Composition, method and application for detecting foodborne pathogens

Abstract

The present invention discloses a composition, method and application for detecting foodborne pathogens, which belongs to the technical field of food safety detection. The present invention has obtained a combination of gDNAs and fluorescent probes suitable for parallel detection of multiple targets through multiple rounds of screening, and at the same time combines LAMP high-efficiency amplification and Pf Taking advantage of the Ago targeted cleavage, a multiple LAMP-based assay was established for three pathogenic bacteria: Staphylococcus aureus, Salmonella, and Listeria monocytogenes. Pf The Ago rapid detection method effectively solves the problem of LAMP multiple detection difficulties. The invention has high specificity and simple result judgment, and the detection limit of pure culture can reach 10 1 CFU / mL, and the detection can be completed within 45 minutes, which has important practical application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of food safety detection, and relates to a composition, method and application for detecting foodborne pathogens. Background Art

[0002] Foodborne pathogens are one of the main causes of foodborne diseases. It can be seen from GB 29921-2021 "National Food Safety Standard Limits of Pathogenic Bacteria in Pre-packaged Foods" and GB 31607-2021 "National Food Safety Standard Limits of Pathogenic Bacteria in Bulk Ready-to-Eat Foods" that Staphylococcus aureus, Salmonella and Listeria monocytogenes are the key pathogens to be monitored in pre-packaged foods and bulk ready-to-eat foods, such as dairy products, meat products, frozen drinks, etc.

[0003] With the rapid development of molecular biology technology, detection methods based on the principle of nucleic acid amplification technology have been widely used in medical diagnosis, pathogen detection, environmental monitoring and other fields, mainly including fluorescent quantitative PCR (qPCR), droplet digital PCR (ddPCR), etc. However, such methods are cumbersome and highly equipment-dependent. Isothermal amplification technology can complete the rapid amplification of DNA at a constant temperature without the need for time-consuming thermal cycling steps. Loop-mediated isothermal amplification (LAMP) relies on 4 to 6 primers that can recognize 6 specific regions on the target DNA and a DNA polymerase with chain displacement activity, which can efficiently amplify nucleic acids under constant temperature conditions. At present, the detection methods of LAMP products mainly include electrophoresis, turbidity and dye methods, which have problems such as long time consumption, false positives and difficulty in multiple detection. Therefore, how to specifically indicate the amplification products of multiple LAMP reactions is a problem that needs to be further solved. Argonaute nucleases are a highly conserved protein family that is widely present in natural organisms, among which Pyrococcus furiosus ( Pyrococcus furiosus ) Pf Ago nuclease is the most studied prokaryotic Argonaute protein. Pf Ago protein can use 5' phosphorylated DNA as a guide to accurately target and cut single-stranded DNA, and the single-stranded DNA product produced by cutting can also be used as a guide to continue to be Pf Ago protein binds and cuts complementary target DNA, and there is no restriction on the specific sequence of the target region. Pf It is unknown whether and how the Ago-based method can be used to simultaneously detect three pathogenic bacteria: Staphylococcus aureus, Salmonella, and Listeria monocytogenes. Pf Based on the characteristics of Ago targeted cleavage, a multiplex LAMP-based assay was established for the simultaneous detection of Staphylococcus aureus, Salmonella, and Listeria monocytogenes. Pf Ago detection technology is of great significance to improving the efficiency of food safety inspection and supervision. Summary of the Invention

[0004] In response to the above-mentioned deficiencies in the prior art, the present invention provides a composition, method and application for detecting foodborne pathogens, aiming to solve the many problems existing in LAMP technology, such as long time consumption, false positives, difficulty in multiple detection, and technical problems that greatly limit the LAMP detection throughput and low specificity.

[0005] The first technical solution provided by the present invention is a composition, which comprises three groups of gDNAs probes; the first group of gDNAs probes is used to specifically detect Staphylococcus aureus, including a first gDNA gF, a first gDNA gT and a first probe, the first gDNA gF sequence is shown in SEQ ID NO: 28, the first gDNA gT sequence is shown in SEQ ID NO: 29, and the first probe sequence is shown in SEQ ID NO: 40; the second group of gDNAs probes is used to specifically detect Salmonella, including a second gDNA gF, a second gDNA gT and a second probe, the second gDNA gF sequence is shown in SEQ ID NO: 45, the second gDNA gT sequence is shown in SEQ ID NO: 46, and the second probe sequence is shown in SEQ ID NO: 53; the third group of gDNAs probes is used to specifically detect Listeria monocytogenes, including a third gDNA gF, a third gDNA gT and a third probe, the third gDNA gF sequence is shown in SEQ ID NO: 80, the third gDNA gT sequence is shown in SEQ ID NO: 81, and the third probe sequence is shown in SEQ ID NO: 92.

[0006] In certain embodiments, the 5' end of the gDNAs is phosphorylated.

[0007] In certain embodiments, the 5' end of the probe is modified with a fluorescent reporter group, and the 3' end of the probe is modified with a quencher group.

[0008] In certain embodiments, the fluorescent reporter group is selected from FAM, HEX, JOE, CY3, and CY5, and the quencher group is selected from DABCYL, TAMRA, and BHQ.

[0009] In certain embodiments, the 5' end of the first probe is modified with a fluorescent reporter group FAM, the 5' end of the second probe is modified with a fluorescent reporter group HEX, and the 5' end of the third probe is modified with a fluorescent reporter group CY5.

[0010] The second technical solution provided by the present invention is a kit for detecting foodborne pathogens, which includes the composition described in the first technical solution and a LAMP amplification composition.

[0011] In certain embodiments, the foodborne pathogens include Staphylococcus aureus, Salmonella, and Listeria monocytogenes.

[0012] In certain embodiments, the LAMP amplification system composition includes three sets of primer pairs; the first set of primer pairs is used to specifically amplify Staphylococcus aureus, including first outer primers F3 and B3, first inner primers FIP and BIP, the first outer primer F3 sequence is shown in SEQ ID NO: 1, the first outer primer B3 sequence is shown in SEQ ID NO: 2, the first inner primer FIP sequence is shown in SEQ ID NO: 3, and the first inner primer BIP sequence is shown in SEQ ID NO: 4; the second set of primer pairs is used to specifically amplify Salmonella, including second outer primers F3 and B3, second inner primers FIP and BIP, second loop primers LF and LB, the second outer primer F3 sequence is shown in SEQ ID NO: 5, the second outer primer B3 sequence is shown in SEQ ID NO: 6, the second inner primer FIP sequence is shown in SEQ ID NO: 7, the second inner primer BIP sequence is shown in SEQ ID NO: 8, the second loop primer LF sequence is shown in SEQ ID NO: 9, and the second loop primer LB sequence is shown in SEQ ID NO: 10. NO:10; the third group of primer pairs is used to specifically amplify Listeria monocytogenes, including third outer primers F3 and B3, third inner primers FIP and BIP, the sequence of the third outer primer F3 is shown in SEQ ID NO:11, the sequence of the third outer primer B3 is shown in SEQ ID NO:12, the sequence of the third inner primer FIP is shown in SEQ ID NO:13, and the sequence of the third inner primer BIP is shown in SEQ ID NO:14.

[0013] In certain embodiments, the kit further comprises a LAMP amplification reagent and Pf Ago detection reagent.

[0014] In certain embodiments, the LAMP amplification reagent includes 10× isothermal amplification buffer II, MgSO 4 , dNTPMix, and Bst 3.0 DNA polymerase.

[0015] In certain embodiments, the PfAgo detection reagents include MnCl2, 10× Pf Ago endonuclease reaction buffer and Pf Ago endonuclease.

[0016] In certain embodiments, the kit further comprises positive controls for Staphylococcus aureus, Salmonella, and Listeria monocytogenes.

[0017] The third technical solution provided by the present invention is a method for detecting foodborne pathogens for non-disease diagnosis purposes, which comprises detecting foodborne pathogens using the kit described in the second technical solution.

[0018] In certain embodiments, the foodborne pathogens include Staphylococcus aureus, Salmonella, and Listeria monocytogenes.

[0019] In certain embodiments, the method comprises the steps of:

[0020] (1) Extract genomic DNA from the sample to be tested or directly dilute the sample to be tested;

[0021] (2) constructing a multiplex LAMP amplification system using the LAMP amplification composition to perform LAMP amplification;

[0022] (3) The LAMP amplification product obtained in step (2) is used to construct a multiplex Pf Ago detection system, enzyme digestion and fluorescence detection.

[0023] In certain embodiments, in the multiplex LAMP amplification system, the final concentrations of the first inner primers FIP and BIP, the first outer primers F3 and B3, the second inner primers FIP and BIP, the second outer primers F3 and B3, the second loop primers LF and LB, the third inner primers FIP and BIP, and the third outer primers F3 and B3 are 0.6 μM, 0.1 μM, 0.3 μM, 0.05 μM, 0.1 μM, 0.3 μM, and 0.05 μM, respectively.

[0024] Furthermore, the total volume of the multiplex LAMP amplification system was 25 μL, 10× isothermal amplification buffer II 2.5 μL, 100 mM MgSO4 1 μL, 10 mM dNTP Mix 3.75 μL, 10 μM first inner primers FIP and BIP were added 1.5 μL respectively, 10 μM first outer primers F3 and B3 were added 0.25 μL respectively, 10 μM second inner primers FIP and BIP were added 0.75 μL respectively, 10 μM second outer primers F3 and B3 were added 0.125 μL respectively, 10 μM second loop primers LF and LB were added 0.25 μL respectively, 10 μM third inner primers FIP and BIP were added 0.75 μL respectively, 10 μM third outer primers F3 and B3 were added 0.125 μL respectively, 8000 U / mL Bst 3.0 DNA polymerase 0.75 μL, and the nucleic acid to be detected 2 µL, add ddH2O to make up to 25 µL; the amplification program is 68 ℃, 30 min.

[0025] In certain embodiments, in the multiple Pf In the Ago detection system, the final concentrations of the first gDNA gF, the first gDNA gT, the first probe, the second gDNA gF, the second gDNA gT, the second probe, the third gDNA gF, the third gDNA gT, and the third probe were all 0.5 μM.

[0026] Furthermore, the multiple Pf The total volume of the Ago detection system was 20 μL. 0.5 μL of 20 μM first gDNA gF and gDNA gT were added, 0.5 μL of 20 μM first probe was added, 0.5 μL of 20 μM second gDNA gF and gDNA gT were added, 0.5 μL of 20 μM second probe was added, 0.5 μL of 20 μM third gDNA gF and gDNA gT were added, 0.5 μL of 20 μM third probe was added, 0.5 μL of 40 mM MnCl2, 10× Pf 2 μL of Ago endonuclease reaction buffer, 200 U / μL of Pf 2 μL of Ago endonuclease and 2 μL of LAMP product were added to 20 μL with ddH2O; the fluorescence detection conditions were 95°C for 15 min.

[0027] The fourth technical solution provided by the present invention is the use of the composition described in the first technical solution in the preparation of a product for detecting foodborne pathogens.

[0028] In certain embodiments, the foodborne pathogens include Staphylococcus aureus, Salmonella, and Listeria monocytogenes.

[0029] Compared with the prior art, the technical effects of the present invention are as follows:

[0030] (1) The present invention effectively combines the high efficiency amplification of LAMP and Pf The advantages of Ago targeted cleavage were used to establish a multiple LAMP-based assay for three pathogenic bacteria: Staphylococcus aureus, Salmonella, and Listeria monocytogenes. Pf Ago rapid detection method has the advantages of high throughput and low equipment requirements. Compared with LAMP technology, Pf Ago can target and cut complementary single-stranded DNA, effectively reducing false positives. Compared with CRISPR / Cas technology, Argonaute / Pf Ago technology only requires one nuclease to achieve simultaneous detection of multiple targets, with a wider range of applications and greater stability.

[0031] (2) The present invention selects gF4 / gT4, gF7 / gT7, and gF11 / gT11 with better effects among the 12 gDNAs of Staphylococcus aureus through step-by-step screening of gDNAs of three pathogenic bacteria; selects gF1 / gT1, gF2 / gT2, and gF3 / gT3 with better effects among the 12 gDNAs of Salmonella; and selects gF3 / gT3, gF4 / gT4, and gF7 / gT7 with better effects among the 12 gDNAs of Listeria monocytogenes. Based on the above single reaction results, a three-factor three-level orthogonal test was used to determine that the optimal gDNA combination is combination 4, which can ensure the best gDNA combination in the triple LAMP- Pf Accurate detection of samples is achieved under the Ago reaction system.

[0032] (3) This invention combines multiple LAMP- Pf Ago technology was applied to the simultaneous detection of Staphylococcus aureus, Salmonella, and Listeria monocytogenes, and detection was completed within 45 minutes. The method has good specificity. Among the 67 experimental strains, only the target bacteria can produce fluorescent signals, and other negative control bacteria have no amplification phenomenon. It is also highly sensitive, and the detection limit of pure cultures can reach 10 1 In addition, the results of the present invention are simple to determine, without the need for tedious electrophoresis operations, and can be used with portable fluorescence detection equipment to meet the needs of rapid on-site detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The cleavage effects of different gDNAs on LAMP amplification products; A: Staphylococcus aureus; B: Salmonella; C: Listeria monocytogenes.

[0034] Figure 2 For triple LAMP- Pf Ago's gDNAs screening results; A: gDNAs combination 1; B: gDNAs combination 2; C: gDNAs combination 3; D: gDNAs combination 4; E: gDNAs combination 5; F: gDNAs combination 6; G: gDNAs combination 7; H: gDNAs combination 8; I: gDNAs combination 9.

[0035] Figure 3 Optimization of triple LAMP reaction conditions; A-C: primer ratio optimization; D-F: reaction temperature optimization; G-I: Mg 2+ concentration optimization; J~L: dNTPs concentration optimization; M~O: Bst 3.0 DNA polymerase concentration optimization; Among them, A, D, G, J, and M represent Staphylococcus aureus in the triple LAMP reaction; B, E, H, K, and N represent Salmonella in the triple LAMP reaction; C, F, I, L, and O represent Listeria monocytogenes in the triple LAMP reaction.

[0036] Figure 4 For triple Pf Optimization of Ago cleavage conditions; A-C: Optimization of LAMP amplification product dosage; D-F: Optimization of MnCl2 concentration; G-I: Pf Ago enzyme concentration optimization; J~L: fluorescent probe concentration optimization; A, D, G, J are triple Pf Staphylococcus aureus in Ago cleavage; B, E, H, K are triple Pf Salmonella in Ago cleavage; C, F, I, L are triple Pf Listeria monocytogenes in Ago cleavage.

[0037] Figure 5 For triple LAMP- Pf Ago detection results.

[0038] Figure 6 For triple LAMP- Pf Ago sensitivity evaluation results; A~C are triple LAMP- Pf Ago detection of Staphylococcus aureus, Salmonella and Listeria monocytogenes. DETAILED DESCRIPTION

[0039] The following describes preferred embodiments of the present invention. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0040] Materials used in the examples:

[0041] The main reagents and culture media used in the examples: 10× isothermal amplification buffer II, MgSO4 (100 mM), and Bst3.0 DNA polymerase were all purchased from New England Biolabs; dNTP Mix (10 mM each) was purchased from Beijing Solebao Technology Co., Ltd.; Syto 9 Green fluorescent dye was purchased from Invitrogen; 10× Pf Ago endonuclease reaction buffer, MnCl2 (40 mM), Pf Ago endonuclease (200 U / μL) was purchased from Beijing Baoying Tonghui Biotechnology Co., Ltd.; 3% sodium chloride alkaline peptone water (APW) and LB broth were purchased from Beijing Luqiao Technology Co., Ltd.

[0042] The main instruments and equipment used in the examples are: KB240 low-temperature incubator (Binder, Germany); TS-200B constant temperature shaker (Shanghai Tiancheng Laboratory Instrument Manufacturing Co., Ltd.); 1-14 tabletop centrifuge (Sigma, Germany); Bagmixer 400 slap-type homogenizer (Interscience, France); 1300 series A2 biological safety cabinet (Thermo Fisher Scientific, USA); CFX96 real-time fluorescence quantitative PCR instrument (Bio-Rad, USA).

[0043] Example 1: Establishment of LAMP detection method

[0044] LAMP primers were designed using the online software PrimerExplorer V5 based on conserved regions of specific target genes for Staphylococcus aureus (SA), Salmonella (SAL), and Listeria monocytogenes (LM). All primers were synthesized by Nanjing GenScript Biotechnology Co., Ltd. The specific primer sequences are as follows:

[0045] SA-F3 (first outer primer): TTGTGAAAAGTTGAGTACTGTT (SEQ ID NO: 1);

[0046] SA-B3 (first outer primer): TAGAGGCGCCAATCATTG (SEQ ID NO: 2);

[0047] SA-FIP (first inner primer):

[0048] TCTTGATGGGGAAATCAGTGGACATGATACATTTCCATCACGC (SEQ ID NO: 3);

[0049] SA-BIP (first inner primer):

[0050] ACCCGCCTTGACTGATCATGTGAATGTTCAGGCATCAGAT (SEQ ID NO: 4);

[0051] SAL-F3 (second outer primer): GCGAAGCGTACTGGAAAGG (SEQ ID NO: 5);

[0052] SAL-B3 (second outer primer): TCAACAATGCGGGGATCTG (SEQ ID NO: 6);

[0053] SAL-FIP (second inner primer):

[0054] ATGATGCCGGCAATAGCGTCACAAAGCCAGCTTTACGGTTCC (SEQ ID NO:7);

[0055] SAL-BIP (second inner primer):

[0056] GGATGACCCGCCATGGTATGGACCATCACCAATGGTCAGC (SEQ ID NO: 8);

[0057] SAL-LF (second loop primer): AAACTTCATCGCACCGTCAAA (SEQ ID NO: 9)

[0058] SAL-LB (second loop primer): ATTTGTCCTCCGCTCTGTCT (SEQ ID NO: 10)

[0059] LM-F3 (third outer primer): CAGATGGAAAAATTAACATCGATCA (SEQ ID NO: 11);

[0060] LM-B3 (third outer primer): AAGCTAAACCAGTGCATTC (SEQ ID NO: 12);

[0061] LM-FIP (third inner primer):

[0062] TGAACAATTTCGTTACCTTCAGGATCTCTGGAGGATACGTTGC (SEQ ID NO: 13);

[0063] LM-BIP (third inner primer):

[0064] TAGCTCATTTCACATCGTCCATCTAGCGTAAACATTAATATTTCTCGC (SEQ ID NO: 14).

[0065] The above primers were added to the following system for reaction: 2.5 μL of 10× isothermal amplification buffer II, 1 μL of 100 mM MgSO4, 3.5 μL of 10 mM dNTP Mix, 0.75 μL of 10 μM first inner primers FIP and BIP, 0.125 μL of 10 μM first outer primers F3 and B3, 0.75 μL of 10 μM second inner primers FIP and BIP, 0.125 μL of 10 μM second outer primers F3 and B3, 0.25 μL of 10 μM second loop primers LF and LB, 0.75 μL of 10 μM third inner primers FIP and BIP, 0.125 μL of 10 μM third outer primers F3 and B3, 0.75 μL of 8000 U / mL Bst 3.0 DNA polymerase, and 2 μL of nucleic acid to be detected. µL, add ddH2O to make up to 25 µL; the amplification program is 65 ℃, 30 min.

[0066] Example 2: Screening of gDNAs

[0067] 1. gDNAs design

[0068] 12 pairs of gDNAs (gF and gT) were designed for LAMP amplification products. gF and gT mediated Pf Ago cuts one single strand of the double-stranded DNA, thereby obtaining a single-stranded DNA with a 5' phosphate group, namely the newly generated gDNA (gN). Pf Ago targets and cleaves complementary fluorescent probes, and the resulting fluorescent signal is detected. Fluorescent probe Pb1 was used in combination with gF1-gT1, gF2-gT2, gF3-gT3, gF4-gT4, gF5-gT5, and gF6-gT6, respectively; fluorescent probe Pb2 was used in combination with gF7-gT7, gF8-gT8, gF9-gT9, gF10-gT10, gF11-gT11, and gF12-gT12, respectively. All gDNAs and fluorescent probes used were synthesized by Nanjing GenScript Biotechnology Co., Ltd., as shown in Tables 1 to 3.

[0069] Table 1 gDNAs and fluorescent probes used for detection of Staphylococcus aureus

[0070]

[0071] Table 2 gDNAs and fluorescent probes for detection of Salmonella

[0072]

[0073] Table 3 gDNAs and fluorescent probes used for detection of Listeria monocytogenes

[0074]

[0075] First, 12 pairs of gDNAs were added to the following system for reaction: 20 μM of the first gDNA gF and gDNA gT were added to 0.5 μL respectively, 20 μM of the first probe was added to 0.5 μL, 20 μM of the second gDNA gF and gDNA gT were added to 0.5 μL respectively, 20 μM of the second probe was added to 0.5 μL, 20 μM of the third gDNA gF and gDNA gT were added to 0.5 μL respectively, 20 μM of the third probe was added to 0.5 μL, 40 mM MnCl2 0.5 μL, 10× Pf 2 μL of Ago endonuclease reaction buffer, 200 U / μL of Pf 3 μL of Ago endonuclease and 4 μL of LAMP product were added to 20 μL with ddH2O. The fluorescence detection conditions were 95°C for 15 min.

[0076] like Figure 1 As shown, different gDNAs mediated Pf The rates at which Ago cleavage reactions produce fluorescent signals vary significantly. For Staphylococcus aureus, SA-gF4 / gT4, SA-gF7 / gT7, and SA-gF11 / gT11 showed the highest cleavage efficiency, all producing fluorescent signals within 2 minutes. For Salmonella, SAL-gF1 / gT1, SAL-gF2 / gT2, and SAL-gF3 / gT3 showed the highest cleavage efficiency, all producing fluorescent signals within 3 minutes. For Listeria monocytogenes, LM-gF3 / gT3, LM-gF4 / gT4, and LM-gF7 / gT7 showed the highest cleavage efficiency, all producing fluorescent signals within 2 minutes, and were used as candidate gDNAs.

[0077] 2. Determination of the optimal combination of gDNAs

[0078] Single-plex LAMP-based assays for Staphylococcus aureus, Salmonella, and Listeria monocytogenes PfAgo gDNAs have been screened, but the results of their combination are not yet known. Therefore, three primary screening gDNAs of Staphylococcus aureus (SA-gF4 / gT4, SA-gF7 / gT7, SA-gF11 / gT11), three primary screening gDNAs of Salmonella (SAL-gF1 / gT1, SAL-gF2 / gT2 and SAL-gF3 / gT3) and three primary screening gDNAs of Listeria monocytogenes (LM-gF3 / gT3, LM-gF4 / gT4 and LM-gF7 / gT7) were used to screen the gDNAs. 3 ) Orthogonal experiment, 9 different combinations were set (Table 4).

[0079] Table 4 gDNAs combination scheme

[0080]

[0081] Multiplex LAMP-based assays of gDNAs from three foodborne pathogens Pf Ago test results are as follows Figure 2 As shown, all 9 combinations of positive controls can generate fluorescent signals. For Staphylococcus aureus, no obvious fluorescence curves were observed in the no-template controls of all combinations. For Salmonella, except for combination 9 ( Figure 2 Except for the template-free control in the other combinations, no obvious fluorescence curves were found. Figure 2 A), combination 2 ( Figure 2 B), combination 3 ( Figure 2 C), combination 5 ( Figure 2 E), combination 6 ( Figure 2 F), combination 7 ( Figure 2 G), combination 8 ( Figure 2 H) and combination 9 ( Figure 2 The template-free controls of I) all produced obvious fluorescent signals (false positive results). Therefore, combination 4 ( Figure 2 D) as a multiplex LAMP- Pf Optimal gDNAs combination for Ago detection.

[0082] Example 3: Multiple LAMP- Pf Ago method establishment

[0083] 1. LAMP reaction system optimization

[0084] (1) Primer ratio optimization: Referring to the reaction system of Example 1, the primer ratios of Staphylococcus aureus, Salmonella and Listeria monocytogenes were set to 1:1:1, 2:1:1, 3:1:1 and 4:1:1. Figure 3As shown in Figures A to C, when the primer ratio is 2:1:1, the fluorescence curves of the three pathogens all peak earlier. However, when the primer ratio is 1:1:1, Staphylococcus aureus does not produce a fluorescence curve ( Figure 3 A). Taking into account the peak time and fluorescence intensity, 2:1:1 was selected as the optimal primer ratio.

[0085] (2) Reaction temperature optimization: Referring to the reaction system of Example 1, the temperature was set to 62 ℃, 65 ℃, 68 ℃, and 71 ℃. When the reaction temperature was 62 ℃ and 65 ℃, Staphylococcus aureus did not produce a fluorescence curve ( Figure 3 When the temperature is too high (71 ℃), Listeria monocytogenes cannot produce a fluorescence curve ( Figure 3 Therefore, 68 °C was selected as the optimal reaction temperature for LAMP.

[0086] (3) Mg 2+ Concentration optimization: refer to the reaction system of Example 1 and set Mg 2+ The concentrations are 2mM, 3mM, 4mM, and 6mM. Figure 3 It can be seen from G~I that when Mg 2+ When the concentration was 4 mM, the fluorescence curves of the three pathogens all peaked earlier. At other concentrations, Staphylococcus aureus did not produce a fluorescence curve, so 4 mM Mg 2+ This is the optimal concentration for the LAMP detection system.

[0087] (4) Optimization of dNTPs concentration: Referring to the reaction system of Example 1, the dNTPs concentrations were set to 1.3 mM, 1.4 mM, 1.5 mM, and 1.7 mM. When the dNTPs concentration was 1.3 mM, Staphylococcus aureus ( Figure 3 J) and Listeria monocytogenes ( Figure 3 The peak time of LAMP was late and the fluorescence intensity was not high. When the dNTP concentration was 1.5 mM, the peak time was the earliest, so 1.5 mM was selected as the optimal dNTP concentration for LAMP detection.

[0088] (5) Optimization of the amount of Bst 3.0 DNA polymerase added: Referring to the reaction system in Example 1, the amount of Bst 3.0 DNA polymerase added was set to 0.5 μL (160 U / mL), 0.75 μL (240 U / mL), 1 μL (320 U / mL), and 1.25 μL (400 U / mL). Figure 3As shown in the M~O plot, high Bst DNA polymerase concentrations significantly delayed the peak fluorescence curve of Staphylococcus aureus, and the no-template control produced a false-positive signal. Considering both amplification efficiency and assay cost, 240 U / mL was selected as the optimal Bst DNA polymerase concentration for LAMP assays.

[0089] 2. Pf Optimization of Ago cutting system

[0090] (1) Optimization of the amount of LAMP amplification product: Referring to the reaction system in Example 2, the amount of LAMP product was set to 2 μL, 4 μL, 6 μL, and 8 μL. Figure 4 As shown in Figures A to C, when the amount of LAMP product was 2 μL and 4 μL, the fluorescence production rate and fluorescence intensity of the three pathogens were high. As the amount of product added increased, the peak time of the fluorescence curve gradually prolonged, indicating that excessive LAMP product would inhibit the Pf Ago cleavage reaction efficiency. Therefore, the amount of LAMP amplification product was determined to be 2 μL.

[0091] (2) Optimization of MnCl2 concentration: Referring to the reaction system of Example 2, the MnCl2 concentration was set to 0.5 mM, 1 mM, 1.5 mM, and 2 mM. Figure 4 It can be seen from D~F that with the increase of MnCl2 concentration, the peak time of the fluorescence curve gradually prolonged, indicating that excessive MnCl2 cannot improve Pf Ago cleavage reaction efficiency. When the MnCl2 concentration is 1 mM, the reaction peak time is the earliest, so 1 mM MnCl2 is selected as the optimal concentration of the cleavage system.

[0092] (3) Pf Ago enzyme concentration optimization: refer to the reaction system of Example 2, set Pf The concentration of Ago enzyme is 10 U / µL, 15 U / µL, 20 U / µL, and 30 U / µL. Figure 4 As shown in G~I, when Pf When the concentration of Ago enzyme was 10 U / μL and 20 U / μL, Staphylococcus aureus did not produce a fluorescence curve, and the peak time of the fluorescence curve of Listeria monocytogenes was significantly delayed. Considering the amplification efficiency and detection cost, 30 U / μL was selected as Pf Optimal enzyme concentration for Ago cleavage reaction.

[0093] (4) Optimization of fluorescent probe concentration: Referring to the reaction system of Example 2, the probe concentrations were set to 0.375 μM, 0.75 μM, 1.125 μM, and 1.875 μM. Figure 4As shown in Figures J–L, the fluorescence signal gradually increases with increasing probe dosage, reaching a plateau after 10 minutes of reaction. Taking into account both fluorescence signal intensity and assay cost, 0.75 μM fluorescent probe was selected as the optimal concentration for the cleavage system.

[0094] 3. Determine multiple LAMP- Pf Ago detection conditions

[0095] The optimal LAMP reaction protocol is as follows: 2.5 μL of 10× isothermal amplification buffer II, 1 μL of 100 mM MgSO4, 3.75 μL of 10 mM dNTP Mix, 1.5 μL of 10 μM first inner primers FIP and BIP, 0.25 μL of 10 μM first outer primers F3 and B3, 0.75 μL of 10 μM second inner primers FIP and BIP, 0.125 μL of 10 μM second outer primers F3 and B3, 0.25 μL of 10 μM second loop primers LF and LB, 0.75 μL of 10 μM third inner primers FIP and BIP, 0.125 μL of 10 μM third outer primers F3 and B3, 0.75 μL of 8000 U / mL Bst 3.0 DNA polymerase, 2 μL of nucleic acid to be detected. µL, add ddH2O to make up to 25 µL; the amplification program is 68 ℃, 30 min.

[0096] Pf Optimal Ago cleavage protocol: 20 μM first gDNA gF and gDNA gT were added to 0.5 μL, 20 μM first probe was added to 0.5 μL, 20 μM second gDNA gF and gDNA gT were added to 0.5 μL, 20 μM second probe was added to 0.5 μL, 20 μM third gDNA gF and gDNA gT were added to 0.5 μL, 20 μM third probe was added to 0.5 μL, 40 mM MnCl2 0.5 μL, 10× Pf 2 μL of Ago endonuclease reaction buffer, 200 U / μL of Pf 2 μL of Ago endonuclease and 2 μL of LAMP product were added to 20 μL with ddH2O; the fluorescence detection conditions were 95°C for 15 min.

[0097] Using the best multiple LAMP- Pf Ago conditions were used to detect Staphylococcus aureus, Salmonella and Listeria monocytogenes. Figure 5It can be seen that the three pathogens can all produce smooth S-shaped fluorescence curves without interfering with each other, and the corresponding blank controls do not show any fluorescence signals, indicating that a multiple LAMP-based multi-target simultaneous detection method has been successfully constructed. Pf Ago detection method.

[0098] Example 4: Multiple LAMP- Pf Ago specificity verification

[0099] The genomic DNA of 25 standard strains and 42 isolated strains stored in our laboratory was used as templates and the multiple LAMP- Pf The results of the method specificity evaluation are shown in Table 5. All 21 Staphylococcus aureus positive strains, 22 Salmonella positive strains, and 9 Listeria monocytogenes positive strains produced fluorescent signals, while the remaining non-target negative strains did not produce fluorescent signals, indicating that the constructed multiple LAMP- Pf The Ago method has good specificity.

[0100] Table 5 Bacteria used for specificity verification and test results

[0101]

[0102] Note: ATCC (American Type Culture Collection), American Type Culture Collection; CICC (China Center of Industrial Culture Collection), China Center for Industrial Microbiology Collection; CMCC (China Medical Culture Collection). Note: "+" indicates a positive result; "-" indicates a negative result.

[0103] Example 5: Multiple LAMP- Pf Ago sensitivity test

[0104] Take the bacterial solution cultured to the logarithmic growth phase and dilute it tenfold with sterile saline to 10 -8 , select 10 -6 , 10 -7 and 10 -8 Three dilutions were plate counted. Pf In the sensitivity evaluation of the Ago method, the concentrations of Staphylococcus aureus, Salmonella, and Listeria monocytogenes were 1.42×10 8 CFU / mL, 1.86×10 8 CFU / mL and 1.23×10 8CFU / mL. The three bacterial solutions were evenly mixed in a 1:1:1 ratio and then diluted tenfold. DNA was extracted from each gradient dilution using the boiling method and used as a template for multiple LAMP- Pf Ago detection was used to determine the minimum detection limit of the method.

[0105] like Figure 6 As shown in the figure, compared with the blank control, the bacterial concentrations at which Staphylococcus aureus, Salmonella and Listeria monocytogenes produced the lowest fluorescence signals were 1.42×10 1 CFU / mL, 1.86×10 1 CFU / mL, 1.23×10 1 CFU / mL. When the bacterial concentration decreases to 10 0 CFU / mL, no obvious fluorescent signal was produced. Therefore, multiple LAMP- Pf The detection limit of the Ago method was 10 1 CFU / mL.

[0106] Example 6: Detection of artificially contaminated samples

[0107] Prepare salmon that has been tested negative for Staphylococcus aureus, Salmonella and Listeria monocytogenes according to GB 4789.10-2016 "National Food Safety Standard Food Microbiology Examination Staphylococcus aureus", GB 4789.4-2024 "National Food Safety Standard Food Microbiology Examination Salmonella" and GB4789.30-2016 "National Food Safety Standard Food Microbiology Examination Listeria monocytogenes". Weigh 25 g of the sample and add 10 2 ~10 7 Prepare artificial contaminated samples by adding 2.5 mL of mixed bacterial suspension of target bacteria at 10 CFU / mL. Add 225 mL of LB broth to the artificial contaminated samples and homogenize to a 1:10 sample solution (the bacterial solution dilution ratio is 1:100). Incubate at 36°C ± 1°C with shaking for 0 h, 2 h, and 4 h. Simultaneously, add sterile water to the samples as a negative control. Pipette the homogenate into a 1.5 mL centrifuge tube for multiple LAMP- Pf Ago detection.

[0108] As shown in Table 6, without culture, multiple LAMP- Pf The minimum detectable initial inoculum size of the Ago method was 1.70×10 1 CFU / mL, 1.80×10 1 CFU / mL, 2.04×10 1CFU / mL of Staphylococcus aureus, Salmonella and Listeria monocytogenes. After culturing for 2 h, the initial inoculum size of Staphylococcus aureus, Salmonella and Listeria monocytogenes was 1.70×10 0 CFU / mL, 1.80×10 0 CFU / mL, 2.04×10 0 Salmon samples with 100 CFU / mL can be detected. Furthermore, blank controls with incubation times of 0, 2, and 4 hours showed no detection of the target bacteria. Therefore, in actual sample testing, an appropriate pre-enrichment step can be selected based on time requirements.

[0109] Table 6 Test results of artificially contaminated samples

[0110]

[0111] Note: “+” indicates detection; “-” indicates non-detection.

[0112] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A kit for detecting foodborne pathogens, characterized in that: The kit includes a LAMP amplification composition and Pf The Ago cleavage composition, the LAMP amplification composition includes three sets of primer pairs; the first set of primer pairs is used for specifically amplifying Staphylococcus aureus, including first outer primers F3 and B3, first inner primers FIP and BIP, the first outer primer F3 sequence is shown in SEQ ID NO: 1, the first outer primer B3 sequence is shown in SEQ ID NO: 2, the first inner primer FIP sequence is shown in SEQ ID NO: 3, and the first inner primer BIP sequence is shown in SEQ ID NO: 4; the second set of primer pairs is used for specifically amplifying Salmonella, including second outer primers F3 and B3, second inner primers FIP and BIP, second loop primers LF and LB, the second outer primer F3 sequence is shown in SEQ ID NO: 5, the second outer primer B3 sequence is shown in SEQ ID NO: 6, the second inner primer FIP sequence is shown in SEQ ID NO: 7, the second inner primer BIP sequence is shown in SEQ ID NO: 8, the second loop primer LF sequence is shown in SEQ ID NO: 9, and the second loop primer LB sequence is shown in SEQ ID NO:

10. NO: 10; a third set of primer pairs for specifically amplifying Listeria monocytogenes, comprising third outer primers F3 and B3, and third inner primers FIP and BIP, the sequence of the third outer primer F3 being shown in SEQ ID NO: 11, the sequence of the third outer primer B3 being shown in SEQ ID NO: 12, the sequence of the third inner primer FIP being shown in SEQ ID NO: 13, and the sequence of the third inner primer BIP being shown in SEQ ID NO: 14; described Pf The Ago cleavage composition contains three sets of gDNAs probes; The first group of gDNAs probes is used to specifically detect Staphylococcus aureus, including a first gDNA gF, a first gDNA gT and a first probe, the first gDNA gF sequence is shown as SEQ ID NO:28, the first gDNA gT sequence is shown as SEQ ID NO:29, and the first probe sequence is shown as SEQ ID NO:40; the second group of gDNAs probes is used to specifically detect Salmonella, including a second gDNA gF, a second gDNA gT and a second probe, the second gDNA gF sequence is shown as SEQ ID NO:45, the second gDNA gT sequence is shown as SEQ ID NO:46, and the second probe sequence is shown as SEQ ID NO:53; the third group of gDNAs probes is used to specifically detect Listeria monocytogenes, including a third gDNA gF, a third gDNA gT and a third probe, the third gDNA gF sequence is shown as SEQ ID NO:80, the third gDNAgT sequence is shown as SEQ ID NO:81, and the third probe sequence is shown as SEQ ID NO:

92.

2. The kit according to claim 1, wherein The 5' end of the gDNAs is phosphorylated.

3. The kit according to claim 1, wherein The 5' end of the probe is modified with a fluorescent reporter group, and the 3' end of the probe is modified with a quencher group.

4. The kit according to claim 3, wherein The fluorescent reporter group is selected from FAM, HEX, JOE, CY3, and CY5, and the quencher group is selected from DABCYL, TAMRA, and BHQ.

5. The kit according to claim 1, wherein The kit also includes LAMP amplification reagents and Pf Ago detection reagent; The LAMP amplification reagent includes 10× isothermal amplification buffer II, MgSO4, dNTP Mix and Bst 3.0 DNA polymerase; Pf Ago detection reagents include MnCl2, 10× Pf Ago endonuclease reaction buffer and Pf Ago endonuclease.

6. A method for detecting foodborne pathogens for non-disease diagnosis purposes, characterized in that: The method comprises detecting foodborne pathogens using the kit according to any one of claims 1 to 5.

7. The method according to claim 6, characterized in that The method comprises the following steps: (1) Extract genomic DNA from the sample to be tested or directly dilute the sample to be tested; (2) constructing a LAMP amplification system using the LAMP amplification composition to perform LAMP amplification; (3) The LAMP amplification product obtained in step (2) is used Pf Ago cleavage composition construction multiple Pf Ago detection system, enzyme digestion and fluorescence detection.

8. The method according to claim 7, wherein In the multiplex LAMP amplification system, the final concentrations of the first inner primers FIP and BIP, the first outer primers F3 and B3, the second inner primers FIP and BIP, the second outer primers F3 and B3, the second loop primers LF and LB, the third inner primers FIP and BIP, and the third outer primers F3 and B3 are 0.6 μM, 0.1 μM, 0.3 μM, 0.05 μM, 0.1 μM, 0.3 μM, and 0.05 μM, respectively; In the multiple Pf In the Ago detection system, the final concentrations of the first gDNA gF, the first gDNA gT, the first probe, the second gDNA gF, the second gDNA gT, the second probe, the third gDNA gF, the third gDNA gT, and the third probe were all 0.5 μM.

9. Use of the kit according to any one of claims 1 to 5, or the method according to any one of claims 6 to 8, in in vitro detection of foodborne pathogens.

Images