detection using the Brucella typing detection kit prepared in Example 1, comprising the following experimental steps:

[0066] (1) Main reagents and instruments: The reagents in the kit of Example 1 were used; the fluorescence quantitative PCR instrument was the Shanghai Hongshi SLAN-96 fluorescence quantitative PCR instrument.

[0067] (2) Sample requirements: The DNA solution obtained by extraction of Brucella-positive whole blood is used as the template.

[0068] (3) PCR amplification and result interpretation:

[0069] A. Design of primers and probes: The quantitative detection primers and probes of the reagents were designed based on the BCSP31 gene of Brucella; the typing detection primers were designed based on the specific sequences of Brucella bovis, Brucella melitensis, Brucella suis, and Brucella canis. The primer and probe sequences are shown in Table 1.

[0070] B. Quantitative standard: Brucella BCSP31 gene fragment connected to a pUC57 plasmid vector, diluted to 10 with sterile purified water. 7 copies / ml, 10 6 copies / ml, 10 5 copies / ml, 10 4 copies / ml, as a quantitative standard.

[0071] C. Typing standards: 4 amplified product fragments of Brucella were connected to 4 pUC57 plasmid vectors respectively, and diluted to 10 6 copies / ml, as typing standards.

[0072] C. Blank control: The blank control is sterile purified water and does not contain any DNA fragments.

[0073] D. Detection: To a total volume of 25 μL of fluorescent PCR amplification system, add 15 μL of reaction solution, 4 μL of detection solution, 1 μL of enzyme mix, and 5 μL of nucleic acid sample. PCR amplification reaction conditions are as follows: initial denaturation at 95°C for 3 minutes, followed by denaturation at 98°C for 10 seconds, annealing and extension using a stepwise ramping strategy for 30 seconds, and extension at 72°C for 30 seconds, for a total of 50 cycles. Melting curve scanning is then performed at 95°C for 1 minute, 45°C for 3 minutes, and then scanned from 45°C to 85°C in 1°C increments. The fluorescence detection channel corresponding to the ROX PLUS dye should be selected. A stepwise ramping strategy is used, with the annealing temperature at 62°C for the first 1–20 cycles and at 58°C for the last 21–50 cycles.

[0074] E. Validity judgment: The positive control and blank control must meet the standards in Table 2, otherwise the experimental results will be considered invalid.

[0075] Table 2 Validity judgment criteria

[0076]

[0077] F. Interpretation of Brucella Quantification Results: Create a curve using the logarithm of the concentration of the four standards as the horizontal axis and the Ct value of the corresponding standard as the vertical axis. Obtain a fitting formula and correlation coefficient. Substitute the Ct value of the unknown sample into the formula to calculate the Brucella DNA content in the sample.

[0078] G. Interpretation of Brucella typing results: The specific type of the sample is determined by the melting peak temperature of the melting curve.

[0079] Table 3 Classification criteria

[0080] Melting peak Classification 65.5±1 degrees single peak Brucella melitensis 68±1 degrees single peak bovine Brucella 71±1 degrees single peak Brucella canis 63±1 degrees, 68±1 degrees double peak Brucella suis No melting peak The sample concentration is too low to be typed

[0081] (4) Experimental results:

[0082] A. The target sequences of the four detection indicators of Brucella suis, Brucella bovis, Brucella ovis, and Brucella canis were synthesized into plasmids respectively, and the positive plasmid samples were diluted to 10 7 , 10 6 , 10 5 , 10 4 , 10 3 The final melting peaks showed that the peaks of the four Brucella species were in good condition ( Figure 1-Figure 4 ), can detect as low as 10 3 copies / ml of sample.

[0083] B. Specificity experiment: The samples selected were 4 Brucella species, 13 bacterial or viral DNAs, and 5 species DNAs (pig, cattle, sheep, dog, and human). The concentration of the sample DNA was 1×10 6 The test results are shown in Table 4. The target bacteria showed good PCR amplification signals, indicating a positive result; the four target bacteria could be identified as specific Brucella types through melting peaks; the Ct value of non-target bacteria was greater than 38, indicating a negative result. This experiment shows that the four detection targets of the project all have good analytical specificity and good exclusivity for other non-target bacteria. The specificity of the primers and probes avoids the possibility of false positive results in this test, ensuring the accuracy and high specificity of the experiment.

[0084] Table 4 Specificity test

[0085]

[0086] C. Sensitivity test results: Four Brucella strains (Brucella suis, Brucella bovis, Brucella spp., and Brucella canis) with known concentrations were diluted with negative serum samples to 1000, 500, and 250 CFU / ml, and each concentration was tested 20 times. The results showed that the minimum detection limit of the established Brucella typing detection system was 1000 CFU copies / ml.

[0087] D. Quantitative standard curve: the concentrations are 10 7 , 106 , 10 5 , 10 4 The quantitative standards of 100 copies / ml were tested, and the logarithms of the four concentrations were used as the horizontal axis and the detection Ct was used as the vertical axis to make a standard curve. Figure 5 The amplification curve of the quantitative standard is a marked S-shaped amplification curve. By using the logarithm of the concentration of the four standards as the horizontal axis and the Ct value of the corresponding standard as the vertical axis, a marked curve is made, such as Figure 6 , relationship coefficient R 2 The linear relationship of the standard curve was good.

[0088] Table 5 Sensitivity test

[0089]

[0090] In summary, the detection results in this example show that the method of the present invention has good sensitivity, high specificity, good repeatability, and the typing results are accurate and reliable.

[0091] Comparative Example

[0092] This example is basically the same as Example 1, except that the reaction solution contains: 5×PCR buffer, 50mM MgCl2, and 0.5Mm dNTP.

[0093] Experimental verification

[0094] Experimental Materials

[0095] 200 samples of Brucella with known species (60 from cattle, 70 from sheep, 50 from pigs, and 20 from dogs) were selected, along with 100 negative samples (whole blood samples from healthy animals) free of Brucella and 50 simulated complex samples (adding high concentrations of interfering substances such as proteins and polysaccharides to whole blood samples from healthy animals). The Brucella typing detection kit of Example 1 of the present invention and the Brucella typing detection kit of the comparative example were used as controls.

[0096] Experimental methods

[0097] The above samples were tested using the test kit of the present invention and a control kit according to the detection method described in Example 2 of the present invention. Each sample was tested three times, and the test results were recorded. Fluorescence signal intensity was recorded using a fluorescence quantitative PCR instrument equipped with a ROX-Plus detection channel. After each test, the instrument was calibrated and a blank control test was performed to ensure data accuracy.

[0098] Experimental results

[0099] When the kit of the present invention tested 200 samples of known Brucella species, it correctly typed 200 samples, with an accuracy rate of 100%; all 100 negative samples were tested as negative, with a specificity of 100%; in the test of 50 simulated complex samples, 50 samples were correctly detected, with an accuracy rate of 100%. The detection sensitivity reached 10 3 The control kit detected 200 samples of known Brucella species and correctly typed 180 of them, with an accuracy of 90%. 10 of the 100 negative samples were positive, with a specificity of 90%. In the simulated complex sample test, 35 samples were correctly detected, with an accuracy of 70% and a sensitivity of 10. 3 copies / ml, and the average fluorescence signal intensity was 4000±300 (relative units).

[0100] From the above results, it can be seen that the addition of combined surfactants, enhancers, trehalose, BSA, SSB, and MnCl2 to the reaction solution can cooperate with other components to improve signal intensity, tolerance to complex samples, detection sensitivity and specificity, etc.

[0101] The above embodiments are only for illustrating the technical concept and features of the present invention. Their purpose is to enable people familiar with this technology to understand the content of the present invention and implement it accordingly. They are not intended to limit the scope of protection of the present invention. Any equivalent changes or modifications made according to the spirit of the present invention should be included in the scope of protection of the present invention.

Claims

1. A Brucella typing detection kit, characterized in that, The method comprises the following components: a reaction solution, a detection solution, an enzyme mixture, a quantitative standard, a typing standard, and a blank control; the reaction solution comprises: 5×PCR buffer, 50mM MgCl2, 0.5Mm dNTP, 0.1-0.3% (v / v) surfactant, 0.5-2mol / L enhancer, 1-5% (w / v) trehalose, 0.1-1% (w / v) BSA, 0.1-1μg / μL SSB, and 0.1-1mM MnCl2.

2. The Brucella typing detection kit according to claim 1, wherein The surfactant is Tween-20; the enhancer is betaine.

3. The Brucella typing detection kit according to claim 1, wherein The quantitative standard is: Brucella BCSP31 gene fragment connected to a pUC57 plasmid vector, diluted to 10 with sterile purified water. 7 copies / ml, 10 6 copies / ml, 10 5 copies / ml, 10 4 copies / ml, as a quantitative standard.

4. The Brucella typing detection kit according to claim 1, wherein The typing standards are: 4 amplified product fragments of Brucella were connected to 4 pUC57 plasmid vectors respectively, and diluted to 10 6 copies / ml, as typing standard; the blank control was sterile purified water.

5. The Brucella typing detection kit according to claim 1, wherein The enzyme mixture includes: 5U / μl hot start Taq enzyme, 5U / μl DNA UDG enzyme, and 0.1U / μl ExoIII exonuclease; the detection solution contains: Brucella quantitative primer pair and probe P0, bovine Brucella amplification primer pair and probe P1, ovine Brucella amplification primer pair and probe P2, porcine Brucella amplification primer pair and probe P3, and canine Brucella amplification primer pair and probe P4.

6. The Brucella typing detection kit according to claim 5, wherein The Brucella quantitative primer pair includes an upstream primer F0 and a downstream primer R0; the bovine Brucella amplification primer pair includes an upstream primer F1 and a downstream primer R1; the ovine Brucella amplification primer pair includes an upstream primer F2 and a downstream primer R2; the porcine Brucella amplification primer pair includes an upstream primer F3 and a downstream primer R3; and the canine Brucella amplification primer pair includes an upstream primer F4 and a downstream primer R4.

7. The Brucella typing detection kit according to claim 6, wherein The sequence of F0 is GATATTGGCAACCGAGCCAT, and the concentration is 400uM; the sequence of R0 is TATTATCCGATTGGTGGTCT, and the concentration is 400uM; the sequence of P0 is 5'-fluorescent reporter group-GAAATCGCGTTCGCGAT-fluorescent quencher group-3', the fluorescent reporter group labeled at the 5' end is ROX PLUS, and the fluorescent quencher group labeled at the 3' end is BHQ1, and the concentration is 80uM; The sequence of F1 is CACACTCACCTTCCACAACA, and the concentration is 100uM; the sequence of R1 is CCCGTTCTGCACCAGAC, and the concentration is 500uM; the sequence of P1 is 5'-fluorescent reporter group-ACAAGGGTGGAACGACCTTTGCAGGC-fluorescent quencher group-3', the fluorescent reporter group labeled at the 5' end is ROXPLUS, and the fluorescent quencher group labeled at the 3' end is BHQ1, and the concentration is 500uM; The sequence of F2 is TCGYATCGGCAGTTTCAA, and the concentration is 120uM; the sequence of R2 is CAGCTTTTGGCCTTTTCC, and the concentration is 500uM; the sequence of P2 is 5'-fluorescent reporter group-CATGGCCCGCAATCTGGAAAAGG-fluorescent quencher group-3', the fluorescent reporter group labeled at the 5' end is ROX PLUS, and the fluorescent quencher group labeled at the 3' end is BHQ1, and the concentration is 500uM; The sequence of F3 is CAAATATCCATGCGGGAAG, and the concentration is 120uM; the sequence of R3 is TGGGCATTCTCTACGGTG, and the concentration is 650uM; the sequence of P3 is 5'-fluorescent reporter group-CCATAAAGCGCAAAGATCACACCGTAGAGA-fluorescent quencher group-3', the fluorescent reporter group labeled at the 5' end is ROXPLUS, and the fluorescent quencher group labeled at the 3' end is MGB, and the concentration is 650uM; The sequence of F4 is GCACAGGCAGGCGA, and the concentration is 100uM; the sequence of R4 is GACATCACCGTTCACGC, and the concentration is 500uM; the sequence of P4 is 5'-fluorescent reporter group-TCTATCTGGCCAAATATCGCGTGAACGGTGAT-fluorescent quencher group-3', the fluorescent reporter group labeled at the 5' end is ROX PLUS, and the fluorescent quencher group labeled at the 3' end is BHQ1, and the concentration is 500uM; The target sequence for the quantitative detection of Brucella is: GATATTGGCAACCGAGCCATTCGACGAAACGGCCGTCGCGACGAGACCCGGCACGCCCTTTTCGCCTGCGCCGGAAATCGCGTTCGCGATCAGACCACCAATCGGATAATA; The bovine Brucella detection target sequence is: TTGCGAGCGGCAGCACGCTGCAGCTTGGCGATGGCAGCACGGATGGCAGGCTTGCGGGCAATGTGGCCAATGCGGGCACACTCACCTTCCACAACAAGGGTGGAACGACCTTTGCAGGCGAGATCTCCGGCACTGGCAGTCTGGTGCAGAACGGGGCGGGTGCACTGACGCTGAGCGGTGACAGCCAAGGTTTTGCCGGT; The target sequence for Brucella ovis detection is: GGCGCGGTGTTGCCGAAAACGTGAAAGAAGCGGCGAAATGGTATCAGCTTGCCGCCGATCAGGGCTTTGCGCCTGCGCAATATCGCATCGGCAGTTTCAATGAAAAGGGCCTCGGCATGGCCCGCAATCTGGAAAAGGCCAAAAGCTGGTATCAGCTTGCCGCAGATCAGGGCAATGCAAGCGCCATGCACAATCTTGCCGTGCTTTTTGCCACAGGTACAAACGGCACGCCGGATAATGCTGCCGCTGT; The target sequence for detecting Brucella suis is: TCCAAGGCCCGGTTGCAGCAGGAACCAGCCAGCCGCAATGGTCAATATGCCAAATATCCATGCGGGAAGGAAGATTGGGTTCGCAAACCATGCCGCGCCGCCATAAAGCGCAAAGATCACAAAAGCGCAAAGATCACACCGTAGAGAATGCCCACTGCATAGTGGCCGATCCAGCCCAGCGCCACTTCATGACGACAGGG; The canine Brucella detection target sequence is: GATGAATTTCCGCAGGGCCGTAATGTTCACGGTGGCGGCCATCGGCCTTGCCGCCTCCCCGCTTTTCACTGCGCCGGCACAGGCAGGCGAGGCTCGCAAATCCAGAGAGGTCTATCTGGCCAAATATCGCGTGAACGGTGATGTCCGCTATTCCAAGCAGCCGAGAGGCAAACTGATGCGAGTTTCGGTCTCACAATATAGGACCAGCAATTCCTATGTCTGTACGCCAAGCGGCTTCGGCCAGAAATCG.

8. A detection method for typing Brucella using the Brucella typing detection kit according to any one of claims 1 to 7, characterized in that: The steps include: Step S1, using the DNA sample extracted from whole blood as the DNA specimen to be tested, and using a positive control substance and a blank control substance, PCR detection is performed using a Brucella typing detection kit; S2. Data processing: After the reaction is completed, the results are determined by the melting curve of the sample.

9. The detection method according to claim 8, characterized in that The amplification system of the PCR detection fluorescence quantitative PCR in step S1 is as follows: 15 μL of reaction solution, 4 μL of detection solution, 1 μL of enzyme mixture, and 5 μL of DNA sample to be tested; the DNA sample to be tested is any one of a quantitative standard, a typing standard, a blank control, and sample DNA; the reaction conditions of the PCR detection fluorescence quantitative PCR in step S1 are: pre-denaturation at 95°C for 3 minutes; denaturation at 98°C for 10 seconds, annealing and extension at 60°C for 30 seconds, and extension at 72°C for 30 seconds, for a total of 50 cycles; then, a melting curve scan is performed at 95°C for 1 minute, 45°C for 3 minutes, and scanning from 45°C to 85°C at intervals of 1°C. The fluorescence channel selects the detection channel corresponding to the ROX PLUS dye.

10. The detection method according to claim 8, characterized in that The PCR detection in step S1 adopts a segmented temperature change strategy during the PCR reaction process, with the annealing temperature of 1-20 cycles in the early stage being 62° C.; and the annealing temperature of 21-50 cycles in the late stage being 58° C.

Images