Application of oncidium leaf extract in whitening and anti-aging skin care product

The preparation of skin care products by extracting Oncidium leaves with ultrapure water or anhydrous ethanol solves the insufficient application of Oncidium in the field of skin care products, achieves the whitening and anti-aging effects of skin care products, and expands the resource utilization of Oncidium.

CN120694934APending Publication Date: 2025-09-26INST OF ADVANCED TECH UNIV OF SCI & TECH OF CHINA +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511023173.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-24
Publication Date
2025-09-26

AI Technical Summary

Technical Problem

There are no reports on the application of Chinese heart orchid in the field of skin care products in the prior art, and the lack of effective ingredients for whitening and anti-aging has limited its resource utilization.

Method used

Ultrapure water or anhydrous ethanol is used as an extraction solvent, and the oncidium leaves are extracted by juicing, crushing and ultrasonic treatment to obtain the oncidium leaf extract, which is used to prepare skin care products such as facial masks, essence water, lotion, cream or spray.

Benefits of technology

Oncidium leaf extract exhibits antioxidant properties, whitening and anti-aging effects that are superior to those of Oncidium flower extract, and has higher total phenol and flavonoid contents, making it suitable for the preparation of antioxidant and whitening skin care products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120694934A_ABST
    Figure CN120694934A_ABST
Patent Text Reader

Abstract

The invention discloses application of oncidium leaf extract in whitening and anti-aging skin care products in the field of natural product chemistry. According to the invention, the oncidium extract and the oncidium leaf extract are respectively subjected to a series of research tests of antioxidant efficacy, tyrosinase inhibition, melanin inhibition, influence on melanin generation related gene expression, elastase inhibition, influence on senescence related gene expression and the like; the oncidium leaf extract is proved to have better anti-oxidation, whitening, anti-melanogenesis and anti-aging effects compared with the oncidium flower extract, the application potential of the oncidium leaf extract in preparation of skin care products with anti-oxidation, whitening and other effects is revealed, and a certain research basis is provided for further resource utilization of oncidium.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of natural product chemistry, and in particular to application of an Oncidium leaf extract in whitening and anti-aging skin care products. Background Art

[0002] Oncidium hybridum, also known as the Golden Butterfly Orchid, Dancing Girl Orchid, or Knob-petal Orchid, refers to the genus Oncidium in the Orchidaceae family. It is primarily found in tropical and subtropical regions of Central and South America, including the United States, Mexico, Paraguay, Peru, Brazil, Jamaica, and Argentina. Along with Phalaenopsis, Dendrobium, and Cymbidium, Oncidium is considered one of the four major orchids and a major commercial flower worldwide. Oncidium plants are lightweight, with a rich variety of colors and graceful blooms, some varieties even possessing fragrance. They are widely adaptable, have a long flowering period, and are highly ornamental and economically valuable.

[0003] With the development of the skin care industry and consumers' demand for plant-based skin care, the application range of plant extracts in cosmetics will become more and more extensive. Plant ingredients play an important role in skin whitening, moisturizing, anti-aging, sun protection, anti-inflammatory and anti-corrosion and antibacterial effects of cosmetics. For example, extracts of Sophora flavescens, Rhodiola rosea, Ginseng, Centella asiatica, tea, etc. have whitening, freckle removal, anti-inflammatory, antibacterial, and anti-wrinkle effects. At present, Oncidium is widely used in cut flowers, potted flowers and landscapes, but there are no related reports in the field of skin care products. In order to systematically broaden the application field of Oncidium and provide a research basis for promoting the further resource utilization of Oncidium, the present invention proposes an application of Oncidium leaf extract in whitening and anti-aging skin care products. Summary of the Invention

[0004] The purpose of the present invention is to solve the above technical problems and provide an application of Oncidium leaf extract in whitening and anti-aging skin care products.

[0005] The present invention achieves the above-mentioned purpose through the following technical solutions: The present invention provides the use of an Oncidium leaf extract in whitening and anti-aging skin care products. The Oncidium leaf extract is obtained by taking fresh Oncidium leaves and ultrapure water, squeezing juice, crushing to obtain a crushed product, adding an extraction solvent to the crushed product, filtering after ultrasonic treatment, and retaining a filtrate.

[0006] As a further optimized solution of the present invention, the extraction solvent is one of ultrapure water or anhydrous ethanol.

[0007] As a further optimization solution of the present invention, the mass-to-volume ratio between the fresh Oncidium leaves and the extraction solvent is 25g:150ml.

[0008] As a further optimized solution of the present invention, the total phenol content in the Oncidium leaf extract is 2535.14-2539.46 μmol / L, and the flavonoid content is 19.71-30.89 μg / ml.

[0009] As a further optimized solution of the present invention, the skin care product is any one of a facial mask, essence water, lotion, cream, gel or spray.

[0010] The beneficial effects of the present invention are: The present invention conducts a series of research experiments on the antioxidant efficacy, tyrosinase inhibition, melanin inhibition, effect on the expression of melanin production-related genes, elastase inhibition, effect on the expression of aging-related genes, etc. on Oncidium flower extract and Oncidium leaf extract, respectively. It is proved that Oncidium leaf extract has better antioxidant performance, whitening, anti-melanin production and anti-aging effects than Oncidium flower extract, and has application potential in preparing skin care products with antioxidant, whitening and other effects.

[0011] The present invention is to efficiently and systematically expand the application field of Oncidium orchid extract, and provide a certain research basis for further resource utilization of Oncidium orchid.

[0012] The oncidium leaf extract of the present invention uses ultrapure water or anhydrous ethanol as the extraction solvent. The extraction method has the advantages of being simple, efficient, convenient, and not using toxic or harmful organic solvents. The production practice is easier to promote and apply. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The results of the effects of the water extract and alcohol extract of Oncidium orchid provided by the present invention on the DPPH free radical scavenging rate; Figure 2 The results of the effects of the water extract and alcohol extract of Oncidium leaves provided by the present invention on the DPPH free radical scavenging rate; Figure 3 The results of the effects of the water extract and alcohol extract of Oncidium orchid provided by the present invention on the ABTS free radical scavenging rate; Figure 4 The results of the effects of the water extract and alcohol extract of Oncidium leaves provided by the present invention on the ABTS free radical scavenging rate; Figure 5 The results of the tyrosine monophenolase inhibition test of the Oncidium extract provided by the present invention are as follows; Figure 6 The results of the tyrosine diphenolase inhibition test of the Oncidium extract provided by the present invention are as follows; Figure 7 The cytotoxicity test results of the Oncidium extract provided by the present invention; Figure 8The results of the effect of the Oncidium orchid water extract provided by the present invention on the expression of melanin production-related genes DCT gene, MITF gene, TYR gene, and TYRP1 gene; Figure 9 The results of the effect of the Oncidium leaf water extract provided by the present invention on the expression of melanin production-related genes DCT gene, MITF gene, TYR gene, and TYRP1 gene; Figure 10 The results of the inhibition rate of the Oncidium orchid water extract and alcohol extract on elastase provided by the present invention are as follows; Figure 11 The results of the inhibition rate of the water extract and ethanol extract of Oncidium leaves provided by the present invention on elastase; Figure 12 Comparison of total phenolic content in the Oncidium flower water extract and Oncidium leaf water extract provided by the present invention; Figure 13 The present invention provides a comparison of the flavonoid content in the Oncidium flower water extract and the Oncidium leaf water extract. DETAILED DESCRIPTION

[0014] The present application is described in further detail below in conjunction with the accompanying drawings. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0015] Materials and Methods Unless otherwise specified, the methods used in the present invention are conventional methods known to those skilled in the art. If specific conditions are not specified, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be purchased commercially.

[0016] Preparation of test materials Preparation of Oncidium leaf extract Preparation of aqueous extract from Oncidium leaves Accurately weigh 25 g of fresh Oncidium leaves, add 100 ml of ultrapure water, place in a juicer, start the instrument to crush, transfer the crushed product to a conical flask, add 150 ml of ultrapure water, ultrasonicate for 30 minutes, filter and collect the filtrate to obtain the Oncidium leaf water extract.

[0017] Preparation of 60% ethanol extract from Oncidium leaves Accurately weigh 25 g of fresh Oncidium leaves, add 100 ml of ultrapure water, place in a juicer, start the instrument to crush, transfer the crushed product to a conical flask, add 150 ml of anhydrous ethanol, ultrasonicate for 30 minutes, filter and collect the filtrate to obtain a 60% ethanol extract of Oncidium leaves.

[0018] Preparation of Oncidium flower extract Using Oncidium flowers as materials, the Oncidium leaf water extract and Oncidium leaf 60% ethanol extract were obtained according to the same preparation steps as described in 1.1.

[0019] Efficacy verification trial 2.1 Antioxidant efficacy test The antioxidant effects of Oncidium orchid leaf water extract, Oncidium orchid leaf ethanol extract, Oncidium orchid leaf water extract and Oncidium orchid leaf ethanol extract were evaluated by DPPH method and ABTS method respectively.

[0020] 2.1.1. DPPH free radical scavenging rate determination DPPH ethanol solution is purple-red with a maximum absorption wavelength at 519 nm. When a free radical scavenger is added, DPPH radicals are scavenged, the solution gradually becomes lighter, and the absorbance at 519 nm decreases. The lighter the solution color, the lower its absorbance, and the more effective the free radical scavenger is in scavenging DPPH radicals.

[0021] The specific method is as follows: use a 96-well plate to set up experimental wells (T), experimental control wells (T0), DPPH model wells (C) and model control wells (C0). For each test concentration of each sample, three parallel wells need to be set up for the experimental well (T), and three parallel wells need to be set up for the DPPH model well (C); 100 μl of sample solution of the same concentration is added to the experimental well (T) and experimental control well (T0), and 100 μl of sample solvent is added to the DPPH model well (C) and model control well (C0); 100 μl of DPPH working solution (0.5 mmol / L) is added to the experimental well (T) and DPPH model well (C), and 100 μl of anhydrous ethanol is added to the experimental control well (T0) and model control well (C0); after the 96-well plate is kept in the dark at room temperature for 30 min, 519 The absorbance was measured at 37.37 nm, and the DPPH radical scavenging rates of Oncidium leaf water extract, Oncidium leaf ethanol extract, Oncidium leaf water extract and Oncidium leaf ethanol extract at different concentrations were calculated based on the absorbance values.

[0022] The DPPH free radical scavenging rate was calculated according to the following formula: Where: A 模 is the absorbance value of the DPPH model well; A 模对 is the absorbance value of the model control well; A 样 is the absorbance value of the experimental well; A 样对 The absorbance value of the experimental control well.

[0023] The results of DPPH free radical scavenging rate of Oncidium orchid water extract and alcohol extract are as follows: Figure 1 As shown in the figure, the results of DPPH free radical scavenging rate of Oncidium leaf water extract and alcohol extract are as follows: Figure 2 As shown in the figure, the DPPH radical scavenging efficiency of Oncidium leaf / flower extracts increases with increasing concentration. The DPPH radical scavenging efficiency of Oncidium flower water and alcohol extracts is inferior to that of Oncidium leaf water and alcohol extracts, as well as the positive control, Trolox. At concentrations of 2.5-5%, Oncidium leaf water and alcohol extracts are comparable to the positive control, Trolox.

[0024] 2.1.2. ABTS free radical scavenging rate determination ABTS reacts with potassium persulfate to produce green ABTS + Substances with antioxidant properties can scavenge ABTS + ABTS + The maximum absorption is at 734 nm. The absorbance is measured and the free radical scavenging ability of the reactant can be quantitatively determined by the absorbance value. That is, the lower the absorbance value, the stronger the antioxidant's ability to scavenge ABTS free radicals.

[0025] The specific method is as follows: use a 96-well plate to set up experimental wells (T), experimental control wells (T0), ABTS model wells (C) and model control wells (C0). For each test concentration of each sample, three parallel wells need to be set up for the experimental well (T), and three parallel wells need to be set up for the ABTS model well (C). 50 μl of sample solution of the same concentration was added to the experimental well (T) and experimental control well (T0), and 50 μl of sample solvent was added to the ABTS model well (C) and model control well (C0). 150 μl of ABTS working solution (7.4 mmol / L ABTS solution and 2.6 mmol / L K2S2O8 solution were mixed in a ratio of 1:1, allowed to stand for 12 h, and then diluted 20 times) was added to the experimental well (T) and ABTS model well (C). 150 μl of ultrapure water was added to the experimental control well (T0) and model control well (C0). After the 96-well plate was placed at room temperature for 6 min, 734 The absorbance was measured at 37.37 nm, and the ABTS free radical scavenging rates of Oncidium leaf water extract, Oncidium leaf ethanol extract, Oncidium leaf water extract and Oncidium leaf ethanol extract at different concentrations were calculated based on the absorbance values.

[0026] The ABTS free radical scavenging rate was calculated according to the following formula: Where: A 模 is the absorbance value of the ABTS model well; A 模对 is the absorbance value of the model control well; A 样 is the absorbance value of the experimental well; A 样对 The absorbance value of the experimental control well.

[0027] The results of ABTS free radical scavenging rate of Oncidium flower extract and alcohol extract are as follows Figure 3 As shown in the results, the ABTS free radical scavenging rate of Oncidium leaf water extract and alcohol extract is as follows Figure 4 As shown in the figure, it can be seen that the Oncidium leaf / flower extract has a strong scavenging effect on ABTS free radicals, and the effect increases with the increase of concentration.

[0028] The combined results of DPPH free radical scavenging rate and ABTS free radical scavenging rate showed that the antioxidant effect of Oncidium leaf extract was better than that of Oncidium flower extract.

[0029] Furthermore, the IC values ​​of Oncidium leaf water extract, ethanol extract and Oncidium flower water extract, ethanol extract to DPPH free radical and ABTS free radical were calculated. 50 The values ​​are shown in Table 1.

[0030] Table 1. IC values ​​of different Oncidium extracts for DPPH free radical and ABTS free radical 50 value ; 2.2 Tyrosinase inhibition test The test steps are as follows: (1) Kojic acid (positive control) was diluted with pH 6.8 PB buffer to a concentration gradient of 0.25 mg / ml, 0.13 mg / ml, 0.06 mg / ml, 0.03 mg / ml and 0.01 mg / ml to verify the test system.

[0031] (2) Test substance treatment: The test substance was diluted with pH 6.8 PB buffer to form multi-level concentration samples.

[0032] (3) Referring to Table 2-3, the inhibition levels of tyrosine monophenolase and diphenolase activities were tested respectively. The specific method is as follows: Use a 96-well plate to set up sample wells (T), sample background (T0), enzyme reaction wells (C), and solvent background (C0). For each sample well (T) of each tested concentration, three parallel wells should be set up, and at the same time, three parallel wells should be set up for the enzyme reaction well (C). Add 50 μl of sample solution of the same concentration to each well of the sample (T) and sample background (T0), and add 50 μl of pH 6.8 PB buffer to each well of the enzyme reaction well (C) and solvent background (C0).

[0033] Add 50 μl of tyrosinase working solution to each of the sample wells (T) and enzyme reaction wells (C). Replace the sample background (T0) and solvent background (C0) with 50 μl of PB buffer. Place the 96-well plate in a 37°C incubator and incubate for 10 minutes.

[0034] Use a spray gun to add 100 μl of L-tyrosine solution or L-dopa solution to each reaction space. After standing at room temperature for 1 hour, place the 96-well plate in a microplate detection system (enzyme reader) and measure the absorbance of each well at 475 nm.

[0035] (4) Calculate the tyrosinase inhibition rate using the following formula: Where: T is the absorbance of the sample tube, that is, the absorbance of the solution after the sample reacts with tyrosinase; T0 is the background absorbance of the sample; C is the average of three absorbances of the enzyme reaction tube, that is, the absorbance after the tyrosinase reaction when no sample is added; C0 is the background absorbance of the solvent.

[0036] Table 2. Sample addition requirements for tyrosine monophenolase activity inhibition level test ; Table 3. Sample addition requirements for tyrosine diphenolase activity inhibition level detection ; (5) Validation of the test: Each batch of experiments needs to be tested with a positive control. The IC 50 The test system is considered valid if the sample concentration (corresponding to achieving 50% inhibition) is between 0.01 mg / ml and 0.1 mg / ml. Calculate the tyrosinase inhibition rate of the sample at each test concentration using the above formula. Simultaneously, calculate the standard deviation (SD) of the inhibition rate between replicate tubes in each group. The parallelism of the test is considered valid if the SD value is ≤3%.

[0037] The results are shown in Tables 4, 5 and Figure 5 、 Figure 6 shown.

[0038] Table 4. Tyrosine monophenolase activity inhibition level test results ; Table 5. Tyrosine diphenolase activity inhibition level test results ; As can be seen from Table 4-5, the positive control kojic acid has an IC value of tyrosine monophenolase. 50 About 0.071mg / ml, diphenolase IC 50 It is about 0.049 mg / ml, all within 0.01 mg / ml-0.1 mg / ml, and the test system is considered effective.

[0039] Tyrosine monophenolase and diphenolase IC 50From the results of the literature, the tyrosinase inhibition levels of Oncidium orchid ethanol extract, Oncidium orchid leaf ethanol extract, Oncidium orchid leaf water extract and Oncidium orchid flower water extract were ranked from high to low. Figure 4 、 Figure 5 The results can also draw the same conclusion.

[0040] 2.3 Melanin inhibition test 2.3.1 Cytotoxicity test In a 96-well plate, 100 μl of B16-F10 cell suspension was added to each well to a cell density of 5,000 cells / well. The plates were then incubated in a 5% CO2 incubator for 24 hours. The ethanol extract of Oncidium flower, the aqueous extract of Oncidium flower, the ethanol extract of Oncidium leaf, and the aqueous extract of Oncidium leaf were diluted to a concentration of 20% in DMEM supplemented with 10% FBS. After sterilization by filtration through a 0.22 μm filter, the plates were further diluted to concentrations of 20%, 10%, 5%, 2.5%, 1.3%, and 0.6%, respectively. After 24 hours of incubation, the cells were removed and the supernatant discarded. Different concentrations of Oncidium leaf extract were added to each well in triplicate for each concentration, and the plates were incubated in a 5% CO2 incubator for another 24 hours.

[0041] Remove the cell culture plate, discard the supernatant, add 100 μl of DMEM culture medium and 10 μl of CCK8 solution to each well, and incubate in a 5% CO2 incubator for 2-4 hours. Measure the absorbance at 450 nm using a microplate reader. Calculate the cell proliferation rate using the following formula: Cell proliferation rate = OD 实验组 / OD 细胞对照组 ×100%; Among them, the experimental group was added with different concentrations of Oncidium leaf extract, and the control group was not added with Oncidium leaf extract.

[0042] The results are as follows Figure 7 As shown, the water extract, alcohol extract of Oncidium orchid and the alcohol extract of Oncidium leaf had no obvious toxic effect on cells at the addition amount of 0.6-1.3%, while the water extract of Oncidium leaf had no obvious toxic effect on cells at the addition amount of 0.6-20%.

[0043] 2.3.2. Detection of melanin expression inhibition level in B16-F10 cells (1) Grouping The test requires setting up a blank control group (Negative control, NC), a model control group (MC), a positive control group (PC), and a test substance group (T). Each group should have three parallel groups.

[0044] Blank control group (NC): contains only cell culture medium.

[0045] Model control group (MC): cell culture medium containing 500 nmol / L α-MSH.

[0046] Positive control group (PC): cell culture medium containing 500 nmol / L α-MSH and 0.01% β-arbutin.

[0047] Test group (T): cell culture medium containing 500 nmol / L α-MSH and test substances at different concentrations.

[0048] (2) Experimental process Take a 6-well plate and add 2 mL of B16-F10 cell suspension (purchased from ATCC, model CRL-6475) to each well to make the cell density 4×10 4 Cells were plated at 100 μL per well and incubated in a 5% CO2 incubator for 24 h. The supernatant was discarded, and 2 mL of the sample from each group was added to each well and incubated in a 5% CO2 incubator for an additional 72 h. The supernatant was discarded, and each well was washed twice with 1 mL of PBS buffer. The PBS was discarded, and 200 μL of trypsin solution was added to each well for 2-4 min. 1 mL of PBS was added to each well and the cells were perfused. The cell suspension was transferred to a 1.5 mL EP tube and centrifuged at 300 g for 5 min. The supernatant was discarded, and 150 μL of melanin extract solution was added to each tube. The tube was incubated in a water bath (90°C ± 5°C) for 1 h until the melanin was completely dissolved. The solution was mixed by pipetting, and 100 μL of each tube was transferred to the corresponding well of a 96-well plate. The melanin extract solution was used as a zero control, and the OD value was measured at 405 nm on a microplate reader.

[0049] (3) Result processing The melanin inhibition rate was calculated according to the following formula: ; Where, OD MC The actual measured absorbance value of the model control group is the absorbance value of the model control group minus the absorbance value of the zero-adjusted control; OD T / PC The actual measured absorbance value of the test substance group or the positive control group is the absorbance value of the test substance group or the positive control group minus the absorbance value of the zero-adjusted control.

[0050] The results are shown in Table 6.

[0051] Table 6. Detection results of the inhibitory effect of Oncidium leaf extract on melanin expression in B16-F10 cells ; The results showed that the ethanol extract of Oncidium orchid leaves, at a 1% addition, had a superior inhibitory effect on melanin production in B16-F10 cells compared to the ethanol extract of Oncidium orchid flowers. Neither the water extract of Oncidium orchid flowers nor the water extract of Oncidium orchid leaves had any inhibitory effect on melanin production in B16-F10 cells at a 1% addition. Furthermore, the water extract of Oncidium orchid leaves exhibited a significant inhibitory effect on melanin production in B16-F10 cells at 5% and 10% additions, in a dose-dependent manner.

[0052] 2.3.3 Tyrosinase activity inhibition test in B16-F10 melanocytes (1) Grouping Same as Section 2.3.2.

[0053] (2) Experimental process 2 ml of B16-F10 cell suspension was added to each well of a 6-well plate to a cell density of 4 × 10⁴ cells / well. The cells were then incubated in a 5% CO₂ incubator for 24 h. The supernatant was discarded, and 2 ml of the different grouped samples were added to each well. The cells were then incubated in a 5% CO₂ incubator for an additional 72 h. The supernatant was discarded, and each well was washed twice with 1 ml of PBS buffer. The PBS was discarded, and 350 µL of 0.5% (v / v) Triton X-100 solution was added to each well to lyse the cells. The cells were perfused and the cell extract from each well was collected into a 1.5 mL EP tube. The cells were centrifuged at 12,000 g for 10 min, and the supernatant was collected. Protein concentration in the supernatant after cell lysis was quantified using a BCA protein quantification kit according to the manufacturer's instructions. The protein concentration was adjusted to the same level with 0.5% (v / v) Triton X-100 for subsequent enzyme activity assays.

[0054] 100 μL of supernatant from each tube was placed in a 96-well plate, and 100 μL of L-DOPA solution (to detect diphenolase activity) was added to each well. At the same time, 100 μL of 0.5% (v / v) Triton X-100 was added to 100 μL of L-DOPA solution as a zero adjustment control.

[0055] The 96-well plate was placed in a thermostat (37°C ± 1°C) and incubated for 1 h, and the absorbance was measured at 475 nm.

[0056] (3) Result processing ; Where, OD MC The actual measured absorbance value of the model control group is the absorbance value of the model control group minus the absorbance value of the zero-adjusted control; OD T / PC The actual measured absorbance value of the test substance group or positive control group is the absorbance value of the test substance group or positive control group minus the absorbance value of the zero-adjusted control.

[0057] The standard deviation (SD) of the absorbance values ​​of the three parallel groups in each test group was calculated. The results are shown in Table 7.

[0058] Table 7. Inhibition rate of Oncidium leaf extract on tyrosine diphenolase activity in B16-F10 cells ; The results are shown in Table 7. The water extract of Oncidium orchid had no inhibitory effect on the tyrosine diphenolase activity in B16-F10 cells at an addition amount of 1%. The alcohol extract and water extract of Oncidium orchid leaves had better inhibitory effect on the tyrosine diphenolase activity in B16-F10 cells at an addition amount of 1% than the alcohol extract of Oncidium orchid with the same addition amount.

[0059] In addition, the water extract of Oncidium leaves had a good inhibitory effect on the activity of tyrosine diphenolase in B16-F10 cells when added at 5% and 10%, and there was a dose-dependent relationship.

[0060] 2.3.4. Effect of Oncidium Extract on the Expression of Melanin-Related Genes (1) Cell recovery and culture Remove the frozen B16-F10 cells from liquid nitrogen, quickly thaw them in a 37°C water bath, and then transfer them to a centrifuge tube containing preheated culture medium. After centrifugation, discard the supernatant, resuspend the cells in fresh culture medium, inoculate them into a culture dish, and culture them in an incubator until the cells reach the logarithmic phase.

[0061] (2) Cell passaging and plating The cells in the logarithmic growth phase were passaged and the cell density was adjusted to 4×10 5 After 100 cells / ml, they were inoculated into 6-well plates, 1 ml per well, and appropriate amount of culture medium was added to ensure uniform distribution of cells. The culture was continued until the cells were stably attached to the wall.

[0062] (3) Grouping The test requires setting up a blank control group (NC), a model control group (MC), and a test substance group (T). Each group should have three parallel groups.

[0063] Blank control group (NC): contains only cell culture medium.

[0064] Model control group (MC): cell culture medium containing 500 nmol / L α-MSH.

[0065] Test substance group (T): cell culture medium containing 500 nmol / L α-MSH and different concentrations of test substances (2.5%, 5% and 10% Oncidium extract).

[0066] (4) Oncidium extract intervention After the cells have attached and stabilized, the original culture medium is removed and 2 ml of the sample from each group is added to each well. The cells are then cultured in an incubator containing 5% CO2 for 24 h. Multiple replicates are set up for each group to ensure the reliability of the results.

[0067] (5) Melanin-related gene detection Remove the cell culture plate, discard the culture medium, and add the RZ lysis buffer of the total RNA extraction kit (brand: TIANGEN, product number: DP419) directly to the culture dish. Extract RNA according to the kit instructions and measure the RNA concentration using a micro-UV spectrophotometer. When the RNA quality is good, proceed to the next step.

[0068] Reverse transcription was performed in an RNase-free PCR tube according to the instructions for the Starscript II Reverse Transcription Kit (Genstar, Catalog No. A233-10). Primers and template were added according to the instructions for the 2xSYBR Green Master Mix Kit (Bimake, Catalog No. B21203). The primer information is as follows: The NCBI accession number of the MITF gene is NM_001410059.1; MITF upstream primer: 5′-AACGGGAACAGCAACGAGC-3′; MITF downstream primer: 5′-GGTGGATGGGATAAGGGAAAGT-3′; The NCBI accession number of the DCT (TYRP2) gene is NM_010024.3; DCT upstream primer: 5′-TCCTCCACTCTTTTACAGACGC-3′; DCT downstream primer: 5′-AGGGGACCATGTTATACATTCG-3′; The NCBI accession number of the TYR gene is NM_001417448.1; TYR upstream primer: 5′-AGCCCAGCATCCTTCTTCTC-3′; TYR downstream primer: 5′-AGTGGTCCCTCAGGTGTTCC-3′; The NCBI accession number of the TYRP1 gene is NM_001282015.1; TYRP1 upstream primer: 5′-ATTGCTGTAGTGGCTGCGTTGT-3′; TYRP1 downstream primer: 5′-GAGGCTGGTTGGCTTCATTC-3′; The NCBI accession number of the GAPDH gene is NM_001411843.1; Internal control GAPDH upstream primer: 5′ TGAAGCAGGCATCTGAGGG 3′; Internal control GAPDH downstream primer: 5' CGAAGGTGGAAGAGTGGGAG 3'.

[0069] For real-time fluorescence quantitative PCR, select a 20 μl system and add 1 μl of template, 1 μl of upstream primer and 1 μl of downstream primer, 10 μl of 2xSYBR Green Master Mix, and 7 μl of deionized water to each well of a 96-well plate to prepare a mixed solution reagent. After affixing a PCR transparent sealing film, centrifuge and place on a PCR instrument to amplify according to the table below. Use statistical software such as Excel or SPSS to organize the collected data and calculate 2 -△△ct The PCR reaction conditions are shown in Table 8.

[0070] Table 8. PCR reaction conditions ; Test results such as Figure 8 、 Figure 9 As shown, an aqueous extract of Oncidium orchid leaves inhibited the mRNA expression of MITF, DCT (TYRP2), TYR, and TYRP1 in a dose-dependent manner, whereas an aqueous extract of Oncidium orchid flowers did not exhibit this effect. In mammals, melanin is an essential biological pigment produced by three melanocyte-specific enzymes: TYR, TYRP1, and TYRP2. Tyrosinase initiates melanin biosynthesis by oxidizing tyrosine to L-DOPA. TYRP1 and TYRP2 have been shown to increase tyrosinase stability and induce melanin synthesis. In particular, MITFis is a master transcription factor of the melanocyte lineage, stimulating melanogenesis by activating the transcription of tyrosinase, TYRP1, and TYRP2.

[0071] It can be seen from this that the water extract of Oncidium leaves has good anti-melanin production activity.

[0072] 2.4 Elastase inhibition assay The inhibitory effects of aqueous and ethanolic extracts of Oncidium orchid flowers and aqueous and ethanolic extracts of Oncidium orchid leaves on elastase were tested. This method uses N-succinyl-alanine-alanine-alanine-p-nitroaniline as a substrate. After reaction with elastase, the solution turns yellow with a maximum absorption wavelength at 380 nm. When the active substance inhibits elastase activity, the solution becomes lighter, and the absorbance at 380 nm decreases. The lighter the solution color, the lower the absorbance value, and the better the elastase inhibition effect.

[0073] The specific method is as follows: a 96-well plate is used to set up experimental wells (T), experimental control wells (T0), elastase model wells (C) and model control wells (C0). Three parallel wells are required for each experimental well (T) of each sample and each tested concentration, and three parallel wells are required for the elastase model well (C). 100 μl of sample solution of the same concentration is added to each experimental well (T) and experimental control well (T0), and 100 μl of sample solvent is added to each elastase model well (C) and model control well (C0). 50 μl of elastase working solution (5 U / ml) is added to each experimental well (T) and elastase model well (C), and 50 μl of solvent is added to the experimental control well (T0) and model control well (C0), and the wells are placed at 25°C for 15 min. 50 μl of substrate working solution (1 mmol / L) is added to each experimental well (T) and elastase model well (C), and 50 μl of substrate working solution (1 mmol / L) is added to each experimental well (T) and elastase model well (C), and 50 μl of substrate working solution (1 mmol / L) is added to each experimental well (T) and elastase model well (C). The 96-well plate was placed at room temperature for 20 min, and the absorbance was measured at 380 nm. The elastase inhibition rates of Oncidium flower water extract, Oncidium flower ethanol extract, Oncidium leaf water extract, and Oncidium leaf ethanol extract at different concentrations were calculated based on the absorbance values.

[0074] The elastase inhibition rate was calculated according to the following formula: Where: A 模 is the absorbance value of the elastase model well; A 模对 is the absorbance value of the model control well; A 样 is the absorbance value of the experimental well; A 样对 The absorbance value of the experimental control well.

[0075] The results are as follows Figure 10 、 Figure 11As shown in the figure, at test concentrations of 3%-50%, the water extract of Oncidium flower had no inhibitory activity against elastase, while the ethanol extract of Oncidium flower at a concentration of 50% was still less effective than 20mg / ml VC. At test concentrations of 3%-50%, both the water extract and ethanol extract of Oncidium leaf had inhibitory activity against elastase, and their inhibitory effects on elastase were both better than 20mg / ml VC at a test concentration of 50%.

[0076] 2.5. Detection of active ingredient content in different Oncidium extracts The active ingredient content of Oncidium leaf water extract, ethanol extract and Oncidium flower water extract, ethanol extract were tested. The flavonoids detection method was based on GB / T 5009.124-2003, and the total phenols detection method was based on GB / T 8313-2008. The test results are shown in Table 9. Figure 12 、 Figure 13 shown.

[0077] Table 9. Active ingredient content in each product ; It can be seen that the Oncidium leaf extract contains extremely high total phenolic and flavonoid contents, which makes it possible to be used in skin external compositions.

[0078] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. Application of Oncidium leaf extract in whitening and anti-aging skin care products, characterized in that: The Oncidium leaf extract is obtained by squeezing fresh Oncidium leaves with ultrapure water, crushing to obtain a crushed product, adding an extraction solvent to the crushed product, filtering after ultrasonic treatment, and retaining a filtrate.

2. The use of the Oncidium extract according to claim 1 in whitening and anti-aging skin care products, characterized in that: The extraction solvent is one of ultrapure water or anhydrous ethanol.

3. The use of the Oncidium leaf extract according to claim 1 in whitening and anti-aging skin care products, characterized in that: The mass-to-volume ratio between the fresh Oncidium leaves and the extraction solvent is 25g:150ml.

4. The use of the Oncidium leaf extract in whitening and anti-aging skin care products according to claim 1, characterized in that: The total phenol content of the Oncidium leaf extract is 2535.14-2539.46 μmol / L, and the flavonoid content is 19.71-30.89 μg / ml.

5. The use of the Oncidium leaf extract according to claim 1 in whitening and anti-aging skin care products, characterized in that: The skin care product is any one of a facial mask, essence water, lotion, cream, gel or spray.