Preparation method of black tea fermentation liquor, black tea fermentation liquor and cosmetics

Through cross-species synergistic fermentation of bacteria, the problem of metabolic competitive inhibition in multi-species co-fermentation was solved, and a red tea fermentation liquid with natural aroma and high stability was prepared, which enhanced the moisturizing, water-locking, antioxidant, anti-inflammatory and anti-aging effects of cosmetics.

CN120694931APending Publication Date: 2025-09-26上海致臻志臣科技有限公司 +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511086984.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-04
Publication Date
2025-09-26

AI Technical Summary

Technical Problem

In traditional cosmetic raw material fermentation technology, the co-fermentation of multiple strains results in metabolic competition inhibition between strains, which limits the improvement of the efficacy of the fermentation products and the fermentation effect of a single strain is single.

Method used

A primary fermentation was carried out using a composite yeast seed solution of Kluyveromyces marxianus and Issaffron orientalis, followed by a secondary fermentation using a composite bacterial seed solution of Acetobacter xylinum and Rahnella sp. The inoculation amount and fermentation conditions were controlled during the fermentation process to form a metabolic complementary synergistic mechanism.

Benefits of technology

It significantly improves the stability and efficacy of black tea fermentation liquid, has a natural aroma, and shows significant effects in moisturizing, anti-oxidation, anti-inflammatory and anti-aging.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120694931A_ABST
    Figure CN120694931A_ABST
Patent Text Reader

Abstract

The invention discloses a preparation method of black tea fermentation liquor, the black tea fermentation liquor and cosmetics. The preparation method of the black tea fermentation liquor comprises the following steps: mixing black tea powder and a fermentation culture medium, and sterilizing to obtain an initial fermentation system; inoculating a composite yeast seed solution containing Kluyveromyces marxianus and Exista orientalis into the initial fermentation system, and carrying out primary fermentation; inoculating a compound bacterium seed solution containing acetobacter xylinum and rahnella into a system subjected to primary fermentation, and carrying out secondary fermentation; and carrying out post-treatment on the system after the secondary fermentation to obtain the black tea fermentation liquor. On the basis of unique strain compatibility and a staged precise culture strategy, an unfavorable'metabolic competition inhibition bottleneck 'in cross-species strain fermentation is successfully converted into a favorable'metabolic complementary synergistic mechanism', and the stability, moisture retention, oxidation resistance, compactness, wrinkle resistance, inflammation resistance, aging resistance and other effects of the black tea fermentation liquor are remarkably improved through fermentation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application belongs to the technical field of cosmetics, and in particular relates to a method for preparing a black tea fermentation liquid, the black tea fermentation liquid and cosmetics. Background Art

[0002] With the increasing demand for natural skincare, botanical skincare ingredients are becoming increasingly prominent in the cosmetics market. The ancient Chinese pharmacological classic "Shennong's Classic of Materia Medica" records that "Shennong tasted hundreds of herbs and encountered 72 poisons each day, which he found as a detoxification for tea," reflecting the crucial role of tea in early medical practice. Modern medical research has further confirmed the numerous health benefits of tea, and tea-related botanical skincare ingredients are also attracting attention in the beauty industry. Tea extracts, primarily consisting of tea polyphenols, flavonoids, and caffeine, possess potent antioxidant, antibacterial, and anti-inflammatory properties.

[0003] Fermentation of cosmetic ingredients utilizes active ingredients produced during microbial fermentation to enhance the efficacy of skincare ingredients. Traditional cosmetic ingredient fermentation techniques rely solely on single-strain fermentation, resulting in limited efficacy enhancements. However, the use of multiple bacterial species for co-fermentation can lead to metabolic competition and inhibition between species. The ecological relationships in the microbial world are incredibly complex, and microorganisms growing in the same environment not only compete for nutrients but also interact with each other's metabolic products. Overcoming the mutual interference of metabolic pathways between bacterial species in co-culture and achieving synergistic effects among multiple strains presents a challenge facing the field of cosmetic ingredient development technology. Summary of the Invention

[0004] The present application provides a method for preparing a black tea fermentation liquid, a black tea fermentation liquid and cosmetics, which significantly improve the efficacy and stability of the fermentation product through the coordinated fermentation of cross-species bacteria.

[0005] In a first aspect, the present application provides a method for preparing a black tea fermentation broth, comprising the following steps: mixing black tea powder with a fermentation medium and sterilizing the mixture to obtain an initial fermentation system; inoculating a composite yeast seed liquid into the initial fermentation system for a primary fermentation to obtain a yeast fermentation system; wherein the composite yeast seed liquid comprises a Kluyveromyces marxianus seed liquid and an Isaacella orientalis seed liquid; inoculating a composite bacterial seed liquid into the yeast fermentation system for a secondary fermentation to obtain a bacterial metabolic system; wherein the composite bacterial seed liquid comprises a Acetobacter xylinum seed liquid and a Rahnella seed liquid; inactivating, high-pressure homogenizing, and solid-liquid separating the bacterial metabolic system, taking a liquid portion for sterilization and preservative treatment to obtain a black tea fermentation broth; wherein the volumes of the Kluyveromyces marxianus seed liquid and the Isaacella orientalis seed liquid are both 2% to 4% of the volume of the fermentation medium; the volume of the Acetobacter xylinum seed liquid is 4% to 8% of the volume of the fermentation medium, and the volume of the Rahnella seed liquid is 5 to 7% of the volume of the fermentation medium.

[0006] Compared with the existing technology, the preparation method of black tea fermentation liquid provided in this application uses the composite yeast seed liquid of Kluyveromyces marxianus and Isafferces orientalis to ferment the fermentation system once, and then uses the composite bacterial seed liquid of Acetobacter xylinum and Rahn's genus for secondary fermentation. At the same time, the inoculation amount of the two yeasts and the two bacteria during the fermentation process is controlled, so that the fermentation processes of the strains promote each other and synergize to enhance the efficiency. The black tea fermentation liquid finally prepared not only has a natural aroma and high stability, but also has effectively improved effects in many aspects such as moisturizing and water locking, anti-oxidation, anti-wrinkle and firming, anti-inflammatory and anti-aging.

[0007] In any embodiment of the present application, the concentration of black tea powder in the initial fermentation system is 8 g / L to 12 g / L; the number of viable bacteria in the Kluyveromyces marxianus seed solution is 0.9×10 7 CFU / mL~1.1×10 7 CFU / mL; the number of viable bacteria in the seed solution of Isaacillus orientalis was 0.9×10 7 CFU / mL~1.1×10 7 CFU / mL; the number of viable bacteria in the Acetobacter xylinum seed solution was 0.9×10 7 CFU / mL~1.1×10 7 CFU / mL; the number of viable bacteria in the seed solution of Rahn's bacteria was 0.9×10 8 CFU / mL~1.1×10 8 CFU / mL.

[0008] In any embodiment of the present application, the Kluyveromyces marxianus seed solution, the Isahomias orientalis seed solution, the Acetobacter xylinum seed solution, and the Rahnella seed solution further contain a seed culture medium, and the seed culture medium contains the following components, calculated by total volume: glucose 15g / L~25g / L, yeast extract 3g / L~8g / L, peptone 5g / L~10g / L, sodium chloride 0.5g / L~1.5g / L, potassium dihydrogen phosphate 1g / L~5g / L, dipotassium hydrogen phosphate 1g / L~3g / L, and magnesium sulfate 0.05g / L~0.15g / L.

[0009] In any embodiment of the present application, black tea powder is prepared by the following method: fresh black tea leaves are placed in a withering tank, withered for 15 to 18 hours under the conditions of a relative humidity of 60 to 70% and a temperature of 25 to 30°C, rolled for 0.5 to 1 hour to form strips, piled and fermented for 4 to 6 hours, dried at 80 to 100°C for 45 to 60 minutes, ground into coarse tea powder, and passed through an 80 to 100 mesh sieve to obtain black tea powder.

[0010] In any embodiment of the present application, the ventilation volume during a fermentation process is 0.2 vvm to 0.5 vvm; the temperature during a fermentation process is 28° C. to 32° C.; the stirring speed during a fermentation process is 100 rpm to 200 rpm; and the fermentation culture time of a fermentation process is 15 h to 20 h.

[0011] In any embodiment of the present application, the ventilation volume during the secondary fermentation process is 0.8vvm~1.5vvm; the temperature during the secondary fermentation process is 30℃~35℃; the stirring speed during the secondary fermentation process is 400rpm~600rpm; and the fermentation culture time of the secondary fermentation is 28h~36h.

[0012] In a second aspect, the present application provides a black tea fermentation liquid prepared by the method described in the first aspect.

[0013] In a third aspect, the present application provides a cosmetic comprising the black tea fermentation broth prepared by the method described in the first aspect or the black tea fermentation broth described in the second aspect, and cosmetic excipients.

[0014] In any embodiment of the present application, the amount of black tea fermented liquor added to the cosmetic is 0.1% to 10% of the total mass of the cosmetic.

[0015] In any embodiment of the present application, the dosage form of the cosmetic is any one of a dressing, an ointment, a cream, an emulsion, a spray, an aerosol, a cream, an aqueous solution, a gel, an oil, a patch, a film, a mud, a powder, a solution, a film coating and a powder. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following is a brief introduction to the drawings required for use in the embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0017] Figure 1 Schematic diagram comparing the inhibitory effects of the black tea fermented liquid and the unfermented black tea liquid on MMP-1 expression prepared in Example 1 of the present application;

[0018] Figure 2 Schematic diagram comparing the inhibitory effects of the black tea fermented liquid and the unfermented black tea liquid on MMP-3 expression prepared in Example 1 of the present application;

[0019] Figure 3 Schematic diagram comparing the effects of the fermented black tea liquid prepared in Example 1 of the present application and the unfermented black tea liquid on increasing COL-I expression;

[0020] Figure 4 Schematic diagram comparing the antioxidant effects of the black tea fermented liquid and the unfermented black tea liquid prepared in Example 1 of the present application;

[0021] Figure 5 This is a graph showing the skin moisture content test results at various time points in a human evaluation experiment on the moisturizing efficacy of cosmetics.

[0022] Figure 6 This is a graph showing the rate of change in skin moisture content at various time points in a human evaluation experiment on the moisturizing efficacy of cosmetics. DETAILED DESCRIPTION

[0023] In order to make the application purpose, technical solutions and beneficial technical effects of this application clearer, the application is further described in detail below with reference to the embodiments. It should be understood that the implementation regulations described in this specification are only for the purpose of explaining this application and are not intended to limit this application.

[0024] For simplicity, this application only explicitly discloses certain numerical ranges. However, any lower limit can be combined with any upper limit to form an unspecified range; and any lower limit can be combined with other lower limits to form an unspecified range, and similarly, any upper limit can be combined with any other upper limit to form an unspecified range. In addition, although not explicitly stated, each point or individual value between the endpoints of a range is included in the range. Thus, each point or individual value can serve as its own lower limit or upper limit and be combined with any other point or individual value, or with other lower limits or upper limits, to form an unspecified range.

[0025] It should be noted that the terms "comprises," "includes," or any other variations thereof are intended to encompass non-exclusive inclusion, such that a process, method, article, or apparatus that includes a list of elements includes not only those elements but also other elements not explicitly listed, or elements inherent to such process, method, article, or apparatus. In the absence of further limitations, the elements defined by the phrase "comprises..." do not exclude the presence of additional identical elements in the process, method, article, or apparatus that includes the elements.

[0026] Unless otherwise specified, the numerical values ​​of the various parameters mentioned in this application can be measured using various measurement methods commonly used in the art (for example, they can be tested according to the methods given in the examples of this application). Unless otherwise specified, the test temperature of each parameter mentioned in this application is 25°C and the test pressure is standard atmospheric pressure.

[0027] The above disclosure of the present application is not intended to describe every disclosed embodiment or every implementation in the present application. The following description more specifically illustrates exemplary embodiments. In many places throughout the application, guidance is provided through a series of examples, and these implementation regulations can be used in various combinations. In each example, the enumeration is only intended to be representative and should not be construed as exhaustive.

[0028] Fermented tea exhibits significant advantages in cosmetic applications, but traditional multi-species co-fermentation techniques have limitations. When homologous microbial combinations are used for fermentation, the fermentation product is limited. When heterologous strains are co-cultured, intense metabolic competition occurs, limiting the efficacy of the fermentation product. To address these challenges, the inventors have improved the preparation process for black tea fermentation broth. Through cross-species synergistic fermentation, the multiple efficacy and stability of the fermentation product have been significantly enhanced.

[0029] According to the first aspect of the present application, some embodiments of the present application provide a method for preparing a black tea fermentation liquid, comprising the following steps: mixing black tea powder with a fermentation medium and sterilizing the mixture to obtain an initial fermentation system; inoculating a composite yeast seed liquid into the initial fermentation system for a primary fermentation to obtain a yeast fermentation system; wherein the composite yeast seed liquid comprises a Kluyveromyces marxianus seed liquid and an Isaacillus orientalis seed liquid; inoculating a composite bacterial seed liquid into the yeast fermentation system for a secondary fermentation to obtain a bacterial metabolic system; wherein the composite bacterial seed liquid comprises a Acetobacter xylinum seed liquid and a Rahn's spp. seed liquid; inactivating, high-pressure homogenizing, and solid-liquid separating the bacterial metabolic system, and sterilizing and preserving the liquid portion to obtain a black tea fermentation liquid; wherein the volumes of the Kluyveromyces marxianus seed liquid and the Isaacillus orientalis seed liquid are both 2% to 4% of the volume of the fermentation medium; the volume of the Acetobacter xylinum seed liquid is 4% to 8% of the volume of the fermentation medium, and the volume of the Rahn's spp. seed liquid is 5% to 7% of the volume of the fermentation medium.

[0030] The preparation method of the black tea fermentation liquid provided in the present application includes two fermentation stages using microorganisms of different species: in the primary fermentation, yeast synchronous fermentation is carried out using Kluyveromyces marxianus and Issaffron orientalis; in the secondary fermentation, bacterial synchronous fermentation is carried out using Acetobacter xylinum and Rahnella; in addition, through the selection of fermentation strains, control of strain dosage and staged cultivation, a metabolic complementary synergistic mechanism is formed between the primary fermentation and the secondary fermentation.

[0031] In the primary fermentation stage, the present application used Kluyveromyces marxianus and I. orientalis yeasts for simultaneous fermentation. Even under the same fermentation conditions, different yeasts produced different ethanol yields and different metabolic byproducts. In the primary fermentation stage of the present application, the applicant selected I. orientalis and Kluyveromyces marxianus from a large number of yeasts for simultaneous fermentation. Among them, the fermentation of I. orientalis yeast is characterized by high ethanol yield, and the main metabolic byproducts are acetic acid and glycerol. Kluyveromyces marxianus also has the characteristics of high ethanol production during fermentation, and the fermentation products of Kluyveromyces marxianus contain a variety of flavor components, mainly including esters, alcohols, and higher alcohols. These components give the fermented product a unique fermentation aroma. In the primary fermentation stage, aromatic substances such as phenylethyl alcohol produced by Kluyveromyces marxianus fermentation combine with the aroma of tea leaves such as linalool and linalool, which can give the tea fermentation liquid a natural and rich rose aroma, reducing the addition of artificial flavors in cosmetics. At the same time, the system also accumulates a large amount of ethanol, acetic acid, and glycerol during the primary fermentation process. These products play an important role in the next secondary fermentation stage.

[0032] During the secondary fermentation stage, the Acetobacter xylinum used in this application, on the one hand, uses alcohol dehydrogenase and acetaldehyde dehydrogenase under aerobic conditions to further oxidize and metabolize ethanol into acetic acid, lowering the pH of the fermentation broth and exerting a certain antibacterial effect. On the other hand, substrates such as glycerol produced by the yeast are metabolized through phosphorylation and gluconeogenesis under the action of enzymes such as glycerol kinase to produce bacterial cellulose. Under the fermentation conditions provided in this application, the low-molecular-weight bacterial cellulose produced by Acetobacter xylinum fermentation has the characteristics of good biocompatibility with various active ingredients and potential water absorption and moisturizing properties. In the fermentation product, it can synergize with multiple active ingredients, helping to disperse and stabilize the various active ingredients produced in the fermentation system, significantly improving the fermentation product's moisturizing, anti-oxidation, anti-inflammatory, anti-wrinkle and firming effects.

[0033] It is worth mentioning that, in general, when the ethanol produced by yeast fermentation accumulates to a certain level, it has antibacterial and bactericidal effects and inhibits bacterial growth. However, the metabolism of Acetobacter xylogenin in the present application requires the use of ethanol. The ethanol accumulated during the primary fermentation process can serve as a carbon source and energy source for Acetobacter xylogenin, promoting the metabolism of Acetobacter xylogenin and the production of small molecular weight bacterial cellulose. Moreover, the acetic acid and glycerol accumulated in the system during the primary fermentation are also beneficial factors for increasing the production of small molecular weight bacterial cellulose by Acetobacter xylogenin. Therefore, the ethanol, acetic acid, and glycerol accumulated in the primary fermentation stage of the fermentation system of the present application promote the metabolism of Acetobacter xylogenin during the bacterial fermentation stage, increase the production of small molecular weight bacterial cellulose, and make an important contribution to the stability and efficacy of the tea fermentation liquid. In addition, the acetic acid produced by the metabolism of Acetobacter xylogenin can also lower the pH of the fermentation system and inhibit contamination by foreign bacteria. At the same time, acetic acid can also gently soften keratin, promote the transdermal absorption of various effective ingredients in the black tea fermentation liquid, and help improve the stability and overall efficacy of the tea fermentation liquid.

[0034] At the same time, because Acetobacter xylinum actively consumes the ethanol in the fermentation system and lowers the system's pH, it effectively inhibits bacterial contamination. The acetic acid produced also serves as a growth substrate for Rahn's bacteria, promoting their metabolism. Rahn's bacteria continuously metabolize to produce antimicrobial proteins, lactic acid, and extracellular phytase, inducing the precipitation of heavy metals such as lead, chromium, copper, and zinc ions accumulated in tea leaves. This reduces the heavy metal content in the tea fermentation broth, reduces the formation of black-brown substances by tea polyphenols and iron ions, and improves the stability of the tea fermentation broth. The antimicrobial proteins produced also help improve and rebalance the skin's surface microbiome, inhibit the overactivity or proliferation of pathogenic bacteria, control bacterial inflammation at the source, and enhance the inhibitory effect of black tea fermentation broth on inflammatory aging.

[0035] The present application not only purposefully screens out Kluyveromyces marxianus, Issenbergia orientalis, Acetobacter xylinum and Rahnella for the preparation of black tea fermentation broth, but also provides an inoculation amount range for the above four strains, so as to better achieve the effect of synergistic metabolism and mutualistic symbiosis of the four strains.

[0036] In summary, based on the innovative bacterial strain compatibility and phased precision cultivation strategy, this application successfully transforms the unfavorable "metabolic competition inhibition bottleneck" in cross-species fermentation into a favorable "metabolic complementary synergistic mechanism". The black tea fermentation liquid prepared by the method provided by this application not only has a natural and rich aroma and high stability, but also has significantly improved efficacy in many aspects such as moisturizing and water lock, anti-oxidation, firming and anti-wrinkle, anti-inflammatory and anti-aging.

[0037] In some embodiments, Kluyveromyces marxianus was deposited by one of the applicants, Shanghai Zhizhen Zhichen Technology Co., Ltd., in the Guangdong Provincial Center for Microbial Culture Collection before the application date, with the deposit number GDMCC 65280; Isaacillus orientalis was purchased by the applicant from the China Industrial Microbiological Culture Collection Administration Center, and the deposit number displayed in the purchase information is CICC1273; Acetobacter xylinum was deposited by one of the applicants, Shanghai Zhizhen Zhichen Technology Co., Ltd., in the Guangdong Provincial Center for Microbial Culture Collection before the application date, with the deposit number GDMCC 65279; and Laenella was deposited by one of the applicants, Shanghai Zhizhen Zhichen Technology Co., Ltd., in the Guangdong Provincial Center for Microbial Culture Collection before the application date, with the deposit number GDMCC 66184.

[0038] For example, the inoculation amount of Kluyveromyces marxianus seed solution can be 2%, 2.5%, 3%, 3.5% or 4% of the volume of the fermentation medium.

[0039] For example, the inoculation amount of the I. orientalis seed solution can be 2%, 2.5%, 3%, 3.5% or 4% of the volume of the fermentation medium.

[0040] For example, the inoculation amount of the Acetobacter xylinum seed solution can be 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5% or 8% of the volume of the fermentation medium.

[0041] For example, the inoculation amount of the Rahn's bacteria seed solution can be 5%, 5.5%, 6%, 6.5%, or 7% of the volume of the fermentation medium.

[0042] In any embodiment of the present application, the concentration of black tea powder in the initial fermentation system is 8 g / L to 12 g / L.

[0043] For example, the mass volume concentration of black tea powder in the initial fermentation system can be 8 g / L, 9 g / L, 10 g / L, 11 g / L or 12 g / L.

[0044] In any embodiment of the present application, the number of viable bacteria in the Kluyveromyces marxianus seed solution is 0.9×10 7 CFU / mL~1.1×10 7 CFU / mL; the number of viable bacteria in the seed solution of Isaacillus orientalis was 0.9×10 7 CFU / mL~1.1×10 7 CFU / mL; the number of viable bacteria in the Acetobacter xylinum seed solution was 0.9×10 7 CFU / mL~1.1×10 7 CFU / mL; the number of viable bacteria in the seed solution of Rahn's bacteria was 0.9×10 8 CFU / mL~1.1×10 8 CFU / mL.

[0045] For example, the number of viable bacteria in the Kluyveromyces marxianus seed solution may be:

[0046] 0.9×10 7 CFU / mL, 0.95×10 7 CFU / mL, 1×10 7 CFU / mL, 1.05×10 7 CFU / mL or 1.1×10 7 CFU / mL.

[0047] Exemplarily, the number of viable bacteria in the oriental yeast seed liquid can be:

[0048] 0.9×10 7 CFU / mL, 0.95×10 7 CFU / mL, 1×10 7 CFU / mL, 1.05×10 7 CFU / mL or 1.1×10 7 CFU / mL.

[0049] For example, the number of viable bacteria in the Acetobacter xylinum seed solution may be:

[0050] 0.9×10 7 CFU / mL, 0.95×10 7 CFU / mL, 1×10 7 CFU / mL, 1.05×10 7 CFU / mL or 1.1×10 7 CFU / mL.

[0051] For example, the number of viable bacteria in the Rahn's bacteria seed solution may be:

[0052] 0.9×10 8CFU / mL, 0.95×10 8 CFU / mL, 1×10 8 CFU / mL, 1.05×10 8 CFU / mL or 1.1×10 8 CFU / mL.

[0053] In any embodiment of the present application, the Kluyveromyces marxianus seed solution, the Isahomias orientalis seed solution, the Acetobacter xylinum seed solution, and the Rahnella seed solution further contain a seed culture medium, which contains the following components, based on the total volume of the seed culture medium: 15 g / L to 25 g / L of glucose, 3 g / L to 8 g / L of yeast extract, 5 g / L to 10 g / L of peptone, 0.5 g / L to 1.5 g / L of sodium chloride, 1 g / L to 5 g / L of potassium dihydrogen phosphate, 1 g / L to 3 g / L of dipotassium hydrogen phosphate, 0.05 g / L to 0.15 g / L of magnesium sulfate, and the balance is water.

[0054] Exemplarily, based on the total volume of the seed culture medium, the seed culture medium contains the following components: 20 g / L glucose, 5 g / L yeast extract powder, 8 g / L peptone, 1 g / L sodium chloride, 4 g / L potassium dihydrogen phosphate, 2 g / L potassium hydrogen phosphate, 0.1 g / L magnesium sulfate, and the balance is water.

[0055] In any embodiment of the present application, the black tea powder is prepared by the following method: fresh black tea leaves are placed in a withering tank, withered for 15 to 18 hours under the conditions of a relative humidity of 60 to 70% and a temperature of 25 to 30°C, rolled for 0.5 to 1 hour to form strips, piled and fermented for 4 to 6 hours, dried at 80 to 100°C for 45 to 60 minutes, ground into coarse tea powder, and passed through an 80 to 100 mesh sieve to obtain the black tea powder.

[0056] In any embodiment of the present application, the ventilation volume during the primary fermentation process is 0.2vvm~0.5vvm; the temperature during the primary fermentation process is 28°C~32°C; the stirring speed during the primary fermentation process is 100rpm~200rpm; and the fermentation culture time of the primary fermentation is 15h~20h.

[0057] In any embodiment of the present application, the ventilation volume during the secondary fermentation process is 0.8vvm~1.5vvm; the temperature during the secondary fermentation process is 30℃~35℃; the stirring speed during the secondary fermentation process is 400rpm~600rpm; and the fermentation culture time of the secondary fermentation is 28h~36h.

[0058] Generally speaking, under conditions of sufficient oxygen, yeast uses sugars and glucose metabolism to produce carbon dioxide and water, rapidly growing the bacteria and increasing the amount of bacteria; in an oxygen-deficient and slightly acidic environment, yeast produces α-keto acids such as pyruvate through the action of transaminases, and under the action of decarboxylase and alcohol dehydrogenase, the α-keto acids are further converted into ethanol and aromatic alcohols, while releasing carbon dioxide. The present application reduces the oxygen content in the fermentation liquid by appropriately reducing the ventilation volume and stirring speed during a fermentation process, so that the yeast in the fermentation process is under slightly hypoxic conditions, thereby accelerating metabolism to produce ethanol and aromatic alcohol substances.

[0059] In any embodiment of the present application, the high-pressure homogenization performed after the secondary fermentation includes two to three cycles of homogenization at a pressure of 1200 to 2000 bar; following the high-pressure homogenization step, filtration is performed using a ceramic membrane to achieve solid-liquid separation. High-pressure homogenization and ceramic membrane filtration ensure that the bacterial cellulose produced by the fermentation of Acetobacter xylinum is within an extremely low molecular weight range, which facilitates its dispersibility and compatibility with other functional substances, thereby improving the stability and overall efficacy of the black tea fermentation broth.

[0060] By controlling the ventilation volume, stirring speed, fermentation temperature and fermentation time in the primary fermentation stage and the secondary fermentation stage within an appropriate range, the synergistic fermentation effect can be enhanced. For example, in the secondary fermentation stage, the present application adopts a short-term dynamic culture, and ferments for 20h to 30h at a stirring speed of 400rpm to 600rpm. Under such fermentation conditions, the bacterial cellulose produced is a low-molecular-weight bacterial cellulose, and the low-molecular-weight bacterial cellulose is not cross-linked and is not easy to form micelles or membranes. With the high-pressure homogenization and ceramic membrane filtration steps in the post-treatment, it is easier to obtain a low-molecular-weight, highly stable black tea fermentation liquid.

[0061] In any embodiment of the present application, the fermentation medium comprises the following components by total volume: sucrose 1g / L-10g / L, peptone 1g / L-5g / L, vitamin C 0.5g / L-1.5g / L, and glucose 1g / L-10g / L.

[0062] In any embodiment of the present application, before the secondary fermentation, a carbon source is further added to the yeast fermentation system; the amount of the added carbon source is 1% to 2% of the volume of the fermentation medium; the added carbon source includes one or more of molasses, glucose, sucrose, glucuronic acid or soluble starch.

[0063] As an example, the amount of carbon source added is 1%, 1.2%, 1.4%, 1.6%, 1.8%, or 2% of the volume of the fermentation medium. Alternatively, the carbon source is glucose or a mixture of glucose and glucuronic acid. For example, the mixture of glucose and glucuronic acid is added to the yeast fermentation system as a carbon source in the form of an aqueous solution, and the concentration of the solution can be 40% (w / w), 45% (w / w), 50% (w / w), 55% (w / w), 60% (w / w), 65% (w / w), etc.

[0064] Alternatively, the primary fermentation and the secondary fermentation can be carried out using various dynamic culture devices, such as mechanically stirred tank culture.

[0065] A second aspect of the embodiments of the present application provides a black tea fermentation liquid prepared by the method described in the first aspect.

[0066] A third aspect of the embodiments of the present application provides a cosmetic comprising the black tea fermentation broth prepared by the method of the first aspect or the black tea fermentation broth of the second aspect, and cosmetic excipients.

[0067] In some embodiments, the amount of black tea fermented liquor added to the cosmetic is 0.1% to 10% of the total mass of the cosmetic.

[0068] For example, the amount of black tea fermented liquor added to the cosmetics may be 0.1%, 0.5%, 1%, 3%, 5%, 8% or 10% of the total mass of the cosmetics.

[0069] In some embodiments, the cosmetic excipient includes at least one of a moisturizer, a thickener, a nourishing agent, an emollient, an antioxidant, a protectant, a preservative, a fragrance, and a colorant.

[0070] In some embodiments, the dosage form of the cosmetic is any one of a dressing, an ointment, a cream, an emulsion, a spray, an aerosol, a cream, an aqueous solution, a gel, an oil, a patch, a film, a mud, a powder, a solution, a film-coating, and a powder.

[0071] Example

[0072] The following examples describe the present disclosure in more detail. These examples are intended for illustrative purposes only, as various modifications and variations within the scope of the present disclosure will be apparent to those skilled in the art. Unless otherwise stated, all parts, percentages, and ratios reported in the following examples are by mass, and all reagents used in the examples are commercially available or synthesized according to conventional methods and can be used directly without further processing. The instruments used in the examples are commercially available.

[0073] The Kluyveromyces marxianus used in the examples of this application is deposited by one of the applicants, Shanghai Zhizhen Zhichen Technology Co., Ltd., in the Guangdong Provincial Microbiological Culture Collection Center, with the deposit number GDMCC 65280, the deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province, and the deposit date is October 16, 2024.

[0074] The Issatchenkia orientalis used in the examples of the present application was purchased by the applicant from the China Industrial Microbiological Culture Collection Center. The collection number shown in the purchase information is CICC 1273, and the collection address is Building 6, No. 24 Jiuxianqiao Middle Road, Chaoyang District, Beijing.

[0075] The Gluconacetobacter xylinus used in the examples of the present application was deposited by one of the applicants, Shanghai Zhizhen Zhichen Technology Co., Ltd., in the Guangdong Provincial Microbial Culture Collection Center with the deposit number GDMCC 65279. The deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province, and the deposit date is October 16, 2024.

[0076] The Rahnella inusitata used in the examples of the present application is deposited by one of the applicants, Shanghai Zhizhen Zhichen Technology Co., Ltd., in the Guangdong Provincial Microbiological Culture Collection Center, with the deposit number: GDMCC 66184, the deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province, and the deposit date is April 21, 2025.

[0077] The brewer's yeast (Saccharomyces cerevisiae) used in the comparative example of this application is deposited by one of the applicants, Shanghai Zhizhen Zhichen Technology Co., Ltd., at the General Microbiology Center of China Culture Collection Administration, with the deposit number CGMCC 28487, the deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit date is September 20, 2023.

[0078] The Cryptococcus watticus used in the comparative example of this application is deposited by one of the applicants, Shanghai Zhizhen Zhichen Technology Co., Ltd., at the General Microbiology Center of the China Culture Collection Administration, with the deposit number CGMCC 28489, the deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit date is September 20, 2023.

[0079] The Lactobacillus plantarum used in the comparative example of this application is deposited by one of the applicants, Shanghai Zhizhen Zhichen Technology Co., Ltd., in the Guangdong Provincial Microbial Culture Collection Center, with the deposit number: GDMCC 65282, the deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province, and the deposit date is October 16, 2024.

[0080] In the following examples, the seed solution of each bacterial species was prepared by the following method:

[0081] 1. Kluyveromyces marxianus seed solution:

[0082] The seed culture medium for Kluyveromyces marxianus comprises the following components, based on the total volume: 20 g / L glucose, 5 g / L yeast extract powder, 8 g / L peptone, 1 g / L sodium chloride, 4 g / L potassium dihydrogen phosphate, 2 g / L potassium hydrogen phosphate, 0.1 g / L magnesium sulfate, and the balance being water. The seed culture medium is inoculated with Kluyveromyces marxianus in a glycerol tube inoculation volume that is 0.5% of the volume of the seed culture medium, and then cultured in a shaker at 200 rpm at 30°C for 16 hours to obtain a viable cell count of 1×10 7 CFU / mL of Kluyveromyces marxianus seed solution.

[0083] 2. Oriental Yeast Seed Solution: The preparation method is the same as that of Kluyveromyces marxianus seed solution, and the viable cell count is 1×10 7 CFU / mL of Isaacillus orientalis seed solution.

[0084] 3. Acetobacter xylinum seed solution: The preparation method differs from that of Kluyveromyces marxianus seed solution in terms of inoculation volume, culture temperature, and culture time: the inoculation volume is 1% of the volume of the seed culture medium in a glycerol tube, and the culture is carried out at 32°C for 24 hours to obtain a viable cell count of 1×10 7 CFU / mL of Acetobacter xylylene seed solution.

[0085] 4. Raenella seed solution: The preparation method is the same as that of Acetobacter xylinum seed solution, and the viable cell count is 1×10 8 CFU / mL of Raenella seed solution.

[0086] In the examples of this application, black tea powder was purchased from Anhui Zhonglian Tea Import and Export Co., Ltd., under the brand name Lapsang Souchong. Its preparation method is as follows: fresh black tea leaves are placed in a withering tank and withered for 15-18 hours, then rolled for 30-60 minutes to form strands, pile-fermented for 4-6 hours, dried, ground into a coarse tea powder, and sieved to obtain the tea powder; wherein the withering operation is carried out under forced air conditions at a relative humidity of 60-70% and a temperature of 25-30°C; the drying temperature is 80-100°C and the drying time is 45-60 minutes; and the coarse tea powder has a sieved particle size of 80-100 mesh.

[0087] Other reagents and instruments used in the examples of this application are common commercial products and can be purchased through conventional commercial channels.

[0088] Example 1

[0089] Example 1 of the present application provides a black tea fermentation liquid, which is prepared by the following method:

[0090] S10: Mix the black tea powder and the fermentation medium and add them into a fermentation tank. After high-temperature sterilization at 120±2°C, cool the mixture to obtain an initial fermentation system. The volume of the fermentation medium used is 4L, and the amount of black tea powder added is 11g / L. The components of the fermentation medium include: 5g / L sucrose, 3g / L% peptone, 1g / L vitamin C, 5g / L glucose, and the rest is deionized water.

[0091] S20: Inoculate the composite yeast seed liquid into the initial fermentation system prepared in S10 to carry out one fermentation, wherein the composite yeast seed liquid contains Kluyveromyces marxianus seed liquid and I. orientalis seed liquid, and the inoculation volumes of the Kluyveromyces marxianus seed liquid and the I. orientalis seed liquid are both 3% and 4% of the volume of the fermentation substrate. During the fermentation stage, the ventilation volume is 0.4 vvm, the stirring speed is 150 rpm, the temperature is 30°C, and the fermentation culture time is 20 h to obtain a yeast fermentation system.

[0092] S30: Add a carbon source to the yeast fermentation system, the added volume of the carbon source being 2% of the volume of the fermentation substrate, the carbon source being a 40wt% aqueous solution of a mixture of glucose and glucuronic acid, wherein the mass ratio of glucose to glucuronic acid is 3:1. Then, a composite bacterial seed solution is inoculated to perform a secondary fermentation, wherein the composite bacterial seed solution comprises a xylinum acetobacterium seed solution and a lanthella seed solution, the inoculation volume of the xylinum acetobacterium seed solution being 5% of the volume of the fermentation medium; the inoculation volume of the lanthella seed solution being 6% of the volume of the fermentation medium, the temperature in the secondary fermentation stage being 32°C, the stirring speed being 500rpm, the ventilation volume being 1.2vvm, and the fermentation culture time being 32h, thereby obtaining a bacterial metabolic system.

[0093] After the S40 fermentation is completed, post-treatment is carried out. The fermentation broth is inactivated at 105°C for 8 minutes, cooled to room temperature, and circulated and homogenized three times using a low-temperature ultra-high-pressure continuous flow cell disruptor at a pressure of 1800 bar. Then, a 100nm ceramic membrane is used for solid-liquid separation. The collected filtrate is sterilized for a second time at 110°C for 10 minutes and cooled to obtain the black tea fermentation broth.

[0094] Example 2 to Example 6

[0095] Examples 2 to 6 were prepared using methods substantially similar to those of Example 1, with the only differences from Example 1 being the amount of black tea powder used in the initial fermentation system, the inoculation amount of each bacterial species in the three fermentation stages, the ventilation volume, temperature, and time parameters during the fermentation process. For details, see the corresponding items in Table 1.

[0096] Comparative Example 1

[0097] The only difference between Comparative Example 1 and Example 1 is that in one fermentation, the Kluyveromyces marxianus seed solution was not inoculated, and only 4% I. orientalis seed solution was inoculated for one fermentation.

[0098] Comparative Example 2

[0099] The only difference between Comparative Example 2 and Example 1 is that in one fermentation, the Kluyveromyces marxianus seed liquid was replaced with the Saccharomyces cerevisiae seed liquid, and the inoculation amount of the Saccharomyces cerevisiae seed liquid and the number of viable bacteria in the seed liquid were consistent with those of the Kluyveromyces marxianus seed liquid in Example 1.

[0100] Comparative Example 3

[0101] The only difference between Comparative Example 3 and Example 1 is that in one fermentation, the I. orientalis yeast seed liquid was not inoculated. Instead, the I. orientalis yeast seed liquid was replaced with an equal inoculation amount of Kluyveromyces marxianus seed liquid, that is, 7% Kluyveromyces marxianus seed liquid was inoculated for one fermentation.

[0102] Comparative Example 4

[0103] The only difference between Comparative Example 4 and Example 1 is that in one fermentation, the oriental yeast seed liquid is replaced with the wahoo Cryptococcus seed liquid, and the inoculation amount of the wahoo Cryptococcus seed liquid and the number of viable bacteria in the seed liquid are consistent with the oriental yeast seed liquid in Example 1.

[0104] Comparative Example 5

[0105] The only difference between Comparative Example 5 and Example 1 is that in the secondary fermentation, the fermentation step of Acetobacter xylinum was not inoculated, and only the fermentation of Rahnella was carried out.

[0106] Comparative Example 6

[0107] The only difference between Comparative Example 6 and Example 1 is that in the secondary fermentation, the Rahn's bacterium seed liquid was not inoculated, and only Acetobacter xylinum fermentation was performed.

[0108] Comparative Example 7

[0109] The only difference between Comparative Example 7 and Example 1 is that in the secondary fermentation, the Rahn's bacteria seed liquid is replaced with the Lactobacillus plantarum seed liquid, and the inoculation amount of the Lactobacillus plantarum seed liquid and the number of viable bacteria in the seed liquid are consistent with those of the Rahn's bacteria seed liquid in Example 1.

[0110] Comparative Example 8

[0111] The only difference between Comparative Example 8 and Example 1 is that the inoculation amounts of Kluyveromyces marxianus seed solution, Issappanella orientalis seed solution, Acetobacter xylinum seed solution, and Rahnella seed solution were changed.

[0112] Comparative Example 9

[0113] The only difference between Comparative Example 9 and Example 1 is that: instead of fermenting in stages, Kluyveromyces marxianus, Issaffron orientalis, Acetobacter xylinum and Rahnella were fermented in one step, and the fermentation conditions were the same as those in the yeast fermentation stage in Example 1.

[0114] Comparative Example 10

[0115] The only difference between Comparative Example 9 and Example 1 is that the order of the staged fermentations is changed, with the bacterial simultaneous fermentation of Acetobacter xylinum and Rahnella being carried out first, and the yeast simultaneous fermentation of Kluyveromyces marxianus and I. orientalis being carried out secondly.

[0116] Comparative Example 11

[0117] Comparative Example 11 is unfermented black tea liquid.

[0118] The method for preparing unfermented black tea liquid is similar to that of Example 1, except that no bacteria are inoculated into the fermentation system, and the bacteria inoculated in Example 1 are replaced by an equal amount of sterile water.

[0119] The relevant parameters of Examples 1 to 6 and Comparative Examples 1 to 11 are shown in Table 1.

[0120] Table 1 Fermentation condition parameters of Examples and Comparative Examples

[0121]

[0122] Detection

[0123] 1. Comparative experiment on the efficacy of fermented black tea and unfermented black tea

[0124] Black tea is rich in tea polyphenols, flavonoids, caffeine, and other ingredients, and has firming, anti-wrinkle, and antioxidant properties. To verify the improved efficacy of black tea extracts during the fermentation process described herein, the fermented black tea broth prepared in Example 1 and the unfermented black tea broth prepared in Comparative Example 11 were tested for their firming, anti-wrinkle, and antioxidant properties at the cellular level.

[0125] (1) Firming and anti-wrinkle efficacy testing

[0126] Type I collagen (COL-I) is the most abundant type of collagen in the skin, primarily found in the dermis. It is responsible for maintaining the skin's elasticity, firmness, and structural integrity. MMP-1 (matrix metalloproteinase-1) and MMP-3 (matrix metalloproteinase-3) are key enzymes involved in the degradation of the extracellular matrix (ECM) in the skin, playing a particularly important role in photoaging, natural aging, and inflammatory responses. Increased activity of these enzymes can lead to excessive degradation of collagens (such as COL-1) and elastic fibers, accelerating skin sagging and wrinkle formation. Therefore, by measuring COL-I, MMP1, and MMP-3 in cells after UVA induction, it is possible to assess whether the fermentation broth has the ability to increase skin collagen expression and inhibit the activity of matrix metalloproteinases, thereby achieving skin firming and anti-wrinkle effects.

[0127] Test method:

[0128] (1) Mouse fibroblast 3T3 cells were cultured at 3×10 5 Inoculate cells / well into 6-well plates and incubate overnight at 37°C in a 5% CO2 incubator.

[0129] (2) Sampling: When the cell plating rate of the 6-well plate reaches 60-70%, discard the culture medium, add fresh culture medium to the control group, and add fresh culture medium containing black tea fermentation liquid / unfermented black tea to the sample group. The final concentration of the sample is 5%. A positive control experiment is set up with 100 ppm blue copper peptide (GHK-Cu). After sampling, place the 6-well plate in an incubator (37°C, 5% CO2) for incubation. After the incubation period, discard the supernatant and wash twice with pre-cooled sterile PBS.

[0130] (3) Total RNA extraction

[0131] Add 300 μL of lysis buffer to each well of a 6-well plate and gently pipette 5-10 times until the suspended solids are dissolved and the solution is clear. Add an equal volume of binding buffer to the lysate and gently invert 3-5 times to mix thoroughly. Transfer the mixture to a purification column and centrifuge at 12,000 rcf for 30 seconds. Discard the liquid in the collection tube. Add 600 μL of wash buffer I and centrifuge at 12,000 rcf for 30 seconds. Discard the liquid in the collection tube. Add 600 μL of wash buffer II and centrifuge at 12,000 rcf for 30 seconds. Discard the liquid in the collection tube. Repeat this step. Centrifuge at maximum speed for 2 minutes to remove any residual liquid. Place the RNA purification column in the RNA elution tube provided in the kit, add 30 μL of elution buffer, let it stand at room temperature for 2-3 minutes, and centrifuge at maximum speed for 30 seconds. The resulting solution is the purified RNA. Add an appropriate amount of DEPC water to dissolve the mRNA, determine the concentration, and perform reverse transcription according to the reverse transcription kit instructions.

[0132] (3) Reverse transcription PCR

[0133] System (20 μl): 5× Primescript buffer: 4 μl; Primescript RT Emzyme Mix: 1 μl; 100 μM Random 6mers: 2 μl; template (cDNA obtained by reverse transcription was diluted 10 times as a template) 2-10 μl, and the system was made up to 20 μl with ultrapure water.

[0134] Reaction conditions: pre-denaturation at 94°C for 5 min; 30 cycles: denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s; post-extension at 72°C for 10 min.

[0135] (4) Fluorescence quantitative PCR experiment (qPCR)

[0136] System (10 μl): 5 μl of 2×SYBR, 2 μl of template (cDNA obtained by reverse transcription diluted 10-fold as template), 0.5 μl of primers, and ultrapure water to make up the system to 10 μl. The sequences of the mouse primers used are as follows:

[0137] COL-Ⅰ primer sequence:

[0138] Forward primer (SEQ ID NO: 1): GCTCCTCTTTAGGGGCCACT

[0139] Reverse primer (SEQ ID NO: 2): CCACGTCTCACCATTGGGG

[0140] MMP-1 primer sequences:

[0141] Forward primer (SEQ ID NO: 3): AACTACATTTAGGGGAGAGGTGT

[0142] Reverse primer (SEQ ID NO: 4): GCAGCGTCAAGTTTAACTGGAA

[0143] MMP-3 primer sequences:

[0144] Forward primer (SEQ ID NO: 5): ACATGGAGACTTTGTCCCTTTTG

[0145] Reverse primer (SEQ ID NO: 6): TTGGCTGAGTGGTAGAGTCCC

[0146] GADPH primer sequence:

[0147] Forward primer (SEQ ID NO: 7): AGGTCGGTGTGAACGGATTTG

[0148] Reverse primer (SEQ ID NO: 8): TGTAGACCATGTAGTTGAGGTCA

[0149] Reaction conditions: pre-denaturation at 94°C for 5 min; 40 cycles: denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s (real-time fluorescence photography); melting curve at 94°C for 30 s, 60°C for 30 s, and 72°C for 1 s (real-time fluorescence photography during the heating process).

[0150] Figures 1 to 3 A comparison of the effects of the fermented black tea liquor of Example 1 and the unfermented black tea liquor of Comparative Example 11 on the mRNA expression of MMP-1, MMP-3, and COL-1 is shown. T-test results for significant differences are as follows: *: p < 0.05, **: p < 0.01, ***: p < 0.001, ****: p < 0.0001, ns: p ≥ 0.05 (no significant difference).

[0151] The results are as follows Figures 1 to 3 As shown in the results, the black tea fermented liquor prepared in Example 1 can significantly increase the expression of COL-I at the mRNA level at a concentration of 5%, and is significantly higher than that of the unfermented black tea liquor at 5%; and can significantly inhibit the expression of MMP-1 and MMP-3 at the mRNA level at a concentration of 5%, while the unfermented tea liquor can only slightly reduce the expression of MMP-3 and fail to significantly reduce the expression of MMP-1, indicating that the black tea fermented liquor has significant efficacy in skin firming and anti-wrinkle, and the efficacy is significantly higher than that of the unfermented tea liquor. This conclusion also provides strong support for the application of tea fermented liquor in skin care products.

[0152] (II) Antioxidant efficacy testing (ABTS method and DPPH free radical scavenging ability)

[0153] In daily life, exposure to ultraviolet radiation, blue light radiation, PM2.5 and other air pollutants, or the effects of smoking, alcoholism and unhealthy diet, can generate a large number of peroxide free radicals in the skin and body. These peroxide free radicals can: (1) activate the MAPK pathway, release matrix metalloproteinases such as mmp1 / 3 / 9, and accelerate collagen loss; (2) activate the IKK / NF-kB pathway, prompting cells to release inflammatory factors such as IL-6, IL-1b, and TNF-a, reducing collagen expression and inhibiting collagen production. They can also accelerate the production and release of matrix metalloproteinases and elastase, accelerating the decomposition of collagen and elastin; (3) activate p53 / p21 and p16, inhibiting skin cell proliferation. Therefore, by testing the total antioxidant capacity and DPPH free radical scavenging rate of black tea fermentation liquid, it can be evaluated whether it has the effect of combating aseptic chronic inflammation caused by peroxide free radicals, thereby alleviating or inhibiting inflammatory aging.

[0154] 1. Total antioxidant capacity test (ABTS kit microplate method):

[0155] (1) Preparation of ABTS working fluid

[0156] Add 100 μL each of ABTS solution and oxidant to a 10 mL centrifuge tube and mix to create the ABTS stock solution. Store at room temperature, protected from light, for 12 to 16 hours before use (it is stable overnight). The prepared ABTS working stock solution can be used within 2 to 3 days by storing at room temperature, protected from light. Dilute the ABTS working stock solution 30-fold (6 mL) with distilled water before use.

[0157] (2) Preparation of Trolox standard gradient

[0158] As shown in Table 2, dilute Trolox solution (10 mM) to 0.05, 0.15, 0.3, 0.6, 0.9, 1.2, and 1.5 mM using appropriate solvents. Mix 60 μL of 10 mM Trolox solution with 240 μL of pure water in a PCR tube or 1.5 mL centrifuge tube to obtain 300 μL of 2 mM Trolox solution.

[0159] Table 2 Trolox standard gradient

[0160]

[0161] Set up blank wells, standard wells, and assay wells as shown in Table 3. Add the solutions into the 96-well plate in that order, and be careful to avoid bubbles. Mix carefully and allow the mixture to react at room temperature for 2 minutes before assaying.

[0162] Table 3 Grouping and adding samples

[0163] Addition (μL) Blank hole Standard hole Measurement well ABTS working fluid 200 200 200 distilled water 5 - - Trolox Standard Solution - 5 - Samples to be tested - - 5

[0164] (3) Determination

[0165] Use a microplate reader to detect the absorbance at 734 nm and record it as A blank, A standard, and A determination in sequence.

[0166] (4) Calculation

[0167] A standard curve for total antioxidant capacity is drawn using a series of Trolox standards as the horizontal axis and the corresponding absorbance as the vertical axis. Based on the absorbance value of the sample measurement tube, the antioxidant capacity of the sample is calculated based on the concentration of Trolox standards.

[0168]

[0169] 2. DPPH free radical scavenging rate detection

[0170] The 1,1-diphenyl-2-trinitrophenylhydrazine (DPPH) free radical is a stable, long-lived free radical. Its ethanolic solution appears dark purple and exhibits strong absorption near 515 nm. In the presence of a DPPH free radical scavenger, the light absorption of the DPPH ethanolic solution is reduced due to pairing with its single electron. The degree of discoloration of the DPPH ethanolic solution is linearly related to the number of electrons it accepts. This allows the free radical scavenging ability of the test sample, i.e., its antioxidant activity, to be evaluated. The sample addition process is shown in Table 4.

[0171] Table 4 Experimental groups and sample addition

[0172]

[0173] The calculation formula of DPPH free radical scavenging rate is as follows:

[0174]

[0175] Where:

[0176] A-control absorbance value, i.e., absorbance value of the solution after the sample reacts with DPPH;

[0177] B-zero adjustment group, solvent and absorbance value;

[0178] C-absorbance value of experimental group, sample group;

[0179] D-sample background absorbance;

[0180] E-positive control;

[0181] The final concentration of the sample after dilution in the reaction system was 5%, and the final concentration of the positive control substance VC (ascorbic acid) was 50 μg / ml.

[0182] Figure 43. The figure is a comparative diagram of the antioxidant effects of the fermented black tea liquid and the unfermented black tea liquid prepared in Example 1 of the present application; wherein, the meanings of the significant difference symbols in the T-test are as follows: *: p < 0.05, **: p < 0.01, ***: p < 0.001, ****: p < 0.0001, ns: p ≥ 0.05 (no significant difference).

[0183] like Figure 4 As shown, the black tea fermented liquor prepared in Example 1 exhibited a total antioxidant capacity of 53.7% at a 5% concentration, equivalent to the standard antioxidant capacity of 0.912 mM Trolox, representing a nearly 80% improvement over the total antioxidant capacity of unfermented black tea liquor (29.46%). In terms of DPPH free radical scavenging capacity, the fermented black tea liquor achieved a 74.77% scavenging rate, a 33% improvement over the 56% scavenging rate of unfermented black tea. This indicates that fermentation of black tea liquor using the present process significantly enhances its antioxidant and DPPH free radical scavenging abilities, helping to eliminate the primary cause of aseptic skin inflammation and combat inflammatory aging.

[0184] 2. Experiment on the influence of strains and fermentation conditions on tea fermentation liquid

[0185] In order to verify the significant effects of the strain compatibility and the phased precision culture strategy of the present application on the prepared black tea fermentation broth, the black tea fermentation broths prepared in Examples 1 to 6 and Comparative Examples 1 to 10 were subjected to aroma testing, stability testing, and cellular level moisturizing efficacy testing.

[0186] (1) Aroma detection

[0187] Take the prepared black tea fermentation liquid, smear it on the wrist of a professionally trained odor tester, and place it in front of the nose tip to identify the odor, determine whether the black tea fermentation liquid has a rose scent and the intensity of the floral scent, and give a score. " / " represents no rose scent, "*, **, ***, ****, *****" represent rose scent, and the intensity of the floral scent increases in turn.

[0188] (2) Stability testing

[0189] Upon completion, the fermented black tea liquid was clear and light brown. The fermented black tea liquid was stored in a sealed, clean container in an incubator at 46°C to 50°C and 70% to 80% relative humidity. The liquid was stored in a dark environment and under bright conditions (D65 light source, 1000 lux) for 90 days. The fermented black tea liquid was observed for clarity and color change.

[0190] (III) Detection of FLG mRNA gene expression in HACAT cells induced by hydrogen peroxide

[0191] Filaggrin (FLG) is an important molecule that connects keratin fibers in the stratum corneum of human skin. With the help of FLG monomers, keratin fibers are regularly aggregated to form a solid physical barrier in the outermost layer of the epidermis, which can prevent the loss of epidermal moisture and the invasion of external allergic substances. FLG can be degraded in the stratum corneum of the epidermis to form small amino acid molecules, which have moisturizing function. It is called "natural moisturizing factor" and plays an important role in moisturizing and barrier integrity. This test stimulates keratinocytes HaCaT by hydrogen peroxide (H2O2) to cause barrier damage, and then detects the changes in the mRNA expression level of FLG in keratinocytes after sample treatment, and evaluates whether the black tea fermentation broth prepared in Examples 1 to 6 and Comparative Examples 1 to 10 has the effect of barrier repair and moisturizing.

[0192] 1. Detection reagent information

[0193] Table 5 Reagent information

[0194] Reagent name Manufacturer Item No. PBS Gibco 2002050 500ml FBS MRC CCS30009.02 500ml DMEM Gibco 11995-065 500ml RNA extraction kit (spin column type) Blue Sky R0026 50T Trypsin-EDTA (0.25%), containing phenol red Thermo Fisher 25200114 Reverse transcription kit Takara RR047A SYBR Yisheng Biology 11202ES08

[0195] 2. Experimental methods:

[0196] 1) Cell seeding: HaCaT cells were seeded into 6-well plates at a density of 200,000 cells per well and incubated overnight at 37°C in a 5% CO2 incubator.

[0197] 2) Experimental grouping: set up a solvent control group, a hydrogen peroxide-induced group, and a sample group, with three replicate wells;

[0198] Table 6 Experimental groups

[0199]

[0200] 3) Sampling: When the cell plating rate in the 6-well plate reaches 60-70%, discard the old culture medium, add fresh culture medium to the control group, and add culture medium containing black tea fermentation broth to the sample group to a final concentration of 1%; after sampling, place the 6-well plate in an incubator (37°C, 5% CO2) for incubation; 4) After the incubation period, discard the supernatant; wash twice with pre-chilled sterile PBS.

[0201] 5) RNA extraction (follow the RNA extraction kit, the process is as follows)

[0202] 6) Add 300 μL of lysis buffer to each well of a 6-well plate and pipette 5-10 times until the suspended solids are dissolved and the solution is clear.

[0203] 7) Add an equal volume of binding buffer to the lysate and mix thoroughly by inverting 3-5 times.

[0204] 8) Transfer the mixture to a purification column, centrifuge at 12000 rcf for 30 s, and discard the liquid in the collection tube.

[0205] 9) Add 600 μL of washing solution I, centrifuge at 12000 rcf for 30 s, and discard the liquid in the collection tube.

[0206] 10) Add 600 μL of Wash Buffer II, centrifuge at 12,000 rcf for 30 s, discard the liquid in the collection tube, and repeat this step.

[0207] 11) Centrifuge at maximum speed for 2 minutes to remove residual liquid.

[0208] 12) Place the RNA purification column in the RNA elution tube provided in the kit, add 30 μL of elution buffer, incubate at room temperature for 2-3 minutes, and centrifuge at maximum speed for 30 seconds. The resulting solution is the purified RNA.

[0209] 13) Add appropriate amount of DEPC water to dissolve mRNA, determine the concentration, and perform reverse transcription according to the reverse transcription kit instructions.

[0210] 14) Reverse transcription PCR

[0211] 15) System (20 μl): 10× buffer 2 μl, 2.5 mM dNTP 2 μl, DNA polymerase (Taq

[0212] 0.5μl, primer 2μl, template (cDNA obtained by reverse transcription is diluted 10 times as a template) 2-10μl, and ultrapure water is used to make up the system to 20μl.

[0213] 16) Reaction conditions: pre-denaturation at 94°C for 5 min; 30 cycles: denaturation at 94°C for 30 s, annealing at 60°C

[0214] 30s, extension at 72℃ for 30s; post-extension at 72℃ for 10min.

[0215] 17) Fluorescence quantitative PCR (QPCR)

[0216] 18) System (20 μl): 10 μl of 2×SYBR buffer, 2-5 μl of template (reverse transcribed cDNA diluted 10-fold as template), 1-2 μl of primers, and ultrapure water to make up to 20 μl. The human primer sequences used are as follows:

[0217] FLG primer sequence:

[0218] Forward primer (SEQ ID NO: 9): GGACAGGAACAATCATCGGGG

[0219] Reverse primer (SEQ ID NO: 10): CAACCTCTCGGAGTCGTCTG

[0220] GADPH primer sequence:

[0221] Forward primer (SEQ ID NO: 11): CTGGGCTACACTGAGCACC

[0222] Reverse primer (SEQ ID NO: 12): AAGTGGTCGTTGAGGGCAATG

[0223] 19) Reaction conditions: pre-denaturation at 94°C for 5 min; 40 cycles: denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s (real-time fluorescence photography); melting curve at 94°C for 30 s, 60°C for 30 s, and 72°C for 1 s (real-time fluorescence photography during the heating process).

[0224] 3. Experimental results

[0225] After adding 200 μM H₂O₂ for 24 hours, FLG mRNA expression in HaCaT cells decreased significantly. After adding 1% black tea fermentation broth and incubating with H₂O₂ for 24 hours, the upregulated expression of FLG mRNA in HaCaT cells was used as a basis for determining whether the black tea fermentation broths prepared in Examples 1-6 and Comparative Examples 1-10 had barrier repair and moisturizing effects.

[0226] The aroma detection, stability detection and FLG expression up-regulation rate of the black tea fermentation broth prepared in Examples 1 to 6 and Comparative Examples 1 to 10 are shown in Table 7:

[0227] Table 7 Aroma detection, stability detection and FLG expression upregulation rate

[0228]

[0229] As can be seen from the results in the above table, Examples 1 to 6 adopt the method provided by the present application, using Kluyveromyces marxianus, I. orientalis, Acetobacter xylinum and Rahnella to prepare black tea fermentation broth; during the preparation process, by controlling the inoculation amount and the staged culture conditions, the primary fermentation (yeast fermentation of Kluyveromyces marxianus and I. orientalis) and the secondary fermentation (bacterial fermentation of Acetobacter xylinum and Rahnella) form synergistic metabolism and mutualistic symbiosis between cross-species microorganisms. The prepared black tea fermentation broth has a natural rich floral aroma and high stability, can significantly upregulate the expression of FLG mRNA in HaCaT cells, and has a significant moisturizing and water-locking effect.

[0230] Comparative Example 1 and Comparative Example 2 were not inoculated with Kluyveromyces marxianus in a single fermentation. Wherein, Comparative Example 1 directly omitted Kluyveromyces marxianus, while Comparative Example 2 replaced Kluyveromyces marxianus with an equal amount of Saccharomyces cerevisiae. Lacking Kluyveromyces marxianus fermentation, the black tea fermentation liquid prepared no longer had the fragrance of roses (even if the Saccharomyces cerevisiae used in Comparative Example 2 can also produce fragrance, but the combination of the fragrance produced by it and the fragrance of black tea itself cannot make the black tea fermentation liquid have a strong rose fragrance). In addition, Comparative Example 1 and Comparative Example 2 also lack the promotion effect of ethanol accumulated during the fermentation process of Kluyveromyces marxianus on the secondary fermentation, thereby also affecting the stability of the black tea fermentation liquid and the improvement of the moisturizing and water-locking effect to a certain extent.

[0231] Comparative Examples 3 and 4 omitted I. orientalis in the first fermentation. Comparative Example 3 increased the amount of Kluyveromyces marxianus, while Comparative Example 4 replaced I. orientalis with an equal amount of Cryptococcus wahooensis. The absence of I. orientalis fermentation resulted in the system being unable to accumulate sufficient ethanol, acetic acid, and glycerol during the yeast fermentation stage, thereby failing to effectively promote the production of low molecular weight bacterial cellulose in Acetobacter xylinum metabolism, which had a significant adverse effect on the stability of the black tea fermentation broth and the improvement of its moisturizing and water-locking efficacy.

[0232] In Comparative Example 5, Acetobacter xylinum was not used in the secondary fermentation, and only Laenella fermentation was performed. Low molecular weight bacterial cellulose could not be produced in the system. The ethanol, acetic acid, and glycerol accumulated in the yeast fermentation stage were in excess in the system, which had an adverse effect on the fermentation of Laenella. The moisturizing and water-locking effect of the black tea fermentation liquid could not be effectively improved, and its stability was not conducive to it.

[0233] Comparative Examples 6 and 7 omitted Rahnella from the secondary fermentation. While Comparative Example 6 omitted Rahnella directly, Comparative Example 7 replaced it with an equal amount of Lactobacillus plantarum. The absence of Rahnella prevented the fermentation system from producing sufficient antimicrobial proteins through its metabolism, preventing the production of extracellular phytase and inducing precipitation of heavy metals accumulated in the tea leaves. This compromised the stability of the black tea fermentation broth, its antimicrobial activity, and its ability to combat bacterial inflammation-related inflammatory aging.

[0234] Although Comparative Example 8 also employed the same bacterial strains and fermentation stage control as Example 1, the bacterial strain amounts used were outside the reasonable range, resulting in a failure to maximize the synergistic effect between the bacterial strains, which was detrimental to the overall efficacy of the black tea fermentation broth. This demonstrates that the inoculum amounts of the four bacterial strains provided in this application precisely match the staged fermentation strategy, and that the unexpected effects achieved based on the four bacterial strain amounts are not routine operations performed by those skilled in the art, but rather a factor that significantly impacts the technical effectiveness of this application.

[0235] The fermentation strains and inoculum amounts used in Comparative Examples 9 and 10 are the same as those in Example 1, except that the staged fermentation strategy of the present application is not adopted. In Comparative Example 9, four strains are used for simultaneous fermentation, while in Comparative Example 10, the order of primary fermentation and secondary fermentation is swapped, with bacteria inoculated for fermentation first and yeast inoculated for fermentation. Relative to Examples 1 to 6, the stability and moisturizing and water-locking effects of the black tea fermentation liquors prepared in Comparative Examples 9 to 10 show a significant decline. When the four bacteria are fermented simultaneously or the bacteria are fermented first, the bacteria multiply rapidly and in large quantities, and the growth of the yeast is very limited, so the fragrance production is very weak, and the improvement of the moisturizing performance is also affected. This shows that the staged fermentation strategy provided in the present application has achieved unexpected results based on the fermentation sequence. It is not a routine operation of those skilled in the art, but one of the factors that has a crucial impact on the achievement of the technical effects of the present application.

[0236] 3. Human evaluation experiment on moisturizing efficacy of cosmetics

[0237] To further confirm the moisturizing and water-locking effect of the black tea fermented liquid prepared in the present application, the black tea fermented liquid prepared in Example 1 was added to a blank matrix gel (the composition of the blank matrix gel is: 0.5% p-hydroxyacetophenone, 0.5% 1,2-hexanediol, 0.2% acrylic acid (ester) / C10-30 alkyl acrylate cross-linked copolymer, 0.18% triethanolamine, and the balance is water). The amount of black tea fermented liquid added is 5% of the blank matrix gel to obtain a gel composition to be tested, and the blank matrix gel is used as a control to conduct a cosmetic moisturizing efficacy human evaluation experiment.

[0238] 1. Test instrument: Corneometer CM825 (Courage-Khazaka, Germany)

[0239] The Cornemeter CM825 measures humidity using the Moisture Measurement Value (MMV) value, which ranges from 0 to 150. To use the instrument: Press the test probe vertically against the skin surface. The probe tip is pushed back a certain distance. A spring inside the probe maintains constant pressure on the skin surface. Within one second, the main unit displays the MMV result and emits a prompt.

[0240] 2. Test environment conditions: temperature: 20-22°C, humidity: 40%-60%.

[0241] 3. Subjects: 5 subjects in total, aged 30 to 45 years old, who met the voluntary inclusion criteria, had no serious systemic diseases, no immunodeficiency or autoimmune diseases, and had not received any skin treatment or other treatment that might affect the test results on their left and right forearms.

[0242] 4. Test method:

[0243] 4.1 Preparation: Subjects should uniformly clean the inner forearms of both hands with clean water and dry them with dry tissue. Mark the inner forearms of both hands with two test areas on each forearm: one for the product area using the gel composition to be tested and the other for the control area using a blank matrix gel. The areas should be separated by at least 1 cm, and each test area should be 5 x 5 square centimeters.

[0244] 4.2 Initial Test Values: After the subject sits quietly for 30 minutes in a constant temperature and humidity chamber meeting the test environment conditions, a corneometer is used to measure the initial skin moisture content of the experimental area. The average values ​​of the product area and the control area on the left and right forearms are taken as the initial skin moisture content values ​​of the product area and the control area for each subject. The average of the initial skin moisture content values ​​of the product area of ​​the five subjects is taken as the product area MMV0; the average of the initial skin moisture content values ​​of the control area of ​​the five subjects is taken as the control area MMV0.

[0245] 4.3 Sample usage: Professionals shall apply the gel composition to be tested and the blank matrix gel to the experimental area respectively, and the application amount to each area is 0.2 g; and start timing, and test immediately after application (5 minutes after application) and 6 hours (6 hours later) according to the same method as 4.2 and obtain: the average value of the skin moisture content of the product area of ​​5 subjects at T0 (5 minutes after application), recorded as product area MMV-T0; the average value of the skin moisture content of the control area of ​​5 subjects at T0 (5 minutes after application), recorded as control area MMV-T0; the average value of the skin moisture content of the product area of ​​5 subjects at T6 (6 hours after application), recorded as product area MMV-T6; the average value of the skin moisture content of the control area of ​​5 subjects at T6 (6 hours after application), recorded as control area MMV-T6.

[0246] 4.4 Calculate the change rate of skin moisture content:

[0247] Immediate product area skin moisture content growth rate % = (product area MMV-T0-product area MMV0) / product area MMV0*100%

[0248] Immediate skin moisture content increase rate in the control area (%) = (MMV in the control area - T0 - MMV0 in the control area) / MMV0 in the control area * 100%;

[0249] 6h product area skin moisture content growth rate % = (product area MMV-T6-product area MMV0) / product area MMV0*100%

[0250] 6h control area skin moisture content growth rate % = (control area MMV-T6-control area MMV0) / control area MMV0 * 100%

[0251] 5. Test results:

[0252] Figure 5 The results of skin moisture content at each time point are shown in the figure. Figure 6 The graph shows the change rate of skin moisture content immediately and 6 hours after application. The experimental results show that the moisture content of the subjects' facial skin increased significantly immediately and 6 hours after application of the test gel composition, indicating that the black tea fermented liquid prepared in Example 1 has a significant moisturizing and water-locking effect.

[0253] The above description is only a specific embodiment of the present application. Those skilled in the art will clearly understand that for the convenience and brevity of description, the specific working process described above can refer to the corresponding process in the aforementioned method embodiment, and will not be repeated here. It should be understood that the scope of protection of the present application is not limited to this. Any person skilled in the art can easily think of various equivalent modifications or replacements within the technical scope disclosed in this application, and these modifications or replacements should be included in the scope of protection of this application.

Claims

1. A method for preparing black tea fermentation broth, characterized in that: The steps include: Mixing black tea powder with fermentation medium and sterilizing the mixture to obtain an initial fermentation system; Inoculating a composite yeast seed solution into the initial fermentation system and performing a fermentation to obtain a yeast fermentation system; wherein the composite yeast seed solution comprises a Kluyveromyces marxianus seed solution and an I. orientalis seed solution; Inoculating a composite bacterial seed solution into the yeast fermentation system for secondary fermentation to obtain a bacterial metabolic system; wherein the composite bacterial seed solution comprises Acetobacter xylinum seed solution and Rahnella seed solution; The bacterial metabolic system is inactivated, subjected to high-pressure homogenization, and subjected to solid-liquid separation, and the liquid portion is sterilized and treated with an antiseptic treatment to obtain a black tea fermentation liquid; The volume of the Kluyveromyces marxianus seed solution and the Isahomias orientalis seed solution are both 2% to 4% of the volume of the fermentation medium; the volume of the Acetobacter xylinum seed solution is 4% to 8% of the volume of the fermentation medium, and the volume of the Rahnella seed solution is 5 to 7% of the volume of the fermentation medium.

2. The method for preparing black tea fermentation broth according to claim 1, wherein The concentration of the black tea powder in the initial fermentation system is 8 g / L to 12 g / L; and / or, The number of viable bacteria in the Kluyveromyces marxianus seed solution was 0.9×10 7 CFU / mL~1.1×10 7 CFU / mL; the number of viable bacteria in the oriental yeast seed liquid is 0.9×10 7 CFU / mL~1.1×10 7 CFU / mL; and / or, The number of viable bacteria in the Acetobacter xylinum seed solution was 0.9×10 7 CFU / mL~1.1×10 7 CFU / mL; the number of viable bacteria in the Raenella seed solution was 0.9×10 8 CFU / mL~1.1×10 8 CFU / mL.

3. The method for preparing black tea fermentation liquid according to claim 1, wherein The Kluyveromyces marxianus seed solution, Issaccharomyces orientalis seed solution, Acetobacter xylinum seed solution, and Rahnella seed solution also contain a seed culture medium. Based on the total volume of the seed culture medium, the seed culture medium comprises the following components: Glucose 15g / L~25g / L, Yeast extract powder 3g / L~8g / L, Peptone 5g / L~10g / L, Sodium chloride 0.5g / L~1.5g / L, Potassium dihydrogen phosphate 1g / L~5g / L, Dipotassium hydrogen phosphate 1g / L~3g / L, Magnesium sulfate 0.05g / L~0.15g / L.

4. The method for preparing black tea fermentation liquid according to claim 1, wherein The black tea powder is prepared by the following method: The fresh black tea leaves are placed in a withering tank, withered for 15 to 18 hours under the conditions of relative humidity of 60% to 70% and temperature of 25°C to 30°C with forced air, rolled for 0.5 to 1 hour to form strips, piled and fermented for 4 to 6 hours, dried at 80°C to 100°C for 45 to 60 minutes, ground into coarse tea powder, and passed through an 80-100 mesh sieve to obtain the black tea powder.

5. The method for preparing black tea fermentation liquid according to claim 1, wherein The ventilation volume during a fermentation process is 0.2vvm to 0.5vvm; and or, The temperature during the primary fermentation is 28°C to 32°C; and or, The stirring speed during the primary fermentation process is 100 rpm to 200 rpm; and or, The fermentation culture time for one fermentation is 15h to 20h.

6. The method for preparing black tea fermentation liquid according to claim 1, wherein: The ventilation rate during the secondary fermentation process is 0.8vvm to 1.5vvm; and or, The temperature during the secondary fermentation is 30°C to 35°C; and or, The stirring speed during the secondary fermentation process is 400 rpm to 600 rpm; and or, The fermentation culture time of the secondary fermentation is 28h to 36h.

7. A black tea fermentation liquid, characterized in that: The method is prepared by any one of claims 1 to 6.

8. A cosmetic, characterized in that: The invention comprises the black tea fermentation liquid prepared by the method according to any one of claims 1 to 6 or the black tea fermentation liquid according to claim 7, and cosmetic excipients.

9. The cosmetic according to claim 8, characterized in that The amount of the black tea fermented liquor added to the cosmetic is 0.1% to 10% of the total mass of the cosmetic.

10. The cosmetic according to claim 8, characterized in that The dosage form of the cosmetic is any one of a dressing, an ointment, a cream, an emulsion, a spray, an aerosol, a cream, an aqueous solution, a gel, an oil, a patch, a film, a mud, a powder, a solution, a film coating and a powder.