Genetic all-male tilapia breeding method

Abstract

The invention discloses a genetic all-male tilapia mossambica breeding method, and belongs to the technical field of tilapia mossambica breeding. According to the method, a key enzyme gene hsd17b1 for estrogen synthesis is taken as a target spot, a gene editing strategy is adopted, specific sgRNA is designed on a first exon and a second exon of the hsd17b1 gene, a large-fragment knockout mutant is constructed through embryo microinjection, a homozygous F2 generation individual with double target spots and large-fragment knockout is obtained through hybridization screening, a mutant line with genetic stability is successfully constructed, and the mutant line with the genetic stability is obtained. And performing high-temperature treatment on the female fish of the homozygous mutation line in a sex differentiation key window period, and inducing the gonad of the female fish to be completely masculinized, so as to finally obtain all-male fish fry groups with the genetic sex of XX and the phenotypic functions of male fish fries. The male and female mutant adult fishes are fertile, so that a large number of fertile homozygous mutant male and female parent fishes can be maintained, the homozygous mutant fish fries can be produced on a large scale, and the bottleneck that the parents cannot be continuously bred due to traditional gene editing is broken through.

Description

Technical Field

[0001] The present invention relates to the technical field of tilapia breeding, and more particularly to a method for breeding genetically all-male tilapia. Background Art

[0002] Nile tilapia ( Oreochromis niloticus Nile tilapia is a species recommended by the Food and Agriculture Organization of the United Nations as an excellent aquaculture species worldwide. Its low bone count and rich omega-3 fatty acid content make it a promising alternative to overfished fish. China, the world's largest tilapia producer, produces over 1.6 million tons annually, generating over US$1 billion in foreign exchange. By integrating sex-controlled breeding with gene editing technology, China is poised to establish an all-male, high-yield tilapia farming system, driving cost reduction and efficiency gains in the aquaculture industry while contributing to global food security and sustainable development goals. Nile tilapia exhibits a typical XX / XY sex determination pattern, with males growing faster than females. The direction of sex differentiation in tilapia is determined by the antagonism between female and male pathway genes. The degree to which environmental temperature influences sex determination and differentiation varies significantly across strains, broadly categorizing them as temperature-sensitive (ESD) and temperature-insensitive (GSD). Despite significant advances in modern breeding technology, the large-scale production of all-male tilapia (TSD) strains still relies primarily on methyltestosterone-induced sex differentiation. This technique, through precise control of hormone exposure during early fry development, consistently achieves a male conversion rate exceeding 95%, and remains the core technology for commercializing all-male tilapia in aquaculture. However, the use of hormone treatment has also sparked ongoing debate in academia regarding the biosafety of aquaculture products and their potential impacts on the ecological environment.

[0003] From the perspective of sex-controlled breeding technology, the large-scale production of genetically all-male tilapia currently faces two major challenges. First, although gene editing can be used to knock out female pathway genes, producing homozygous male tilapia, because all homozygous individuals will develop into males, homozygous mutant female broodstock cannot be obtained. Therefore, mass production of all-male fry using gene editing technology is currently not possible. Second, even in temperature-sensitive tilapia, high temperature exposure can increase the male rate to a certain extent (approximately 70%), but genetically all-male breeding is not possible. Because tilapia have a high reproductive capacity, once mature males and females are available, a large number of fry will be produced. Different batches of fry will compete for food resources, resulting in significant individual and growth differences within the group, affecting the uniformity of market access. Summary of the Invention

[0004] The purpose of the present invention is to provide a method for breeding genetically all-male tilapia. By integrating gene editing with a temperature response mechanism, the method not only ensures the stable inheritance of the mutant genotype (homozygous female and male fish can reproduce independently), but also achieves full masculinization through controllable environmental conditions.

[0005] In order to achieve these purposes and other advantages according to the present invention, a method for breeding genetically all-male tilapia is provided, comprising the following steps: CRISPR / Cas9 gene editing in Nile tilapia fertilized eggs hsd17b1 Gene knockout is performed, and the targets selected for gene knockout include hsd17b1 Target 1 on the first exon of the gene and target 2 on the second exon, the sequence of target 1 is shown as SEQ ID NO. 1, and the sequence of target 2 is shown as SEQ ID NO. 2. The fertilized eggs are then hatched, positive individuals are screened, and raised to sexual maturity as the F0 generation; Select male fish from the positive individuals of the F0 generation and mate them with wild-type female fish to obtain the F1 generation heterozygous male and female population; The F1 generation heterozygous male and female fish were cultured to sexual maturity, self-fertilized, and screened to obtain F2 generation homozygous mutant female fish; The homozygous mutant female fish of the F2 generation are raised to sexual maturity, and the sex-reversed individuals among the homozygous mutant female fish of the F2 generation are hybridized with non-sex-reversed individuals to obtain homozygous mutant female fish of the F3 generation; During the sex differentiation window period, the F3 generation homozygous mutant female fish were subjected to a high temperature treatment of 35-37°C to induce complete masculinization of their gonads, and ultimately a group of all-male fry with male phenotypes and functions were obtained.

[0006] Preferably, when positive individuals are screened, the primers used to detect whether the hsd17b1 gene is successfully knocked out include hsd17b1-detection primer F and hsd17b1-detection primer R, the nucleotide sequence of the hsd17b1-detection primer F is shown in SEQ ID NO. 3, and the nucleotide sequence of the hsd17b1-detection primer R is shown in SEQ ID NO. 4.

[0007] Preferably, during the sex differentiation window period, the F3 generation homozygous mutant female fish are subjected to a high temperature treatment of 35-37°C, specifically including: high temperature incubation at 36°C from 5 to 90 days after hatching, and then transferred to a 26°C normal temperature breeding system until the fish grow up, thereby successfully obtaining an all-male fry group.

[0008] Preferably, the high temperature treatment is achieved by a stepped temperature increase, with the temperature increasing in three stages over a 24-hour period: i) From 26°C to 30°C at a rate of ≤2°C / h and maintain for 4 hours; ii) Continue to raise the temperature to 33°C at a rate of ≤1.5°C / h and maintain for 8 hours; iii) Finally, the temperature was raised to 36°C at a rate of ≤1°C / h.

[0009] Preferably, the entire heating process is controlled by a titanium alloy heating rod and a PID temperature control feedback system, and the water temperature fluctuation is ≤±0.3℃; At the same time, a circulating filtration system was used to maintain the dissolved oxygen concentration in the water at ≥6 mg / L and the ammonia nitrogen concentration at ≤0.05 mg / L. Commercial pellet feed with a particle size of 0.2-0.5 mm was fed 4 times a day, and the feeding amount was dynamically adjusted according to 3%-5% of the fish body weight.

[0010] Preferably, before applying high temperature treatment during the sex differentiation window period, the method further includes a step of dynamically monitoring and regulating the sex differentiation state, specifically: Gene expression assay: Starting 15 days after hatching, gonadal tissue samples were collected from F3 homozygous mutant females every 5 days. The expression levels of the male pathway marker gene Gsdf and the female pathway marker gene Cyp19a1a were detected by fluorescent quantitative PCR or immunohistochemistry. Determination of the temperature treatment initiation phase: When the expression level of Gsdf continues to increase and reaches more than 0.5 times the expression level of Cyp19a1a, the mutant individual is determined to have entered the critical window period of temperature treatment; Dynamic adjustment of high temperature parameters: a) If ≥5% of individuals in the population reach the critical window period, high temperature treatment of 35-37°C will be initiated immediately; b) If <5% of individuals in the population reach the critical window period, the start of high temperature treatment will be delayed until the standard is met; c) After the high temperature treatment is initiated, gene expression will be continuously monitored: if the Gsdf / Cyp19a1a expression ratio at any sampling point is <0.5, the high temperature treatment duration will be extended by 10-15 days.

[0011] Preferably, the high temperature treatment adopts a periodic temperature fluctuation mode, specifically: daily high temperature exposure period, 8:00-18:00, maintained at 36℃±0.5℃, night recovery period, 18:00-8:00 the next day, reduced to 30℃±0.5℃; the temperature fluctuation is achieved by a programmed temperature control system, and the heating / cooling rate is ≤1℃ / 10 minutes; the total duration of the periodic treatment is ≥45 days, and covers the entire critical window period of sex differentiation.

[0012] Preferably, the dynamic monitoring and control of the temperature treatment start time and state further includes: Dynamic monitoring at the molecular level: Gsdf and Cyp19a1a protein concentrations in the gonads were detected by tissue observation and immunofluorescence; Automated decision-making system: Deploys a water biosensor array to collect sex hormone metabolite data in real time, combines it with an AI model to predict the progress of population differentiation, and dynamically triggers the start of high-temperature treatment. Grouping and processing mechanism: Based on the RFID tag to identify the individual development status, the fry are diverted to independent temperature control units for group processing. Among them: For the group of individuals who meet the standard, high temperature treatment will be started immediately if Gsdf / Cyp19a1a ≥ 0.5; for the group of individuals who do not meet the standard, treatment will be delayed and continuously monitored; high temperature duration optimization: during high temperature treatment, if Gsdf / Cyp19a1a is < 0.5, the temperature will be raised to 37°C ± 0.5°C first, and treatment will be extended for 5-7 days only if the ratio continues to be below the threshold, and treatment will be terminated when the testis is histologically mature or serum 11-KT is > 2 ng / mL.

[0013] Preferably, the step-by-step heating process also includes a water temperature uniformity control step: multiple temperature sensors are evenly distributed in the aquaculture water body to monitor the temperature of different locations in real time; if the temperature of any sensor is detected to deviate from the current stage set value by more than ±0.5°C, or the temperature difference between any two sensors is greater than 1°C, the output power of the titanium alloy heating rod and the water flow rate of the circulation filtration system are automatically adjusted until the temperature of all locations returns to the set range.

[0014] Preferably, during the high temperature treatment, water quality parameters are dynamically regulated according to the real-time water temperature, specifically including: Oxygen dynamic compensation: According to the formula dissolved oxygen set value = 6 + 0.5 × (real-time water temperature - 26), adjust the aeration intensity to maintain the dissolved oxygen content in the water body not lower than the set value; Enhanced control of ammonia nitrogen: start the enhanced filtration cycle within 1 hour after feeding to quickly reduce the ammonia nitrogen concentration to ≤0.04mg / L; Equipment linkage execution: Through the feedback signals of temperature sensors, dissolved oxygen sensors and ammonia nitrogen sensors, the operating parameters of the titanium alloy heating rod, aeration equipment and circulation filtration system are controlled in a linkage manner.

[0015] The present invention has at least the following beneficial effects: The present invention allows for the fertility of both male and female mutant adult fish, enabling the maintenance of large numbers of fertile homozygous mutant broodstock without exogenous hormone treatment. This enables the large-scale production of homozygous mutant fry, overcoming the bottleneck of traditional gene editing that leads to unsustainable parental reproduction. This is unattainable with other male-female pathway gene mutations, as sex-reversed mutants often produce single-sex populations, making it impossible to obtain homozygous mutant male and female fish. Furthermore, the elimination of the need for exogenous hormone treatment of broodstock reduces costs in aquaculture.

[0016] This technology, for the first time, integrates CRISPR / Cas9 gene editing with high-temperature stress regulation to establish a controllable, all-male fry production system (100% male) in Nile tilapia. Compared to traditional aquaculture methods that rely on hormone induction, this patent application relies on gene editing and temperature manipulation to achieve all-male fry production, ensuring a hormone-free production process and avoiding the contamination of the aquatic environment by excessive hormone administration. Its controllability, operability, and low environmental risk significantly increase aquaculture yields and economic benefits, showing broad application prospects in the sustainable and intensified development of fisheries.

[0017] In short, the all-male tilapia population obtained by this technology has both genetic stability and fertility, providing an efficient solution for the large-scale production of all-male seedlings with high growth performance.

[0018] Other advantages, objectives and features of the present invention will be reflected in part from the following description and will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 for hsd17b1 Schematic diagram of gene target site locations. hsd17b1 Gene structure and mutation target design. The gene consists of six consecutive exons, with each exon domain distinguished by color. The translation start site (ATG) and termination codon (TAA) are marked at either end of the open reading frame, respectively. Specific mutation targets were designed in the first two exons. The bases marked in red on a purple background represent the PAM (Protospacer Adjacent Motif, NGG / CCN) structure. Target1 and Target2 represent the target sequences in exons 1 and 2 of the hsd17b1 gene, respectively. The dotted line indicates target sequence deletions, and the numbers to the right indicate the exact number of bases deleted in each allele. C) Mutation analysis by agarose gel electrophoresis: The wild-type contains only an 864 bp band, the heterozygous contains two bands, 864 and 370 bp, and the homozygous contains only a 370 bp band. M, DNA Marker DL2000. D) Sanger sequencing analysis: In addition to a 501 bp in-frame deletion, a 7 bp insertion was detected at the target site. WT, wild type; + / -, hsd17b1 + / - ;- / -, hsd17b1 - / - .

[0020] Figure 2 :High temperature treatment can significantly improve hsd17b1 Sex reversal ratio of homozygous mutant female fish 60 days after hatching. AC) Wild type (n=4), hsd17b1 - / -XX (n=15) and hsd17b1 - / - Histological observation of gonadal development in XX fish treated with high temperature (n=20). A'-C'') Fluorescent immunohistochemistry was used to detect the expression of the female pathway marker gene Cyp19a1a (A'-C') and the male pathway marker gene Gsdf (A''-C''). The number in the upper right corner indicates the proportion of individuals with this phenotype in the population. Blue indicates nuclear DAPI staining, red indicates Cyp19a1a signal, and green indicates Gsdf signal. WTXX is a wild-type female fish; hsd17b1 - / - XX is hsd17b1 Female fish with homozygous mutations; hsd17b1 - / - XX +HT indicates mutant female fish treated with high temperature; scale bar: 10 μm.

[0021] Figure 3 :High temperature treatment significantly increases hsd17b1 The sex reversal ratio of genes at different stages, A) hsd17b1 The proportion of sex reversal at different times after incubation of homozygous mutations. The number in the upper right corner represents the proportion of this phenotype. hsd17b1 - / - XX: indicates homozygous mutation hsd17b1 female fish; hsd17b1 - / - XX+HT: indicates homozygous mutation after treatment at 36°C hsd17b1 Female fish. B) Statistics of sex reversal ratio, 1M: indicates homozygous mutation at 1 month old hsd17b1 Female fish; 3M: indicates homozygous mutation at 3 months old hsd17b1 Female fish; 4M: indicates homozygous mutation at 4 months old hsd17b1 Female fish; 2M+HT: indicates homozygous mutation after 2 months of treatment at 36℃ hsd17b1 Female fish condition; 3M+HT: indicates homozygous mutation after 3 months of treatment at 36℃ hsd17b1 Female fish condition.

[0022] Figure 4 : hsd17b1 Analysis of fertility of homozygous mutant adult fish, AD) Histological analysis of gonads of tilapia with different genotypes: wild-type female fish (n=3), hsd17b1 Homozygous mutant XX ovarian phenotype individuals (n=3), hsd17b1Homozygous mutant XX testicular phenotype individuals (n=3) and wild-type males (n=3). EG) Serum testosterone (T), 17b-estradiol (E2), and 11-ketotestosterone (11-KT) concentrations were measured in adult fish, with three biological replicates per group. Data are presented as mean ± SD (n=3). Different letters above the error bars indicate statistically significant differences (P<0.05) by one-way ANOVA with Tukey's post hoc test. HI) Papanicolaou staining of sperm morphology in XY+ / + (n=3) and XX- / --T (n=5) at 240 days post-hatching (dah). Arrows indicate normal sperm. J) hsd17b1 Schematic diagram of the establishment of homozygous mutant lines. + / + For wild-type XX female fish; XX - / - -O refers to the preservation of ovarian structure hsd17b1 Homozygous mutation XX individual; XX - / - -T refers to the testicular structure hsd17b1 Homozygous mutation XX individual; XY + / + Wild-type XY male fish; scale bar: 50 μm. DETAILED DESCRIPTION

[0023] The present invention will be further described and described in detail below with reference to the accompanying drawings. It should be understood that the following examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0024] 1: Nile tilapia hsd17b1 Construction of homozygous mutant lines (1) Experimental materials Wild-type (WT) Nile tilapia (Olivestock) were obtained from the Key Laboratory of Freshwater Fisheries Resources and Reproductive Development, Ministry of Education, Southwest University (Beibei, Chongqing). The animals were maintained in a constant-temperature circulating water system (water temperature 26°C ± 1°C, photoperiod 12 L:12 D).

[0025] (2) Synthetic Nile tilapia hsd17b1 gRNA of the gene Download Tilapia from NCBI (https: / / www.ncbi.nlm.nih.gov / ) hsd17b1 The complete sequence of the gene, hsd17b1 The nucleotide sequence of the gene is shown below: turn up hsd17b1 Gene exon region, designed in the exon region through CRISPR / gRNA target sequence design website (http: / / zifit.partners.org / ZiFiT / ) hsd17b1 Target sequences. Specific principles and design methods are based on Li Minghui's doctoral dissertation (Li Minghui, 2014). The selected targets include target 1 located in exon 1 and target 2 located in exon 2 of the hsd17b1 gene.

[0026] The sequence of the target 1 is shown in SEQ ID NO. 1: GGCTCCATGGATAAAAAGG; The sequence of the target 2 is shown in SEQ ID NO. 2: GGATGCAAGAGATAGGATTG; The gRNA upstream primer is a designed specific target primer, and the downstream primer is a specific sequence on the gRNA template plasmid. hsd17b1 The primer sequences of the two target sites designed on the exon and the primer sequences of the gRNA are as follows: gRNA-F1: TAATACGACTCACTATAACAGCACTGCCCTTACGCCGGTTTTAGAGCTAGAAATAGC; gRNA-F2::TAATACGACTCACTATACAGCTCAAGAATGGTTGCGAGTTTTAGAGCTAGAAATAGC; Synthesis of gRNA and Cas9 mRNA Synthesis of gRNA: PCR amplification is performed using the designed forward and reverse primers. The system is as follows: After amplification, gel electrophoresis was performed for 20 min, and the target band was recovered by cutting the gel and used for in vitro transcription (without enzyme).

[0027] In vitro transcription, the system is as follows: Mix according to the system, centrifuge, and incubate at 37°C in a water bath for 2-3 hours; remove and add 2 uL DNase I, mix well, and incubate at 37°C in a water bath for 15 minutes; then add 50 uL anhydrous ethanol and 2 uL NaAc, mix well, and incubate at -80°C overnight. gRNA extraction: On the second day, place the reactants in a refrigerated centrifuge, 4°C, 12,000 rpm, 30 min, and discard the supernatant; wash the precipitate twice with 75% pre-cooled ethanol, 4°C, 12,000 rpm, 10 min each time; discard the supernatant, empty the centrifuge for 2 min, discard the ethanol, use an enzyme-free pipette to aspirate the supernatant, then place it on a clean bench, open the lid and let it stand on ice for 10 min. The dried precipitate is colorless and transparent, then add an appropriate amount of DEPC water to dissolve the precipitated gRNA and measure the concentration. The entire process is enzyme-free.

[0028] Cas9 mRNA synthesis: Cas9 plasmid linearization, the linearization system is as follows: (3) Microinjection Two targeting gRNAs and Cas9 mRNA diluted to appropriate concentrations were injected into single-cell zygotes using a SYS-PV830 injector (WPI, USA) microinjection system. Three control groups were also established: a gRNA-only injection group, a Cas9 mRNA-only injection group, and a no-injection group. (4) hsd17b1 Screening of knockout-positive fish The injected fertilized eggs were incubated under a suitable environment. Three days after hatching, a portion of the eggs were collected into 1.5 ml centrifuge tubes and genomic DNA was extracted using the phenol / chloroform method. After measuring the DNA concentration and OD value, PCR amplification of the target band was performed using specific F and R detection primers. The fragments were then separated by electrophoresis on a 1.5% agarose gel and recovered. Positive subclones were selected for sequencing to confirm the activity of CRISPR / Cas9 and the gRNA, confirming the successful knockout of hsd17b1.

[0029] The detection primer sequences are as follows: hsd17b1 -The nucleotide sequence of detection primer F is shown in SEQ ID NO. 3: ATCTCAAGTGCACGGCTCAA; hsd17b1 -The nucleotide sequence of detection primer R is shown in SEQ ID NO. 4: CTCTGACGCACACAGCCTTA.

[0030] The tail fin of the fish was cut off 90 days after hatching, and the genomic DNA was extracted after digestion and amplified. hsd17b1 The target band was screened after sequencing hsd17b1 Knockout-positive fish.

[0031] (5) Subculture This technical solution adopts a three-level breeding system to build a stable genetic hsd17b1 Homozygous mutant line: First select hsd17b1 Knockout-positive male fish were hybridized with wild-type female fish to obtain F1 generation heterozygous male and female populations carrying large-fragment knockout mutations; the F1 generation was then self-fertilized and cultivated to sexual maturity, and the F2 generation was screened. hsd17b1 Homozygous mutant female fish. Due to the key role of this gene in the female estrogen biosynthesis pathway, homozygous mutant female fish show a sex reversal rate (testicular development phenotype) of about 50% under conventional culture conditions. Ultimately, through the targeted mating of sex-reversed individuals (XX♂) with non-reversed individuals (XX♀), large-scale breeding of genetically consistent individuals is possible. hsd17b1 Homozygous mutant female fish fry are used to achieve stable transmission of the mutant strain.

[0032] 2: High temperature treatment hsd17b1 Homozygous knockout female fish achieves genetic all-male fry Select F2 generation hsd17b1 Homozygous mutant XX seedlings were treated with a temperature intervention program after they reached the horizontal swimming stage (5-7 days after hatching, when they possessed the ability to swim continuously horizontally). The culture vessel consisted of a 2m × 1m × 0.8m (length × width × height) glass aquarium equipped with an independent circulation filtration system, two 1200W titanium alloy heating rods, and a temperature control system. A digital temperature sensor monitored the water temperature in real time. After a 24-hour stepwise temperature increase, the temperature stabilized at 36.0±0.3°C (temperature fluctuation ≤0.5°C / h). A compound feed containing ≥40% protein (particle size 0.2-0.5mm) was fed daily at 08:00, 12:00, and 16:00 at a rate of 3%-5% of body weight. The photoperiod was controlled to a 12L:12D lighting regime (light intensity 500-800 lux). When the treatment was continued until 90 days of age, the sex ratio was verified by the following methods: 1. Anatomical observation: 30 fish samples were randomly selected for gonadal tissue section observation. It was found that the gonads at this time were completely male, which was significantly different from the homozygous knockout fish that were not treated with high temperature at the same time, only part of the gonads showed male morphology. hsd17b1 The mutant female fish completely reversed their biological sex, resulting in a population of 100% males (genetic sex XX, biological sex ♂). This achievement demonstrates the ability to produce all-male fry through gene editing and temperature manipulation, providing a highly efficient solution for the large-scale production of high-performance, all-male fry in aquaculture.

[0033] According to another embodiment of the present invention, a genetic all-male tilapia breeding method addresses the problem of incomplete sex reversal due to individual variability in the timing of high-temperature treatment. A dynamic monitoring and control strategy is proposed. Specifically, before F3 generation homozygous mutant females enter the sex differentiation window, gonadal tissue samples are collected every five days starting 15 days after hatching. The expression levels of the male pathway marker gene Gsdf and the female pathway marker gene Cyp19a1a are measured using fluorescent quantitative PCR. When Gsdf expression levels consistently increase and reach at least 0.5 times that of Cyp19a1a, the individual is considered to have entered the critical sex differentiation window. Control is then implemented based on the developmental synchrony of the population: if more than 5% of the individuals in the population meet this criterion, high-temperature treatment at 35-37°C is initiated immediately. If the proportion of individuals meeting this criterion falls below 5%, high-temperature treatment is delayed until the criterion is met. After the high-temperature treatment is initiated, gene expression levels are monitored every 5 days. If the expression ratio of Gsdf to Cyp19a1a at any sampling point is lower than 0.5, the high-temperature treatment time is automatically extended by 10 to 15 days to ensure that sex reversal is completely completed.

[0034] Traditional high-temperature treatment methods only apply constant temperature treatment within a fixed time window (5 to 90 days after hatching), failing to account for individual developmental differences. For example, some developmentally delayed individuals fail to enter the critical period of sexual differentiation within this fixed timeframe, resulting in ineffective high-temperature exposure and a sex reversal rate of only 70% to 80%. In contrast, this implementation method dynamically captures individual differentiation states through real-time molecular monitoring and uses gene expression ratios as an objective criterion, overcoming the limitations of empirical time-series manipulation. Furthermore, while traditional hormone induction methods can achieve a 95% male conversion rate, they require continuous feeding of methyltestosterone, posing the risk of drug residues contaminating water bodies and endangering food safety. This method, however, relies entirely on gene editing and a temperature-responsive mechanism, eliminating the need for exogenous hormones. While ensuring a 100% all-male phenotype, it eliminates the risk of chemical contamination, aligning with the development trend of green aquaculture.

[0035] According to another embodiment of the present invention, during the high-temperature treatment phase for F3 homozygous mutant female fish, a step-by-step temperature increase strategy is employed to ensure physiological adaptability of the fry. The specific operation is as follows: First, the aquaculture water temperature is stabilized at 26°C (basic water temperature). The temperature increase process is precisely controlled in three stages: 1. Phase 1: Raise the water temperature from 26°C to 30°C at a rate of no more than 2°C per hour, and maintain it for 4 hours. 2. Phase 2: Continue to raise the water temperature to 33°C at a rate of no more than 1.5°C per hour, and maintain it for 8 hours. 3. Phase 3: Finally, raise the water temperature to the target temperature of 36°C at a rate of no more than 1°C per hour.

[0036] The entire heating process is controlled by a titanium alloy heating rod linked to a PID temperature feedback system, ensuring that water temperature fluctuations do not exceed ±0.3°C. Simultaneously, a circulating filtration system maintains dissolved oxygen levels ≥6 mg / L and ammonia nitrogen concentrations ≤0.05 mg / L. The fish are fed a sustained-release microencapsulated feed (particle size 0.2-0.5 mm) four times daily, with the feed amount adjusted dynamically based on 3%-5% of their body weight. This process begins five days after hatching and continues until 90 days, after which they are transferred to a normal temperature of 26°C until they mature.

[0037] Existing technology directly maintains a constant temperature of 36°C from 5 to 90 days after hatching, omitting the gradual temperature increase step. This sudden temperature change causes significant stress reactions in the fry (manifested by sluggish swimming and refusal to feed), resulting in an average survival rate of only 65%-70%. In addition, some individuals experience incomplete sex reversal due to metabolic disorders (the masculinization rate is approximately 85%).

[0038] Advantages of this implementation method: 1. Reduced stress damage: The stepped temperature increase allows the fry to gradually adapt to the high temperature environment. The stress symptoms of the experimental group were reduced by more than 90%, and the survival rate increased to 92%-95%; 2. Improved sex reversal efficiency: The gradual temperature increase ensures the normal differentiation of gonadal cells. Combined with real-time monitoring, the masculinization rate reaches 100%; 3. Strong operability: The PID system achieves precise temperature control of ±0.3°C. Combined with dynamic water quality management, it avoids batch-to-batch differences caused by temperature fluctuations or water quality deterioration in traditional constant temperature methods.

[0039] According to another embodiment of the present invention, during the high-temperature treatment stage of the sex differentiation window period of the F3 generation homozygous mutant female fish, a periodic temperature fluctuation mode is adopted: a high temperature environment of 36°C is maintained from 8:00 to 18:00 every day, and the temperature is reduced to 30°C to restore from 18:00 to 8:00 the next day. The heating and cooling process is precisely controlled by a programmed temperature control system, with a rate not exceeding 1°C / 10 minutes, and the water temperature fluctuation is stable within the range of ±0.5°C. The circulating water system simultaneously maintains a dissolved oxygen content of ≥6 mg / L and an ammonia nitrogen concentration of ≤0.05 mg / L, and feeds sustained-release microcapsule feed 4 times a day. The temperature fluctuation treatment lasts for at least 45 days, completely covering the critical window period of sex differentiation.

[0040] Advantages of this approach: 1. Circadian synergy: Daytime high temperatures (36°C) enhance expression of the male pathway gene Gsdf, while nighttime low temperatures (30°C) alleviate heat stress and inhibit rebound expression of the female pathway gene Cyp19a1a. This dual-pathway synergy ensures 100% sexual reversal efficiency. 2. Dramatic improvement in survival rate: Nighttime temperature recovery significantly reduces cumulative heat damage, raising the survival rate of the experimental group to over 95%, a 30 percentage point increase compared to the constant temperature method. 3. Guaranteed functional sperm: The temperature fluctuation model maintains normal gonadal cell metabolism, resulting in sperm morphology that is indistinguishable from wild-type males and a fertilization rate of ≥90%, completely eliminating the sperm distortion problem associated with traditional constant temperature methods.

[0041] Example 1 During the sexual differentiation window of the F3 generation, homozygous mutant females were subjected to a programmed temperature fluctuation treatment: a high temperature of 36°C ± 0.5°C was maintained from 8:00 AM to 6:00 PM daily, followed by a temperature drop to 30°C ± 0.5°C from 6:00 PM to 8:00 AM the following day. The temperature fluctuations were precisely controlled by a PID temperature control system, with a rate of no more than 1°C per 10 minutes. The circulating water system simultaneously maintained dissolved oxygen levels ≥ 6 mg / L and ammonia nitrogen ≤ 0.05 mg / L. The fish were fed a slow-release microcapsule diet (particle size 0.2-0.5 mm) four times daily. This treatment lasted for 60 days, covering the entire critical period of sexual differentiation.

[0042] Technical effect verification: 1. Survival rate: The survival rate of fry in the experimental group reached more than 95% ( Figure 3 1. Sex reversal efficiency: anatomical and histological examinations showed that 100% of the gonads showed testicular structures, and serum testosterone levels were no different from those of wild males. 2. Sperm function: Papanicolaou staining showed that the sperm morphology was normal in ≥98% of the fish ( Figure 4 I arrow), fertilization rate ≥90%; 4. No hormone residue: No exogenous hormones were detected in water and fish samples (compared with traditional hormone induction method).

[0043] Comparative Example 1 (Constant Temperature Treatment) The treatment was carried out at a constant temperature of 36° C. for 60 days, and other conditions were the same as those in the example.

[0044] Defect Analysis: 1. High mortality rate: Due to continuous heat stress, the survival rate of fry is only 65-70%; 2. Incomplete sex reversal: About 15% of individuals retain ovarian tissue, and the masculinization rate in the group is only 85%; 3. Sperm abnormalities: 40% of sperm have deformed heads or missing flagella, and the fertilization rate is ≤50%; 4. Deteriorating water quality: Ammonia nitrogen concentrations fluctuate by more than 0.2 mg / L, exacerbating metabolic disorders.

[0045] Comparative Example 2 (Traditional Hormone Induction Method) According to conventional methods, wild-type fry were fed with a feed containing methyltestosterone (60 mg / kg) for 30 days.

[0046] Defect analysis: 1. Hormone residue risk: Methyltestosterone residues were detected in the fish liver (1.2±0.3 μg / kg), which does not meet food safety standards; 2. Environmental impact: Hormone diffusion was detected in the treated water (0.8±0.2 μg / L), posing an ecological pollution risk; 3. Batch differences: The male conversion rate fluctuated greatly (85%-95%), requiring repeated dosage adjustments; 4. Unsustainable: Each batch required reprocessing, making it impossible to establish a genetically stable breeding population.

[0047] The data of Example 1 is compared with those of Comparative Examples 1 and 2, as shown in Table 1.

[0048] Table 1: Data comparison of Example 1 and Comparative Examples 1 and 2 index Example 1 Comparative Example 1 (constant temperature) Comparative Example 2 (Hormone) Survival rate ≥95% 65-70% 90% Masculinity ratio 100% 85% 95% Normal sperm rate ≥98% ≤60% 90% Hormone residues Not detected Not detected Detectable (1.2 μg / kg) Sustainable reproduction of parents Support (F3 generation independent propagation) Not supported Not supported Conclusion: The periodic temperature fluctuation mode, through the coordination of circadian physiological rhythms (enhancing Gsdf gene expression during the day and relieving metabolic pressure at night), while maintaining 100% sex reversal efficiency, increased the survival rate from 70% of the traditional constant temperature method to more than 95%, and completely avoided the risk of hormone contamination, thus achieving the green and sustainable development of all-male seedling production.

[0049] According to another embodiment of the present invention, a method for dynamically monitoring tilapia sex differentiation based on body fluid biomarkers and AI decision-making includes: 1. Sample Collection: Starting on day 15 after hatching, micro-blood samples (≤ 10 μL per sample) or non-invasive mucus sampling from the tail vein of homozygous F3 female fish were collected every 48 hours. Blood samples were collected using capillary tubes pre-filled with anticoagulant, while mucus samples were obtained by scraping secretions from the gill cover using a sterile swab. 2. Marker Detection: The sample was applied to an immunochromatographic strip pre-coated with Gsdf / Cyp19a1a antibodies, and the colorimetric result was read within 10 minutes. Alternatively, quantitative detection was performed using a microfluidic chip, with a detection limit of 0.1 ng / mL and an error of ±5%. 3. Data Collection and AI Decision-Making: A biosensor array (dissolved oxygen, pH, and ammonia nitrogen sensors linked to a German Sartorius bioreactor system) is deployed in the water to monitor the concentrations of sex hormone metabolites such as 11-KT and E2 in real time. This data is uploaded to edge computing devices, where a pre-trained machine learning model (trained on 1,200 sets of historical data) predicts the progress of population differentiation. If more than 5% of individuals have a Gsdf / Cyp19a1a ratio ≥ 0.5 (determined to have entered the window period), a high-temperature treatment command is automatically triggered. If the population development dispersion (standard deviation > 0.3) is too high, a grouping mechanism is initiated. 4. Grouping and Processing: Each fish is implanted with a micro RFID tag to correlate detection data in real time. Individuals meeting the standard (Gsdf / Cyp19a1a ≥ 0.5) are diverted via intelligent valves to a 36°C high-temperature tank; those failing to meet the standard remain in a 26°C monitoring tank for further observation. 5. Optimization of high temperature control: If Gsdf / Cyp19a1a < 0.5 is detected twice consecutively during high temperature treatment, the temperature should be raised to 37°C ± 0.5°C (maintained for 3 days). If the ratio still does not rise, the treatment should be extended for 5 days (maximum total duration ≤ 12 days). When testicular histological sections show a spermatogonia ratio > 80% or serum 11-KT > 2 ng / mL, high temperature should be terminated immediately.

[0050] The existing technology proposes a sex differentiation monitoring method based on gonadal biopsy: Operation process: gonadal tissue is dissected and collected every 5 days, and then Gsdf / Cyp19a1a is detected by fluorescent quantitative PCR, and then the window period is manually determined.

[0051] Problems with existing technologies: 1. Tissue sampling results in a cumulative mortality rate of 15.3% for juvenile fish (experimental data n=300); 2. Detection takes >24 hours, with a window period determination error of ±3 days; 3. The unified treatment strategy ignores individual differences, resulting in a group male conversion rate of only 91.7%.

[0052] The present invention's solution includes: 1. Zero-injury monitoring: Using body fluids instead of tissue samples, the juvenile survival rate exceeds 99.8% (n=1,000 experiments). 2. Real-time response: The AI ​​system updates its predictions every 30 minutes, with a window activation error of less than ±12 hours. 3. Individualized treatment: RFID-based grouping management increases the sex reversal rate to 99.4%. 4. Risk control: The duration of high-temperature exposure is shortened by 50% (up to 12 days vs. 25 days with existing technology), and the growth inhibition rate is reduced by 18%. For experimental results, see Table 2. Table 2: Comparative laboratory tests on freshwater fish index Prior art (Chen et al.) Solution of the present invention Juvenile mortality 15.3% 0.2% Window period determination error ±3 days ±0.5 days Population male conversion rate 91.7% 100% Maximum number of days for high temperature treatment 25 days 12 days Average weight loss of adult fish 12.6% 4.1% Conclusion: The solution of the present invention, through the triple innovation of non-invasive detection, AI decision-making and clustering processing, completely solves the problems of sampling damage, response delay and development asynchrony in the existing technology while maintaining a 100% all-male conversion rate, providing reliable technical support for large-scale applications.

[0053] According to another embodiment of the present invention, during the stepwise heating process of F3 generation homozygous mutant female fish, water temperature uniformity is controlled: three temperature sensors are evenly distributed per cubic meter in the aquaculture pond to monitor surface, middle, and bottom water temperatures in real time. If any sensor temperature deviates by more than ±0.5°C from the set value for the current stage (e.g., 29.2°C or 33.5°C measured at 30°C), or if a regional temperature difference exceeds 1°C, the temperature control system automatically adjusts the output power of the titanium alloy heating rods and simultaneously increases the water flow rate of the circulating filtration system by 20%-30% until the temperature at all monitoring points returns to within the set range (e.g., 30°C ± 0.3°C). This operation covers the entire heating process (from 26°C to 36°C), ensuring that the fry are not subject to localized heat stress damage.

[0054] Existing technology relies only on single-point temperature control. In actual aquaculture, the temperature difference between the upper and lower layers often reaches 2-3°C due to water stratification (paragraph

[0045] of the specification). Some fry are exposed to low temperature areas (e.g., the bottom layer is only 31°C at a target temperature of 33°C), which hinders gonad differentiation ( Figure 3 The survival rate of the 2M+HT group was only 70%); high temperature areas (such as local areas reaching 37°C) caused heat shock, causing the group survival rate to fluctuate by more than 15%.

[0055] Advantages of this implementation: 1. Eliminate temperature gradients: Multi-point sensing and dynamic feedback suppress regional temperature differences to ≤1°C, resulting in no temperature-induced mortality in the experimental group. 2. Improve the stability of sex reversal: A uniform thermal environment ensures synchronous development of all individuals. Combined with Quan6 gene expression monitoring, the masculinization rate remains stable at 100%. 3. Strong scalability: Direct integration into the circulatory system reduces additional costs to less than 5%.

[0056] According to another embodiment of the present invention, during the high-temperature treatment stage (including step-by-step temperature increase or periodic fluctuation), dynamic water quality control is implemented: 1. Real-time dissolved oxygen compensation: Based on the water temperature sensor data (T), the aeration intensity is automatically adjusted according to the formula: dissolved oxygen set value = 6 + 0.5×(T-26) (for example, maintaining ≥11 mg / L at 36°C); 2. Ammonia nitrogen peak suppression: Within 1 hour after each feeding of slow-release feed, the enhanced filtration circulation mode is started to quickly suppress the ammonia nitrogen concentration to ≤0.04 mg / L (the conventional mode maintains ≤0.05 mg / L); 3. System linkage execution: Through the dissolved oxygen / ammonia nitrogen sensor signal, the aeration equipment, circulation pump and biological filter are linked in real time to ensure that the water quality parameters meet the standards within 10 minutes.

[0057] Current technology drawbacks: Fixed water quality standards (dissolved oxygen ≥6 mg / L, ammonia nitrogen ≤0.05 mg / L) cannot meet metabolic needs during high temperatures. At a constant temperature of 36°C, dissolved oxygen of 6 mg / L only meets basal oxygen consumption, while actual oxygen demand increases by over 50%. After feeding, ammonia nitrogen levels instantly soar to 0.2 mg / L, causing gill damage.

[0058] Advantages of this implementation: 1. Precise metabolic support: Dynamic compensation of dissolved oxygen meets peak oxygen consumption during high-temperature periods (e.g., 11 mg / L at 36°C), increasing the sperm normalization rate from 60% to 98%; 2. Immediate toxicity control: Ammonia nitrogen ≤ 0.04 mg / L within 1 hour after feeding, avoiding cumulative damage (no symptoms of ammonia nitrogen poisoning were seen in the experimental group); 3. Fully automated operation: Sensor-device linkage response speed is < 5 minutes, and water quality fluctuations between batches are reduced by 90%.

[0059] While the present invention has been described in detail above through general explanations, specific embodiments, and experiments, it is readily apparent to those skilled in the art that appropriate modifications or improvements based on the present invention may be made, such as adjusting the gRNA targeting site for the HSD17B1 gene or replicating the technique in different tilapia strains. Therefore, any such modifications or improvements that do not deviate from the core spirit of the present invention are intended to be included within the scope of protection claimed herein.

Claims

1. A method for breeding genetically all-male tilapia, characterized in that: The following steps are involved: CRISPR / Cas9 gene editing in Nile tilapia fertilized eggs hsd17b1 Gene knockout is performed, and the targets selected for gene knockout include hsd17b1 Target 1 on the first exon of the gene and target 2 on the second exon, the sequence of target 1 is shown as SEQ ID NO. 1, and the sequence of target 2 is shown as SEQ ID NO.

2. The fertilized eggs are then hatched, positive individuals are screened, and raised to sexual maturity as the F0 generation; Select male fish from the positive individuals of the F0 generation and mate them with wild-type female fish to obtain the F1 generation heterozygous male and female population; The F1 generation heterozygous male and female fish were cultured to sexual maturity, self-fertilized, and screened to obtain F2 generation homozygous mutant female fish; The homozygous mutant female fish of the F2 generation are raised to sexual maturity, and the sex-reversed individuals among the homozygous mutant female fish of the F2 generation are hybridized with non-sex-reversed individuals to obtain homozygous mutant female fish of the F3 generation; During the sex differentiation window period, the F3 generation homozygous mutant female fish were subjected to a high temperature treatment of 35-37°C to induce complete masculinization of their gonads, and ultimately an all-male fry population with male phenotypes and functions was obtained.

2. The genetic all-male tilapia breeding method according to claim 1, wherein: When positive individuals are screened, they are used for testing hsd17b1 The primers for successful gene knockout include hsd17b1 - Detection primers F and hsd17b1 - detection primer R, hsd17b1 -The nucleotide sequence of the detection primer F is shown in SEQ ID NO. 3, hsd17b1 -The nucleotide sequence of the detection primer R is shown in SEQ ID NO.

4.

3. The genetic all-male tilapia breeding method according to claim 1, wherein: During the sex differentiation window period, the F3 generation homozygous mutant female fish were subjected to a high temperature treatment of 35-37°C, specifically including: high temperature incubation at 36°C from 5 to 90 days after hatching, and then transferred to a 26°C normal temperature breeding system until the fish grew up, and an all-male fry group could be successfully obtained.

4. The genetic all-male tilapia breeding method as claimed in claim 1, wherein: The high temperature treatment is achieved by a stepped temperature increase, which is divided into three stages within 24 hours: i) From 26°C to 30°C at a rate of ≤2°C / h and maintain for 4 hours; ii) Continue to raise the temperature to 33°C at a rate of ≤1.5°C / h and maintain for 8 hours; iii) Finally, the temperature was raised to 36°C at a rate of ≤1°C / h.

5. The genetic all-male tilapia breeding method as claimed in claim 4, wherein: The entire heating process is controlled by the titanium alloy heating rod and the PID temperature control feedback system, and the water temperature fluctuation is ≤±0.3℃; At the same time, a circulating filtration system was used to maintain the dissolved oxygen concentration in the water at ≥6 mg / L and the ammonia nitrogen concentration at ≤0.05 mg / L. Commercial pellet feed with a particle size of 0.2-0.5 mm was fed 4 times a day, and the feeding amount was dynamically adjusted according to 3%-5% of the fish body weight.

6. The genetic all-male tilapia breeding method according to claim 1, wherein: Before applying high temperature treatment during the sex differentiation window period, the process also includes dynamic monitoring and regulation of the sex differentiation state, specifically: Gene expression assay: Starting 15 days after hatching, gonadal tissue samples were collected from F3 homozygous mutant females every 5 days. The expression levels of the male pathway marker gene Gsdf and the female pathway marker gene Cyp19a1a were detected by fluorescent quantitative PCR or immunohistochemistry. Determination of the temperature treatment initiation phase: When the expression level of Gsdf continues to increase and reaches more than 0.5 times the expression level of Cyp19a1a, the mutant individual is determined to have entered the critical window period of temperature treatment; Dynamic adjustment of high temperature parameters: a) If ≥5% of individuals in the population reach the critical window period, high temperature treatment of 35-37°C will be initiated immediately; b) If <5% of individuals in the population reach the critical window period, the start of high temperature treatment will be delayed until the standard is met; c) After the high temperature treatment is initiated, gene expression will be continuously monitored: if the Gsdf / Cyp19a1a expression ratio at any sampling point is <0.5, the high temperature treatment duration will be extended by 10-15 days.

7. The genetic all-male tilapia breeding method according to claim 1, wherein: High temperature treatment adopts a periodic temperature fluctuation mode, specifically: daily high temperature exposure period, 8:00-18:00, maintained at 36℃±0.5℃, night recovery period, 18:00-8:00 the next day, reduced to 30℃±0.5℃; the temperature fluctuation is achieved through a programmed temperature control system, with a heating / cooling rate of ≤1℃ / 10 minutes; the total duration of the periodic treatment is ≥45 days, and covers the entire critical window period of sex differentiation.

8. The genetic all-male tilapia breeding method according to claim 6, wherein: Dynamic monitoring and control of temperature treatment start-up time and status further includes: Dynamic monitoring at the molecular level: Gsdf and Cyp19a1a protein concentrations in the gonads were detected by tissue observation and immunofluorescence; Automated decision-making system: Deploys a water biosensor array to collect sex hormone metabolite data in real time, combines it with an AI model to predict the progress of population differentiation, and dynamically triggers the start of high-temperature treatment. Grouping and processing mechanism: Based on the RFID tag to identify the individual development status, the fry are diverted to independent temperature control units for group processing. Among them: For the group of individuals who meet the standard, high temperature treatment will be started immediately if Gsdf / Cyp19a1a ≥ 0.5; for the group of individuals who do not meet the standard, treatment will be delayed and continuously monitored; high temperature duration optimization: during high temperature treatment, if Gsdf / Cyp19a1a is < 0.5, the temperature will be raised to 37°C ± 0.5°C first, and treatment will be extended for 5-7 days only if the ratio continues to be below the threshold, and treatment will be terminated when the testis is histologically mature or serum 11-KT is > 2 ng / mL.

9. The genetic all-male tilapia breeding method according to claim 4, wherein: The step-by-step heating process also includes a water temperature uniformity control step: multiple temperature sensors are evenly distributed in the aquaculture water body to monitor the temperature of different locations in real time; if the temperature of any sensor deviates from the current stage set value by more than ±0.5°C, or the temperature difference between any two sensors is greater than 1°C, the output power of the titanium alloy heating rod and the water flow rate of the circulation filtration system will be automatically adjusted until the temperature of all locations returns to the set range.

10. The method for breeding genetically all-male tilapia according to claim 1, wherein: During high temperature treatment, water quality parameters are dynamically controlled based on the real-time water temperature, including: Oxygen dynamic compensation: According to the formula dissolved oxygen set value = 6 + 0.5 × (real-time water temperature - 26), adjust the aeration intensity to maintain the dissolved oxygen content in the water body not lower than the set value; Enhanced control of ammonia nitrogen: start the enhanced filtration cycle within 1 hour after feeding to quickly reduce the ammonia nitrogen concentration to ≤0.04 mg / L; Equipment linkage execution: Through the feedback signals of temperature sensors, dissolved oxygen sensors and ammonia nitrogen sensors, the operating parameters of the titanium alloy heating rod, aeration equipment and circulation filtration system are controlled in a linkage manner.

Images