Construction method and verification of fixed-point knock-in mouse model expressed by fluorescent tracing IFN-gamma protein
By using CRISPR/Cas9 technology to insert the luciferase gene into the IFN-γ gene, an IFN-γ-2A-luciferase fluorescent tracer mouse model was constructed, which solved the problem that the existing model could not non-invasively monitor IFN-γ expression and realized the real-time monitoring and functional research of IFN-γ expression.
Patent Information
- Application Number
- CN202510662018.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-22
- Publication Date
- 2025-09-23
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Existing IFN-γ fluorescent tracer mouse models are unable to non-invasively monitor the expression and location of IFN-γ in vivo without interfering with the normal function and expression profile of the IFN-γ protein.
The luciferase fluorescent gene was inserted before the 3'UTR of the IFN-γ gene using CRISPR/Cas9 technology, and connected through a 2A short peptide to construct an IFN-γ-2A-luciferase fluorescent tracer transgenic mouse model to achieve co-expression of IFN-γ and luciferase proteins.
It achieves non-invasive real-time monitoring of the location and intensity of IFN-γ expression, enhances the expression level of IFN-γ protein, and enables better study of its role in specific physiological and pathological processes.
Smart Images

Figure CN120683175A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering and relates to a method for constructing and verifying a site-specific knock-in mouse model expressing fluorescent tracer IFN-gamma protein. Background Art
[0002] Interferons are a class of cytokines with diverse activities, including immunomodulatory, antiviral, and anti-tumor activities. IFNs are primarily classified into three categories: type I, type II, and type III, based on their primary protein sequence, cognate receptor, gene locus, and cell type. Interferon-gamma (IFN-gamma, IFN-γ), also known as type II interferon, is a pleiotropic cytokine primarily produced by natural killer (NK) cells and T cells (including CD4+ and CD8+ T cells) upon stimulation, with smaller amounts produced by dendritic cells, macrophages, and B cells. It possesses antiviral, anti-tumor, and immunomodulatory properties, promoting the activation, development, and proliferation of immune cells and acting as effector cells. It can also induce antigen presentation, cell growth arrest, and apoptosis in tumor cells, playing a key role in coordinating innate and adaptive immune responses. The IFN-γ receptor (IFNGR) is expressed on the surface of most cells. IFN-γ binds to IFNGR through the classical pathway, activating JAK1 and JAK2. This in turn promotes the phosphorylation of STAT homodimers and their nuclear translocation. Binding to IFN-γ activation sites further promotes downstream gene transcription. IFN-γ can also play a role in signal transduction through non-classical pathways.
[0003] In an inflammatory environment or tumor microenvironment, proinflammatory cytokines can drive IFN-γ expression by inducing the activation of transcriptional elements (such as members of the STAT family of transcriptional activators). This can trigger the activation of immune responses and stimulate the elimination of pathogens. At the same time, it can prevent overactivation of the immune system and tissue damage by regulating immune cell activity and modulating cytokine networks.
[0004] Given the crucial role of IFN-γ in immune research, further understanding of its expression is needed. Long-term, non-invasive monitoring of IFN-γ expression and localization in vivo is of great value in studying a variety of disease models, including infection, tumor immunity, and autoimmunity. To better understand the crucial role of IFN-γ in the immune system, researchers have developed a variety of models. For example, an IFN-γ fluorescent transgenic mouse model is created by inserting the fluorescent reporter gene luciferase behind the endogenous IFN-γ promoter. This gene replaces portions of the IFN-γ exons and introns, allowing expression of luciferase to be driven by the IFN-γ promoter and displacing IFN-γ itself. This allows for in vivo imaging to pinpoint the location of IFN-γ expression. This model allows for real-time tracking of IFN-γ expression in vivo. However, its drawback is that the IFN-γ protein is replaced, preventing proper detection of IFN-γ protein function. Furthermore, the fluorescence tracking results are inconsistent with the known IFN-γ expression profile. For example, another model of IFN-γ function uses transgenic technology to overexpress IFN-γ protein in animals through random insertion. However, this method disrupts the physiological levels of IFN-γ protein and prevents non-invasive, real-time tracking of IFN-γ expression. Therefore, there is an urgent need for a transgenic mouse model that fluorescently traces IFN-γ, allowing for long-term, non-invasive monitoring of IFN-γ expression and location in vivo, while not interfering with the normal changes in IFN-γ protein in the animal body. Summary of the Invention
[0005] The purpose of the present invention is to provide a method for constructing a transgenic mouse model of fluorescently traced IFN-γ protein and verify its expression effect. To achieve the above purpose, the present invention provides the following technical solutions: The first aspect of the present invention discloses a method for constructing a site-specific knock-in mouse model expressing fluorescent tracer IFN-gamma protein, which utilizes CRISPR / Cas9 technology to construct a transgenic mouse model expressing fluorescent tracer IFN-gamma protein, specifically comprising the following steps: Step 1: Obtain Cas9 mRNA and gRNA by in vitro transcription, and construct a homologous recombination vector, which contains a recombinant left arm, a connecting peptide and a luciferase gene fusion sequence, and a recombinant right arm, the sequences of which are shown in SEQ ID NOs: 2-4, respectively; the sequence of the gRNA is shown in SEQ ID NO: 1; Step 2: Cas9 mRNA, gRNA, and homologous recombination vectors are microinjected into mouse fertilized eggs. The injected fertilized eggs are then transplanted into pseudopregnant female mice. After birth, the genotypes of the mice are identified by PCR amplification and sequencing to obtain F0 generation chimeric mice. Step 3: The F0 generation chimeric mice are mated with wild-type mice to obtain F1 generation mice. The genotypes are identified by PCR amplification and sequencing to obtain heterozygous F1 generation positive mice, thus completing the construction of a mouse model that can be stably propagated.
[0006] The second aspect of the present invention discloses a mouse model, including the mouse model constructed by the above-mentioned construction method and its offspring mouse model.
[0007] Preferably, cells or tissues expressing IFN-γ protein in the mouse model can be identified by fluorescence detection tools or methods.
[0008] The third aspect of the present invention discloses a mouse model constructed by the above construction method or the application of the mouse model in studying the function and mechanism of action of IFN-γ protein under different pathological conditions.
[0009] Preferably, the above application includes studying the function of IFN-γ protein in primary cells under physiological conditions or the role of IFN-γ protein in an inflammatory environment or a tumor microenvironment.
[0010] Compared with the prior art, the present invention has the following technical effects: This study utilizes CRISPR / Cas9 technology to insert a fluorescent luciferase gene before the 3' UTR of the IFN-γ gene through homologous recombination. The gene is then linked via a 2A peptide, creating a fluorescently traced IFN-γ-2A-luciferase (IFNG-Luc) transgenic mouse model. This model not only achieves co-expression of IFN-γ and luciferase proteins but also increases IFN-γ protein expression. This model not only allows for the fluorescent expression of luciferase to mark the expression location of IFN-γ protein, and for luciferase fluorescence intensity to reflect IFN-γ protein expression, but also enhances IFN-γ protein expression in the model, enabling better research into the role of IFN-γ in specific physiological and pathological processes. BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Figure 1 : The structure of mouse IFN-γ gene and the IFN-γ gene structure after IFNG-Luc gene modification.
[0012] Figure 2Schematic diagram of the IFNG-Luc mouse model construction strategy and identification results. Figure A is a schematic diagram of the IFNG-Luc mouse model construction strategy; P1, P2, P3, and P4 are the positions of the recombination PCR identification primers; Figure B is an electrophoresis image of homologous recombination identification in F0 generation mice; numbers indicate mouse numbers, WT is the wild-type control, H is the control with water as the PCR template, and M is a 1kb DNA marker.
[0013] Figure 3 : Electrophoresis diagram of homologous recombination identification in F1 generation mice; numbers are mouse numbers, WT is the wild-type control; H is the control where the PCR template is water; M is a 1 kb DNA marker.
[0014] Figure 4 :Detection of luciferase fluorescence expression in IFNG-Luc gene knock-in mice.
[0015] Figure 5 :Detection of acute inflammation induction effect in IFNG-Luc gene knock-in mice.
[0016] Figure 6 :Detection of tumor therapeutic effect in IFNG-Luc gene knock-in mice.
[0017] Figure 7 :Detection of therapeutic effect of IFNG-Luc gene knock-in on psoriasis in mice. DETAILED DESCRIPTION
[0018] The present invention is further illustrated by way of examples below, but the invention is not limited to the scope of the examples described. The experimental methods in the following examples, unless otherwise specified, are conventional methods and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, can be obtained from commercial sources.
[0019] Example 1 Construction of IFNG-Luc Mouse Model To obtain a model that can non-invasively indicate the location and relative dosage of IFN-γ protein expression in real time through fluorescent tracing, the inventors constructed an IFNG-Luc mouse model. The design strategy for this model is to insert the 2A-luciferase element before the stop codon of the mouse IFN-γ gene protein. The wild-type IFN-γ gene structure and the modified IFNG-Luc gene structure are shown in Figure 2. Figure 1 shown.
[0020] 1) gRNA target site screening The gRNA target sequence determines its targeting specificity and the efficiency with which Cas9 can cleave the target gene. The higher the efficiency of Cas9 cleavage, the more efficient homologous recombination will occur. Therefore, efficient and specific target sequence selection and design are prerequisites for the successful establishment of the IFNG-Luc mouse model.
[0021] According to the recombination protocol, a gRNA recognizing the target site was designed and synthesized near the insertion site: AAAAGGAGTCGCTGCTGATTCGG (SEQ ID NO: 1). This gRNA was tested to have good site-cleavage activity.
[0022] 2) Construction of homologous recombination vector According to the obtained gRNA site and insertion site information, a homologous recombination vector was constructed. The vector structure was as shown in the strategy Figure 2 As shown, the structure, from left to right, consists of the recombinant left arm, the linker peptide (2A) and luciferase gene fusion sequence, and the recombinant right arm. The sequences are SEQ ID NOs: 2-4, respectively. The recombinant left and right arms were amplified by PCR using the mouse genome as a template, while the remaining fragments were generated by whole-genome synthesis. During the construction process, the recombinant left arm, the knock-in fragment (2A-Luciferase), and the recombinant right arm were first obtained by PCR. These three DNA fragments were then ligated into the PBR322 vector using the In-Fusion method to create the final PBR322-IFNG-Luc recombinant vector. After the vector was verified by enzyme digestion and sequencing, mouse production was subsequently carried out.
[0023]
[0024]
[0025]
[0026] 3) Construction of IFNG-Luc knock-in mice: Fertilized eggs from C57BL / 6 mice were collected and the PBR322-IFNG-Luc recombinant vector, Cas9 mRNA, and gRNA were mixed according to the method in the "Mouse Embryo Manipulation Experiment Manual (3rd Edition)". The fertilized eggs were microinjected. After a short period of incubation, the injected fertilized eggs were transplanted into the oviduct of the recipient mother mouse to obtain gene-modified F0 generation mice. After the F0 generation mice were born, their tails were cut and the genome was extracted. The identification primer pair for the left arm of homologous recombination (primers P1 and P2) and the identification primer pair for the right arm (primers P3 and P4) were used to identify whether correct homologous recombination had occurred. The primer positions are shown in the figure below. Figure 2 As shown in P1-P4 in Figure A, the sequence information is as follows: Primer name Sequence information (5'→3') P1 GATATTACCACCAAAACTACGCAGG (SEQ ID NO: 5) P2 CTTAATGAGAATCTCGCGGATCTTG (SEQ ID NO: 6) P3 TGGGAGGCAAAGTTCTTAATGTTTC (SEQ ID NO: 7) P4 TGACTTATGAAACCAGTGGAAGCTA (SEQ ID NO: 8) The PCR reaction systems for primer pairs P1 / P2 and P3 / P4 are the same, as follows: PCR reaction composition Volume (µl) <![CDATA[ddH2O]]> 8.05 2xPCR Buffer 10 Primer 1 (20 pmol / µl) 0.3 Primer 2 (20 pmol / µl) 0.3 DNA Polymerase 0.35 Genomic DNA 1 total 20 The PCR reaction procedures for primer pairs P1 / P2 and P3 / P4 are the same and are as follows: step Temperature (℃) time Remark 1 94 3 min 2 98 20 seconds 3 63 20 seconds 4 68 4 min Repeat steps 2-4 for a total of 34 cycles 5 68 5 min 6 12 10 min A total of 12 F0 mice were born. The results of homologous recombination identification of the left arms of mice No. 1-12 are as follows Figure 2 As shown in B, the F0 generation mice with correct homologous recombination can amplify a 5.3kb band, while no PCR product can be amplified in negative mice. The results show that correct homologous recombination occurred in the left arms of mice No. 1, 3, 6, 9 and 10; the results of homologous recombination identification in the right arms of mice No. 1-12 are shown in Figure 2 As shown in B, correct recombination of the right arm can be PCR amplified into a 4.6kb band, and negative mice can amplify an 8.0kb product. The results show that correct homologous recombination also occurred in the right arms of mice No. 1, 3, 6, 9 and 10.
[0027] After adulthood, F0 mice No. 1 and No. 10 were mated with wild-type C57BL / 6 mice to obtain F1 mice. After birth, the F1 mice were tail-cut and the genome was extracted. PCR was performed using the same conditions as for the identification of F0 mice, targeting the left arm (primers P1 and P2) and the right arm (primers P3 and P4) of homologous recombination to confirm whether the obtained F1 mice were correctly homologously recombined IFNG-Luc gene knock-in mice. The identification results are as follows: Figure 3 shown. Figure 3 The middle left picture shows the results of homologous recombination identification in the left arm of F1 generation mice No. 1-9; Figure 3 The middle right image shows the results of homologous recombination identification in the right arm of F1 generation 1-9 mice. The results show that F1 generation mice 4, 5, 6, and 7 are recombination-positive mice obtained through passage.
[0028] Example 2 Detection of luciferase fluorescence expression in IFNG-Luc gene knock-in mice During the construction of IFNG-Luc mice, according to the design strategy, IFN-γ and luciferase proteins share a promoter and are co-expressed. Therefore, after the injection of luciferin substrate, the mice express IFN-γ while the expressed luciferase can catalyze the substrate to emit light, so the fluorescence expression of luciferin should be detected at the same time. The inventors used the in vivo imaging method to detect the fluorescence expression of luciferin 10 minutes after the injection of luciferin substrate. The test results are as follows Figure 4 As shown in A, luciferin fluorescence can be detected in the spleen, lymph nodes, and thymus of IFNG-Luc mice, while almost no fluorescence is detected in the spleen and thymus of wild-type C57BL / 6 mice. The results of quantitative detection of fluorescence signals are shown in Figure 4 As shown in B, the fluorescence expression signal of IFNG-Luc mice was significantly increased compared with that of wild-type mice.
[0029] Example 3 Detection of the Acute Inflammation Induction Effect in IFNG-Luc Gene Knock-in Mice To verify whether this model can continuously track the expression location and relative amount of IFN-γ during inflammation, the inventors injected polyinosinic acid (Poly(I:C)) at hour 0 to simulate viral infection to induce inflammation, thereby activating IFN-γ expression. Luciferin fluorescence expression was measured at hours 0, 1, 3, 5, 7, and 24. Figure 5 A is the injection time), the specific results are as follows Figure 5 As shown in C, the fluorescence intensity increases with time, reflecting the increasing relative amount of IFN-γ expression. The quantitative results are shown in Figure 5 As shown in B.
[0030] Example 4 Detection of the therapeutic effect of IFNG-Luc gene knock-in in mice Previous studies have shown that IFN-γ combined with PD-1 or CTLA-4 blockade can enhance immune function and play a key role in tumor treatment. To verify whether this model can detect the expression location and relative expression of IFN-γ in real time during monoclonal antibody treatment of tumors, the inventors used colon cancer MC38 cells to inoculate IFNG-Luc gene knock-in mice and randomly divided them into a treatment group and a normal saline control group. On the 7th day after inoculation, the treatment group received 5 mg / kg of anti-PD-1 or 20 mg / kg of anti-CTLA 4 monoclonal antibody every 3 days ( Figure 6 A). In the presence of anti-mouse PD-1 ( Figure 6B) and anti-mouse CTLA-4 ( Figure 6 C) After treatment, tumor growth was effectively inhibited. Figure 6 As shown in B, tumor inhibition became significant on day 14. At the same time, compared with the saline group, luciferase expression in mice in the drug-treated group increased rapidly. Mice receiving anti-PD-1 treatment showed a significant increase in luciferase signal starting on day 11 after tumor inoculation and then stabilized at a relatively high level, indicating that the increase in IFNγ infiltration in MC38 tumors may be induced by PD-1 blockade ( Figure 6 D). A similar trend was observed in anti-CTLA-4 treated mice ( Figure 6 C and E).
[0031] Example 5 Detection of therapeutic effects of IFNG-Luc gene knock-in on psoriasis in mice In order to study the role of IFNγ in the pathogenesis of psoriasis, the present invention established an IMQ-induced psoriasis mouse model using IFNG-Luc gene knock-in mice, and wild-type mice of the same litter served as controls and were treated with dexamethasone (Dex). Figure 7 As shown in AD, IMQ induction led to a gradual worsening of skin lesions, increased skin thickening, and elevated PASI scores, followed by significant improvement around day 6. Notably, the IMQ + Dex group exhibited milder symptoms overall compared to the IMQ group. In vivo bioluminescence imaging results showed that the fluorescence intensity in the skin peaked on day 2 and then gradually decreased ( Figure 7 EF), showed a negative correlation with skin thickness ( Figure 7 G). ELISA analysis showed that serum IFNγ levels reached a peak on day 3 ( Figure 7 H), while RT-qPCR showed that IFNγ expression in psoriatic skin lesions was highest on day 2 and then decreased over time ( Figure 7 I), reflecting the changing trend of fluorescence intensity. These results indicate that IFNγ plays a key role in the development of psoriasis and its expression dynamics can be effectively monitored using bioluminescence imaging.
[0032] Example 6 Quantitative Detection of IFN-γ Expression The control group consisted of normal C57BL / 6 mouse cells; the experimental group consisted of IFNG-Luc gene knock-in mouse cells; The method for quantitative detection of IFN-γ includes the following steps: 1. Dilute the rabbit polyclonal antibody to 10 μg / mL with PBS and add 100 μL per well to the ELISA plate. Seal the plate with sealing film and incubate at 4°C overnight.
[0033] 2. Discard the liquid in the wells, pat the ELISA plate dry, wash the plate with PBST solution, 200 μL / well, wash for 3 minutes, pat the ELISA plate dry and proceed to the next wash, wash the plate 3 times in total.
[0034] 3. Add 200 μL of blocking agent (PBST containing 5% milk and 5% FBS) to each well, seal the plate with sealing film, and incubate at 37°C for 2 hours.
[0035] 4. Discard the liquid in the wells, pat the ELISA plate dry, wash the plate with PBST solution, 200 μL / well, wash for 3 minutes, pat the ELISA plate dry and proceed to the next wash, wash the plate 3 times in total.
[0036] 5. Add 100 μL of the serially diluted standard (4096, 2048, 1024, 512, 256, 128, 64, 32, and 16 pg / ml) to each reaction well. Add 100 μL of diluent to the blank control well. Seal the plate with sealing film and incubate at 37°C for 2 h.
[0037] 6. Discard the liquid in the wells, pat the ELISA plate dry, wash the plate with PBST solution, 200 μL / well, wash for 3 minutes, pat the ELISA plate dry and proceed to the next wash, wash the plate 3 times in total.
[0038] 7. Add 100 μL of HRP-labeled mouse monoclonal antibody 6E8-5G5-IgG-HRP (1.5 μg / mL) to each well of the corresponding plate, seal the plate with sealing film, and incubate at 37°C for 1.5 h.
[0039] 8. Discard the liquid in the wells, pat the ELISA plate dry, wash the plate with PBST solution, 200 μL / well, wash for 3 minutes, pat the ELISA plate dry and proceed to the next wash, wash the plate 3 times in total.
[0040] 9. Add 100 μL of TMB color development solution to each well. Seal the plate with a film and incubate at 37°C for 15 minutes in the dark.
[0041] 10. Add 50 μL of stop solution to each well and gently shake the ELISA plate until mixed evenly.
[0042] 11. Within 10 minutes after termination, measure the absorbance of each well at 450 nm using a microplate reader. Subtract the negative control value from the sample value to obtain the net value.
[0043] Rabbit polyclonal antibody was used as coating antibody (using concentration of 10 μg / mL, 100 μL / well), 6E8-5G5-IgG- HRP was used as the detection antibody (at a concentration of 1.5 μg / mL, 100 μL / well) for IFN-γ quantitative detection experiments.
[0044] Rabbit polyclonal antibody and HRP-labeled mouse monoclonal antibody 6E8-5G5-IgG-HRP can be used in a double antibody sandwich method IFN-γ was quantitatively detected to obtain the IFN-γ protein content.
[0045] The concentration of IFN-γ was quantitatively detected using the double antibody sandwich method as shown in Table 1 IFN-γ concentration (pg / ml) control group 131.2±15 pg / mL Experimental group 265.1±15 pg / mL In summary, the inventors provide a method for constructing an IFNG-Luc gene knock-in mouse model, using the screened highly active gRNA target sites to construct an IFNG-Luc mouse model based on homologous recombination mediated by the CRISPR / Cas9 system; the inventors verified the fluorescence expression of the model, as well as the fluorescence tracing effect in an induced acute inflammation model, a tumor treatment model, and a psoriasis treatment model, and also promoted the expression of IFN-γ protein in mouse cells. This model can be applied to fields such as IFN-γ function research under specific physiological and pathological conditions.
[0046] The above description is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any technician familiar with the technical field, within the technical scope disclosed by the present invention, who makes equivalent replacements or changes based on the technical solution and inventive concept of the present invention, should be covered by the scope of protection of the present invention.
Claims
1. A method for constructing a site-specific knock-in mouse model for fluorescently traced IFN-gamma protein expression, characterized in that: The CRISPR / Cas9 technology was used to construct a transgenic mouse model expressing fluorescent IFN-γ protein, which specifically included the following steps: Step 1: Obtain Cas9 mRNA and gRNA by in vitro transcription, and construct a homologous recombination vector, which contains a recombinant left arm, a connecting peptide and a luciferase gene fusion sequence, and a recombinant right arm, the sequences of which are shown in SEQ ID NOs: 2-4, respectively; the sequence of the gRNA is shown in SEQ ID NO: 1; Step 2: Cas9 mRNA, gRNA, and homologous recombination vectors are microinjected into mouse fertilized eggs. The injected fertilized eggs are then transplanted into pseudopregnant female mice. After birth, the genotypes of the mice are identified by PCR amplification and sequencing to obtain F0 generation chimeric mice. Step 3: The F0 generation chimeric mice are mated with wild-type mice to obtain F1 generation mice. The genotypes are identified by PCR amplification and sequencing to obtain heterozygous F1 generation positive mice, thus completing the construction of a mouse model that can be stably propagated.
2. A mouse model, characterized in that The invention comprises a mouse model constructed by the construction method according to claim 1 and an offspring mouse model bred therefrom.
3. The mouse model according to claim 2, wherein Cells or tissues expressing IFN-γ protein in the mouse model can be identified by fluorescence detection tools or methods.
4. Use of the mouse model constructed by the construction method of claim 1 or the mouse model of claim 2 in studying the function and mechanism of action of IFN-γ protein under different pathological conditions.
5. The use according to claim 4, characterized in that This includes studying the function of IFN-γ protein under physiological conditions of primary cells or the role of IFN-γ protein in inflammatory environment or tumor microenvironment.