Method for deacidifying berry fruit wine

Abstract

The invention provides a method for reducing acidity of berry fruit wine. The method comprises the following steps: compounding blueberry pulp and pitaya pulp according to a set proportion to prepare compound pulp; non-saccharomyces cerevisiae and saccharomyces cerevisiae are inoculated into the composite fruit pulp together for fruit wine fermentation, the berry fruit wine is obtained, and the non-saccharomyces cerevisiae is a special microbial strain which is screened from blueberry fruit raw materials and has the function of reducing organic acid. By increasing the initial pH value of the berry fermentation raw material and adding the special microbial strain with the organic acid degradation function, the acidity of the berry fruit wine is reduced, the acidity of the berry fruit wine product can be effectively reduced, and the flavor and taste quality of the berry fruit wine product can be guaranteed.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for reducing the acidity of berry wine. Background Art

[0002] blueberry( Vaccinium spp. Blueberries (Vaccinium vitis-idaea) are a small berry in the Ericaceae family. Horticulturally, they are among the fruits with the highest anthocyanin content. However, due to their poor storage resistance and significant variations in acidity, sugar content, and other qualities among different varieties, a large amount of blueberry fruit remains after fresh sales, requiring processing. Blueberries, with their high sugar, organic acid, and anthocyanin content, are well-suited for fermentation into functional wines. Therefore, fermented wine is currently one of the main products of blueberry processing.

[0003] Because some varieties and origins of blueberries have too high organic acid content, fermented wines are often sour, with a sharp, rough, and unharmonious taste and poor quality. Harmonious acidity is the key to the quality of wine. An appropriate amount of organic acid can give blueberry wine a mellow taste, inhibit the growth of some harmful microorganisms, and balance the bitterness of the wine itself. However, too much organic acid will cause the wine to taste sour, rough, and unharmonious, which will directly affect the taste and quality of the wine. Therefore, blueberry berries need to be treated to reduce acidity when processed into wine.

[0004] The main reason for the acidic nature of blueberry wine is the excessive organic acids in the raw materials themselves and the organic acids produced during fermentation. Currently, there are several methods for deacidification: 1. Deacidification at the raw material end: This involves adding alkali to neutralize the raw materials before fermentation or to the fermented product afterward. However, this method significantly impacts the taste of the final wine. 2. Deacidification by shortening the fermentation time: While this can reduce some acidity, it underutilizes the raw material sugars, resulting in excessively high sugars, low alcohol content, insufficient flavor compounds, and a poor taste, making it unsuitable for dry red wines. 3. Deacidification by adsorbents: Post-fermentation deacidification is performed using processes such as bentonite clarification and adsorption. However, this process also removes a significant amount of functional substances such as anthocyanins and phenols, affecting the taste and resulting in significant loss of nutritional and functional substances. 4. Deacidification during fermentation: This method is currently the most commonly used, but requires a large number of refrigerated storage tanks, resulting in high refrigeration and insulation costs, a long deacidification period (typically over a year), and ineffective deacidification. Therefore, developing an effective deacidification method for blueberry wine has become a technical difficulty in blueberry berry fermentation wine. Summary of the Invention

[0005] The object of the present invention is to provide a method for reducing the acidity of berry wine. By increasing the initial pH value of berry fermentation raw materials and adding special microbial strains with the function of degrading organic acids, the acidity of berry wine can be reduced. This method can not only effectively reduce the acidity of the berry wine product, but also ensure the flavor and taste quality of the berry wine product.

[0006] To achieve the above objectives, the present technical solution provides a method for reducing the acidity of berry wine, comprising the following steps: The composite pulp is prepared by mixing blueberry pulp and dragon fruit pulp in a set ratio; Non-brewer's yeast and brewer's yeast are inoculated into composite fruit pulp together for wine fermentation to obtain berry wine, wherein the non-brewer's yeast is a special microbial strain with the function of reducing organic acid screened from blueberry fruit raw materials.

[0007] In some embodiments, the weight ratio of pitaya pulp to blueberry pulp is 2:8 to 3:7. This solution increases the pH value of the composite pulp by compounding pitaya pulp and blueberry pulp, thereby reducing the initial acidity of the composite pulp.

[0008] In some embodiments, the blueberry pulp is obtained by crushing blueberry fruit raw materials, and the dragon fruit pulp is obtained by crushing dragon fruit raw materials.

[0009] In some embodiments, the Saccharomyces cerevisiae is selected to be conventional Saccharomyces cerevisiae.

[0010] In some embodiments, the non-Saccharomyces yeast is selected from Hansenula vitis spores ( Hanseniaspora uvarum ), Pichia terrestrial ( Pichia terricola ), Pichia brunnei ( Pichia bruneiensis ) and Saturnella saitoensis ( Saturnispora diversa ) or any combination thereof.

[0011] Preferably, the non-brewery yeast is selected from Hansenula vitis spores ( Hanseniaspora uvarum ), Pichia terrestrial ( Pichia terricola ), Pichia brunnei ( Pichia bruneiensis ) and Saturnella saitoensis ( Saturnispora diversa ) or a combination of any two.

[0012] The grape juice spore-bearing Hansenula sporogenes obtained by this scheme ( Hanseniaspora uvarum ), the strain was screened from blueberries (Blue Beauty No. 1 variety) collected from the blueberry planting base of Degaole Family Farm in Baijiang Town, Hangzhou City, Zhejiang Province in June 2022. It was deposited in the General Microbiology Center of China Culture Collection Administration on November 8, 2023. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 28901.

[0013] The terrestrial Pichia pastoris obtained by screening in this scheme ( Pichia terricola), the strain was screened from blueberries (Lexie variety) collected from the blueberry planting base of Gaofeng Blueberry Planting Co., Ltd. in Hangzhou, Zhejiang Province in June 2022. It was deposited in the General Microbiology Center of China Culture Collection Committee on November 8, 2023. The deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 28903.

[0014] The Pichia brunnensis strains obtained by this method ( Pichia bruneiensis ), the strain was screened from blueberries (O'Neill variety) collected from the blueberry planting base of Degaulle Family Farm in Baijiang Town, Hangzhou City, Zhejiang Province in June 2022. It was deposited in the General Microbiology Center of China Culture Collection Administration on November 8, 2023. The deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 28904.

[0015] The Saito Saturn yeast strains obtained by this method ( Saturnispora diversa ), the strain was screened from blueberries (rabbit eye variety) collected from the blueberry planting base of Gaofeng Blueberry Planting Co., Ltd. in Hangzhou, Zhejiang Province in June 2022. It was deposited in the General Microbiology Center of China Culture Collection Administration on November 8, 2023. The deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 28902.

[0016] In some embodiments, the process of inoculating non-Saccharomyces cerevisiae and Saccharomyces cerevisiae into a composite fruit pulp for fruit wine fermentation comprises the following steps: S1: Prepare non-brewery yeast into seed suspension; S2: adjusting the sugar content of the composite fruit pulp to 20% to 24% to obtain a sugar-adjusted composite fruit pulp; S3: inoculating the seed bacterial suspension and brewer's yeast into the sugar-adjusted composite fruit pulp for fermentation to obtain berry wine.

[0017] In some embodiments, the concentration of the seed suspension in step S1 is 10 6 -10 9 CFU / mL.

[0018] In some embodiments, the inoculation amount of the seed bacteria suspension in step S3 is 3% to 5% of the weight of the sugar-adjusted composite fruit pulp.

[0019] In some embodiments, in step S3, the seed fungus suspension and brewer's yeast are inoculated into the sugar-adjusted composite fruit pulp and fermented at 25-30° C. for 20-25 days to obtain berry wine.

[0020] Compared with the existing technology, this technical solution has the following characteristics and beneficial effects: This solution uses a dual acid reduction pathway to achieve the effect of reducing the acidity of berry wine: One is to increase the initial pH value of the berry fermentation raw material to reduce the initial acidity. The present invention optimizes through a series of experimental studies to screen a scheme for reducing the initial acidity of the blueberry raw material by compounding pitaya. Pitaya and blueberry are both berries, both contain rich anthocyanins and sugars, and are suitable for fermenting fruit wine. The acidity of pitaya is lower than that of blueberry. Therefore, the initial pH value of the berry fermentation raw material can be increased by compounding in a certain proportion.

[0021] Secondly, in the initial stage of fermentation of berry wine, non-brewer's yeast with acid-reducing function is added, and the non-brewer's yeast and traditional brewer's yeast are inoculated into the composite fruit pulp for fermentation, thereby reducing the acidity of the berry wine through biological fermentation. The present invention selects a special microbial strain with the function of degrading organic acid from blueberry fruits grown locally in Hangzhou, Zhejiang Province: Hansenula vitis vinifera ( Hanseniaspora uvarum ), Pichia terrestrial ( Pichia terricola ), Pichia brunnei ( Pichia bruneiensis ) and Saturnella saitoensis ( Saturnispora diversa ), and inoculate this special microbial strain together with traditional brewing yeast into the fermentation process of blueberries for biological deacidification. It will not introduce foreign impurities that affect the quality of fruit wine brought by other deacidification processes, and can produce high-quality functional fruit wine with harmonious aroma, flavor and mouthfeel. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a schematic diagram of the colony of Hansenula vitis vinifera HZNK188 strain on YPD agar.

[0023] Figure 2 This is a schematic diagram of the Hansenula vitis vinifera HZNK188 bacteria under a microscope.

[0024] Figure 3 This is a schematic diagram of the colony of terrestrial Pichia pastoris strain HZNK662 on YPD agar.

[0025] Figure 4 This is a schematic diagram of the terrestrial Pichia pastoris HZNK662 under a microscope.

[0026] Figure 5 This is a schematic diagram of the colony of Pichia brunnei HZNK1268 strain on YPD agar.

[0027] Figure 6 This is a schematic diagram of the Hansenula vitis vinifera HZNK188 bacteria under a microscope.

[0028] Figure 73 is a color evaluation chart of the berry wine of the test group and the control group in Example 7.

[0029] Figure 8 This is the GC-IMS difference spectrum of the volatile components in the sample of Example 7.

[0030] Figure 9 This is the fingerprint of the volatile components in the sample of Example 7.

[0031] Figure 10 This is the PCA score diagram of the volatile components of the sample in Example 7.

[0032] Figure 11 3 is a color evaluation chart of the berry wine of the test group and the control group in Example 8.

[0033] Figure 12 This is the GC-IMS difference spectrum of the volatile components in the sample of Example 8.

[0034] Figure 13 This is the fingerprint of the volatile components in the sample of Example 8.

[0035] Figure 14 This is the PCA score diagram of the volatile components of the sample in Example 8. DETAILED DESCRIPTION

[0036] The application team designed the following embodiments: Example 1: Compounding blueberry puree and dragon fruit puree in different proportions The blueberries and pitaya fruits from the same batch were squeezed and crushed, and then compounded in different weight ratios to obtain corresponding composite pulps. The pH values ​​of the composite pulps were tested and the results are shown in Table 1 below: Table 1 pH value of compound pulp with different proportions

[0037] As shown in Table 1, the pH of pure blueberry pulp is 2.80, while that of pure pitaya pulp is 4.64. Blueberries are significantly more acidic than pitaya. The initial pH of the fermented pulp can be adjusted by adding a certain amount of pitaya. The pH of the composite pulp increases with increasing pitaya content. However, when the pitaya content exceeds 40%, the pulp begins to develop a grassy off-flavor. Considering the acidity and flavor of the composite pulp, combined with the flavor evaluation of the fermented wine, the optimal weight ratio of pitaya to blueberry pulp is 2:8 to 3:7.

[0038] Example 2 Grape juice Hansenula sporogenes ( Hanseniaspora uvarum ) Strain screening and identification 1. The grape juice spore-bearing Hansenula sporogenes obtained by the application team ( Hanseniaspora uvarum ) strain, which has been deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms, with the deposit number CGMCC No.28901.

[0039] 2. This strain was obtained by screening blueberries (Blue Beauty No. 1 variety) collected from the blueberry planting base of Degaole Family Farm in Baijiang Town, Hangzhou City, Zhejiang Province in June 2022. The screening method is as follows: (1) Separation After the blueberry fruit was crushed, it was added to a sterile 500 mL triangular flask and naturally fermented in a shaking incubator at 28°C for 7 days. 10 mL of sample was taken every day and diluted 10 times with sterile physiological saline. -2 , 10 -3 , 10 -4 , 10 -5 Four appropriate dilutions were plated onto Red Bengal isolation medium (RBA agar) to separate colonies. The plate was incubated at 28°C for 2-3 days to select colonies that exhibited typical yeast characteristics. The formulation of Red Bengal isolation medium (RBA) (g / L) is as follows: 5.0g peptone, 10.0g glucose, 1.0g potassium dihydrogen phosphate, 0.5g magnesium sulfate (anhydrous), 0.033g Red Bengal, 0.1g chloramphenicol, and 20.0g agar. To prepare Red Bengal agar (RBA agar), weigh 36.6g of the medium powder and dissolve it in 1L of distilled water. Heat and boil until completely dissolved. Autoclave at 121°C for 15 minutes, cool to approximately 50°C, and set aside.

[0040] (2) Purification Isolate and purify a representative colony by streaking it onto yeast extract peptone dextrose medium (YPD agar) and incubating it at 28°C for 2 days. For secondary purification, pick a representative colony from the YPD agar, streak it onto YPD agar again, and incubate it at 28°C for 2 days. Repeat this method five times to obtain a purified strain. Yeast extract peptone dextrose medium (YPD agar) recipe (g / L): 10.0g peptone, 20.0g glucose, 14.0g yeast extract powder, and 14.0g agar. Preparation: Weigh 50.0g into 1L of distilled water, boil until completely dissolved, autoclave at 121°C for 20 minutes, cool to approximately 50°C, and set aside.

[0041] (3) Acid reduction performance screening Different colonies were selected from the above purified strains and inoculated into YPD liquid culture medium containing citric acid at a mass concentration of 12 g / L. The culture was carried out in a shaking incubator at 28°C and 150 r / min for 72 h. The total organic acid content was determined every 24 h using the acid-base titration method according to GB12456-2021. The average value was taken after three repetitions. The strains with acid-reducing effects were screened by the acid-reduction rate, and a non-Saccharomyces cerevisiae strain with good acid-reducing effects was obtained and named HZNK188.

[0042] Table 2 shows the strain's ability to reduce citric acid during 72 hours of fermentation in YPD citric acid liquid medium. YPD liquid medium formula (g / L): 20.0g peptone, 20.0g glucose, 10.0g yeast extract powder. Preparation: Weigh 50.0g of the strain into 1L of distilled water, boil until completely dissolved, and autoclave at 121°C for 20 minutes before use.

[0043] Table 2 The acid-reducing effect of HZNK188 strain fermentation on citric acid

[0044] Table 2 shows that the HZNK188 strain reduced citric acid content during fermentation: after 24 hours of fermentation, the reduction rate was 28.82%; after 48 hours of fermentation, the reduction rate was 86.02%; and after 72 hours of fermentation, the reduction rate was 90.86%. Therefore, this strain can effectively reduce the organic acid content in raw materials within 72 hours.

[0045] 3. Identification of HZNK188 strain (1) Morphological identification of HZNK188 strain The HZNK188 strain was cultured on YPD agar at 28°C for 72 h, and the colonies formed by reproduction and growth were as follows: Figure 1 As shown by Figure 1 The colonies are round, milky white, smooth in surface and with flat edges. Figure 2 As shown by Figure 2 It can be seen that the bacteria are spherical or ellipsoidal in shape, with a body size of (1.5-3.0)×(3.5-4.5)μm.

[0046] (2) Identification of the main physiological and biochemical reactions of HZNK181 strain The physiological and biochemical reactions of the HZNK188 strain were identified using the VITEK 2 Compact fully automatic microbial analysis system from BioMérieux. The results are shown in Table 3.

[0047] Table 3 Physiological and biochemical reaction identification results of HZNK181 strain

[0048] (3) Analytical biological identification DNA of the HZNK188 strain was extracted, primers were designed for PCR amplification of the ITS rRNA gene, and amplification and sequencing were performed to obtain the sequence of the HZNK188 strain as shown in SEQ ID NO.1. The specific sequence is as follows:

[0049] The above sequence was compared with the known sequences in GenBank to determine the fungal species and classify it into genus or species. The strain HZNK188 was identified as Hansenula vitis spores ( Hanseniaspora uvarum ).

[0050] (4) Hansenula viticola ( Hanseniaspora uvarum) HZNK181 strain preservation Hansenula viticola ( Hanseniaspora uvarum ) Inoculate the HZNK181 strain onto the slant of a YPD agar tube, culture at 28°C for 48-72 hours, add glycerol, and store at -80°C or freeze-dry under vacuum.

[0051] Example 3 Terrestrial Pichia yeast ( Pichia terricola ) Screening and identification of bacterial strains 1. A strain of Pichia terrestrial yeast ( Pichia terricola ) HZNK662, which has been deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms with the deposit number CGMCC No.28903.

[0052] 2. This strain was obtained by screening blueberries (Lexie variety) collected from the blueberry planting base of Gaofeng Blueberry Planting Co., Ltd. in Hangzhou, Zhejiang Province in June 2022. The screening method is as follows: (1) Separation: the method and steps are the same as those in Example 2.

[0053] (2) Purification: the method and steps are the same as those in Example 2.

[0054] (3) Acid reduction performance screening Different colonies were selected from the purified strains described above. Following the method of Example 2, a non-Saccharomyces cerevisiae strain with excellent acid-reduction properties was obtained, named HZNK662. The acid-reduction properties of this strain during 72 hours of fermentation in YPD citric acid liquid medium are shown in Table 4.

[0055] Table 4 HZNK662 strain fermentation process on the acid-reducing effect of citric acid

[0056] Table 4 shows that the HZNK662 strain's citric acid reduction effect during fermentation was as follows: after 24 hours of fermentation, the acid reduction rate was 19.57%; after 48 hours of fermentation, the acid reduction rate was 52.15%; and after 72 hours of fermentation, the acid reduction rate was 88.17%. Therefore, after 24 hours of fermentation, the HZNK662 strain's acid reduction effect was not ideal, and fermentation for 48-72 hours was required to effectively reduce the organic acid content in the raw material.

[0057] 3. Identification of HZNK662 strain (1) Morphological identification of HZNK662 strain The HZNK662 strain was cultured on YPD agar at 28°C for 72 h, and the colonies formed by the growth were as follows: Figure 3 As shown by Figure 3 The colonies are round, milky white, smooth in surface and with flat edges. The results of microscopic examination are as follows: Figure 4 As shown by Figure 3 It can be seen that the main shape is ellipsoidal, with a small amount of spherical, and the size of the bacteria is (1.5-3.0)×(4.0-4.5)μm.

[0058] (2) Identification of the main physiological and biochemical reactions of HZNK662 strain The HZNK662 strain was identified for physiological and biochemical reactions using BioMérieux's VITEK 2 Compact fully automated microbial analysis system. The identification results are shown in Table 5. Table 5 Identification results of physiological and biochemical reactions of HZNK662 strain

[0059] (3) Molecular biological identification DNA of the HZNK662 strain was extracted, primers were designed for PCR amplification of the ITS rRNA gene, and the amplification and sequencing were performed to obtain the sequence shown in SEQ ID NO. 2, which is as follows: GGCCATTAAAAGTGGCTAATCACACTGCGTGCGCGTAACAAACCCCTAAACATGAATAACCTAGTCAAGAATCCATAAGAATAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGCATGCCTGTTTGAGCGTCGTTTCTATCTCACGCAAGTGGAGCTGGCCCGGCCTTGGCCCCGCCGAAAAGAAACGAGGGCGAAGCGAACTATGTTGTGCGCCGACCCCAGCTATCAAGCTCGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAGAGGAGGAACA After comparing the above sequence with known sequences in GenBank, the fungal species was determined and classified into genus or species. The strain HZNK662 was identified as terrestrial Pichia pastoris ( Pichia terricola ).

[0060] Example 4 Pichia brunnei ( Pichia bruneiensis ) Screening and identification of bacterial strains 1. A strain of Pichia brunnei ( Pichia bruneiensis)HZNK1268, which has been deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms with the deposit number CGMCC No.28904.

[0061] 2. This strain was obtained by screening blueberries (O'Neill variety) collected from the blueberry planting base of Degaole Family Farm in Baijiang Town, Hangzhou City, Zhejiang Province in June 2022. The screening method is: (1) Separation: the method and steps are the same as those in Example 2.

[0062] (2) Purification: the method and steps are the same as those in Example 2.

[0063] (3) Acid reduction performance screening Different colonies were selected from the purified strains and screened for acid reduction using the method described in Example 2. A non-Saccharomyces strain with excellent acid-reduction properties was obtained and named HZNK1268. The acid-reduction properties of this strain during 72 hours of fermentation in YPD citric acid liquid medium are shown in Table 6.

[0064] Table 6 HZNK1268 strain fermentation process on the acid-reducing effect of citric acid

[0065] Table 6 shows that the HZNK1268 strain's acid-reducing effect on citric acid during fermentation was as follows: after 24 hours of fermentation, the acid-reduction rate was 12.99%; after 48 hours of fermentation, the acid-reduction rate was 56.53%; and after 72 hours of fermentation, the acid-reduction rate was 90.61%. Therefore, the acid-reducing properties of the HZNK1268 strain are similar to those of HZNK662, requiring 72 hours of fermentation to effectively reduce the organic acid content in the raw material.

[0066] 3. Identification of HZNK1268 strain (1) Morphological identification of HZNK662 strain The HZNK662 strain was cultured on YPD agar at 28°C for 72 h, and the colonies formed by the growth were as follows: Figure 5 As shown by Figure 5 The colonies are round, milky white, smooth in surface and with flat edges. Figure 6 As shown by Figure 6 It can be seen that the shape is spherical or ellipsoidal, with the ellipsoidal shape being the most common. The size of the bacteria is (2.0-3.0)×(3.0-4.0)μm.

[0067] (2) Identification of the main physiological and biochemical reactions of HZNK1268 strain The physiological and biochemical reactions of the HZNK1268 strain were identified using the VITEK 2 Compact fully automatic microbial analysis system from BioMérieux. The results are shown in Table 7.

[0068] Table 7 Identification results of physiological and biochemical reactions of HZNK1268 strain

[0069] (3) Molecular biological identification DNA of the HZNK1268 strain was extracted, and primers were designed for PCR amplification of the ITS rRNA gene. The amplified sequence was obtained as shown in SEQ ID NO. 3. The specific sequence is: GGGCCGTCAGAGCTAAGATTCTCACACTGCGTGGGCGAAGCGAAACACCGAAACTGGCAGCGCGGCCGTCAAACACAAAAAATCCACAAAACTTTCAACAACGGATCTCTGGGTTCTCGCATCGATAAAAAGCGCAGCGAAAGGCAATACCTAGGGGGAATTGCACCCATCGGGAATCATCAAGTTCTTGAACGCACATGGCGCCCGCCGG CTTTCCGGGGGGCATGCCTGTCTGAGCGTCGTTTCCTTCTTGGGGCGAAGCTTCAAACCTGGGCGGGAAGGCGGGTTTTCCCCGGTTCAAAGCAAGGGCCGGCCTGCCCAAACTATGGGGGGCCCCCGGGCGGGCAGCAAACTTTACCGAGCTCGACCTCAGATCAGGCAGGAGTACCCGCTGAACTTAAGCATATCAATAACCGGAGGAAA After comparing the above sequence with known sequences in GenBank, the fungal species was determined and classified into genus or species. The strain HZNK1268 was identified as Pichia brunnensis ( Pichia bruneiensis ).

[0070] Example 5 Saito Saturn yeast ( Saturnispora diversa ) Screening and identification of bacterial strains 1. Saturn yeast of Saito Saturnispora diversa ) strain, which was deposited in the General Microbiology Center of China Culture Collection Administration on November 8, 2023. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 28902.

[0071] 2. According to the method of Example 2, HZNK494 was screened from blueberries (rabbit eye variety) collected from the blueberry planting base of Gaofeng Blueberry Planting Co., Ltd. in Hangzhou, Zhejiang Province in June 2022, and was identified as Saturnella saccharomyces cerevisiae.

[0072] Example 6 Effects of Fermentation with Four Acid-Reducing Non-Saccharomyces Yeasts on the Acidity of Different Blueberry Composite Purees Hansenula vitis vinifera ( Hanseniaspora uvarum ), Pichia terrestrial ( Pichia terricola ), Pichia brunnei ( Pichia bruneiensis ) and Saturnella saitoensis ( Saturnispora diversa ) The test results of the acid-reducing effects of the four non-brewery yeasts on the two groups of composite fruit pulps are shown in Tables 8 and 9, wherein the weight ratio of pitaya pulp to blueberry pulp in the composite fruit pulp corresponding to Table 8 is 2:8, and the weight ratio of pitaya pulp to blueberry pulp in the composite fruit pulp corresponding to Table 9 is 3:7.

[0073] Table 8 Results of the acid-reducing effect of different non-brewery yeasts on composite fruit pulp (dragon fruit and blueberry weight ratio 2:8) (total acid unit: g / L)

[0074] Table 9 Results of the acid-reducing effect of different non-brewery yeasts on composite fruit pulp (dragon fruit and blueberry weight ratio 3:7) (total acid unit: g / L)

[0075] Tables 8 and 9 show that Hansenula sporangiophora, Pichia terrestris, Pichia brunei, and Saturnus saccharomyces ... The pitaya pulp ratio was increased from 2:8 to 3:7, and the initial acidity of the composite pulp has dropped significantly. When compared with the natural fermentation blank control without added bacteria, the acidity reduction rate data was reduced, but the overall acid reduction performance did not decrease significantly.

[0076] Example 7 1. Fermentation process The berry wine of this embodiment is prepared by an acid reduction fermentation process comprising the following steps: (1) First, streak the non-brewery yeast on YPD agar and incubate at 28℃ for 48h for activation; after activation, inoculate it into YPD liquid medium and incubate at 28℃ for 48h to prepare a seed suspension, where the concentration of the seed suspension is 106 -10 9 CFU / mL seed bacterial suspension; (2) crushing the blueberry fruit and the pitaya fruit raw materials respectively to obtain blueberry pulp and pitaya pulp; (3) preparing a blueberry composite pulp by mixing pitaya pulp and blueberry pulp in a weight ratio of 3:7, and adjusting the sugar content to 22% to obtain a sugar-adjusted blueberry composite pulp; (4) The seed bacterial suspension and traditional brewing yeast were inoculated into the sugar-adjusted blueberry compound pulp. The inoculation amount of the seed bacterial suspension was 3% to 5% of the weight of the sugar-adjusted blueberry compound pulp. The traditional brewing yeast was a special yeast for wine and fruit wine (produced by Angel Yeast Co., Ltd.), and was added according to the inoculation amount in the product instructions.

[0077] (5) Fermentation was carried out at 25-30°C for 25 days to obtain the blueberry wine (BP2 group) of this example.

[0078] 2. Fruit wine quality analysis Using a single strain of traditional Saccharomyces cerevisiae (produced by Angel Yeast Co., Ltd.), a berry wine was prepared using the same fermentation process as described above, serving as a control (BP1 group). The properties of the two berry wines were then tested and analyzed. Specifically, the fermentation performance of different fermentation strains was compared on the same complex fruit puree to evaluate the beneficial effects of adding acid-reducing non-Saccharomyces yeast.

[0079] (1) Acidity of fruit wine The acidity of the fruit wine fermented with the acid-reducing non-Saccharomyces yeast strain (experimental group BP2) was 3.59 g / L, while the acidity of the fruit wine control group (BP1) fermented without the acid-reducing non-Saccharomyces yeast strain was 4.80 g / L. This indicates that the acidity of the fruit wine produced with the acid-reducing non-Saccharomyces yeast strain decreased significantly (p < 0.05), with a decrease rate of 25.21%.

[0080] (2) Alcohol content of fruit wine The alcohol content of the fruit wine produced by fermenting with the acid-reducing non-Saccharomyces yeast strain (BP2 group) was 11.5%, while the alcohol content of the fruit wine produced by fermenting without the acid-reducing non-Saccharomyces yeast strain (BP1 group) was 11.7%, with no significant difference between the two (p>0.05). This shows that the use of acid-reducing non-Saccharomyces yeast in producing fruit wine does not affect the final alcohol content of the fruit wine product.

[0081] (3) Color quality test of fruit wine The color quality test results of fruit wine are as follows Figure 7 As shown, Figure 7 BP1 is the control group, BP2 is the experimental group, and different lowercase letters in the figure indicate significant differences between the two groups ( p<0.05), the same lowercase letters indicate no significant difference between the two groups ( p >0.05). Figure 10 It can be seen that compared with the fruit wine in the control group (BP1), the L value, a value and b value of the fruit wine in the experimental group (BP2) had no significant difference (p>0.05), indicating that adding acid-reducing non-brewery yeast strains to the composite fruit pulp fermentation to prepare fruit wine will not affect the color quality of the dry red characteristic of the fruit wine product.

[0082] (4) Evaluation of volatile flavor substances 1) Sample collection: Gas phase ion mobility spectrometry (GC-IMS) was used to compare and analyze the differences in volatile flavor compounds between the experimental group (BP2) and the control group (BP1) fruit wine. To facilitate analysis, the two groups of samples were first numbered. The sample information table is shown in Table 10: Table 10 Sample information table of Example 7

[0083] 2) Comparative analysis of volatile component spectra After obtaining the spectra of each sample, the spectrum of the blueberry composite pulp sample BP0-S before fermentation was used as a reference, and the spectra of other samples were deducted from the reference to obtain the difference comparison diagram of different samples as shown in the figure below. Figure 8 If the volatile organic compound content in the target sample and the reference is the same, the subtracted background is white, red represents that the concentration of the substance in the target sample is higher than that in the reference, and blue represents that the concentration of the substance in the target sample is lower than that in the reference. Figure 8 It can be seen intuitively that the volatile organic compounds in the berry wine increase significantly after fermentation.

[0084] 3) Fingerprint analysis of volatile organic compounds In order to further compare the types and contents of volatile organic compounds in each sample, fingerprint analysis was carried out. The analysis results are as follows: Figure 9 As shown, Figure 9From left to right: 2-ethyl-1-hexanol, (Z)-3-hexenol, 1-hexanol, 1-penten-3-ol, 1-pentanol, 1-butanol, 2-propanol, 2-heptanone, 2-pentanone, 2-butanone, acetone, methyl 2-methylbutyrate, methyl 3-methylbutyrate, cis-3-hexenyl acetate, isopropyl butyrate, amyl acetate, hexanal, acetal, 2-methylpropanal, acetaldehyde, benzene, pinene, dimethyl sulfide, acetoin, 4-methyl-2-pentanone, nonanal, Heptanal, 3-methylbutanal, propionaldehyde, 2-propenal, linalool oxide, 2-methyl-1-propanol, 1-propanol, ethanol, methanol, ethyl octanoate, ethyl hexanoate, hexyl acetate, methyl hexanoate, methyl butyrate, isobutyl acetate, butyric acid, acetic acid, linalool, 1-heptanol, cis-2-penten-1-ol, butyl hexanoate, isobutyl isobutyrate, ethyl isobutyrate, propyl acetate, ethyl lactate, phenylacetaldehyde, (E)-2-pentenal, 3-methyl-1-butanol, ethyl 3-methylbutyrate, ethyl 2-methylbutyrate, isoamyl acetate, ethyl butyrate, ethyl acetate, methyl acetate, 2-methyl-3-heptanone.

[0085] Depend on Figure 9 It can be seen that ① BPO-S contains relatively high contents of substances such as 2-ethyl-1-hexanol, 2-3-hexenol, 1-hexanol, 1-penten-3-ol, 1-pentanol, 1-butanol, 2-propanol, 2-heptanone, 3-heptanone, 2-pentanone, 2-butanone, acetone, methyl 2-methylbutyrate, methyl 3-methylbutyrate, leaf acetate, isopropyl butyrate, amyl acetate, hexanal, acetal, 2-methylpropanal, acetaldehyde, benzene, β-pinene, and dimethyl sulfide.

[0086] ② BP1-M contained higher levels of acetoin, 4-methyl-2-pentanone, nonanal, heptanal, 3-methylbutanal, propionaldehyde, 2-propenal, linalool oxide, 2-methyl-1-propanol, 1-propanol, ethanol, methanol, ethyl octanoate, ethyl hexanoate, hexyl acetate, methyl hexanoate, methyl butyrate, and isoamyl acetate. BP2-M ​​contained higher levels of ethyl propionate. This indicates that after 48 hours of fermentation, volatile flavor compounds such as esters increased significantly. The BP2-M ​​group, supplemented with acid-reducing non-Saccharomyces yeast, had lower methanol content and higher ester content than the BP1-M group.

[0087] ③ BP1-E showed higher levels of butyric acid, acetic acid, linalool, 1-heptanol, Z-2-penten-1-ol, butyl hexanoate, isobutyl isobutyrate, ethyl isobutyrate, propyl acetate, ethyl lactate, phenylacetaldehyde, E-2-heptenal, and 3-methyl-2-butenal; BP2-E showed higher levels of cyclopentanone, E-2-hexenal, 3-methyl-1-butanol, ethyl 3-methylbutyrate, ethyl 2-methylbutyrate, isobutyl acetate, ethyl butyrate, ethyl acetate, and methyl acetate. These results suggest that, compared with BP1-E, the volatile esters in the fruit wines supplemented with acid-reducing non-Saccharomyces yeast significantly increased after fermentation in BP2-E, while volatile organic acids such as butyric acid and acetic acid decreased significantly.

[0088] 4) Cluster analysis In order to further compare the types of volatile organic compounds in each sample, a cluster analysis of volatile organic compounds was conducted. The analysis results are as follows: Figure 10 As shown. Figure 10 It can be seen that after 48 hours of fermentation, the total amount of volatile organic compounds in the fruit wine fermented with the acid-reducing non-Saccharomyces yeast strain (BP2-M) was lower than that in the fruit wine fermented without the acid-reducing non-Saccharomyces yeast strain (BP1-M), indicating that the acid-reducing non-Saccharomyces yeast can degrade a lot of acid substances in the first 48 hours of fermentation; after the fermentation, there was no significant difference in the total amount of volatile organic compounds between the fruit wine fermented with the acid-reducing non-Saccharomyces yeast strain (BP2-E) and the fruit wine fermented without the acid-reducing non-Saccharomyces yeast strain (BP1-E).

[0089] Therefore, when the composite fruit pulp fermented with acid-reducing non-brewery yeast strains is used to prepare berry wine, it will not have a negative impact on the total content of volatile organic matter and can produce beneficial effects: it can significantly increase the content of volatile esters and significantly reduce the content of volatile organic acids such as butyric acid and acetic acid.

[0090] Example 8 1. Fermentation process The berry wine in this embodiment is prepared by an acid reduction fermentation process comprising the following steps: (1) First, streak the non-brewery yeast on YPD agar and incubate at 28℃ for 48h for activation; after activation, inoculate it into YPD liquid medium and incubate at 28℃ for 48h to prepare a seed suspension, where the concentration of the seed suspension is 10 6 -10 9 CFU / mL seed bacterial suspension; (2) crushing the blueberry raw material to obtain blueberry pulp; (3) Adjusting the sugar content of the blueberry pulp to 22% to obtain sugar-adjusted blueberry pulp; (4) The seed bacterial suspension is inoculated into the sugar-adjusted blueberry pulp together with traditional brewing yeast. The inoculation amount of the seed bacterial suspension is 3%-5% of the weight of the sugar-adjusted blueberry composite pulp.

[0091] (5) Fermentation was carried out at 25-30°C for 25 days to obtain the blueberry wine (Group B2) of this embodiment.

[0092] 2. Fruit wine quality analysis The blueberry wine of this example served as a control group (Group B2) for comparative evaluation against the berry wine (Test Group BP2) derived from the composite fruit puree in Example 7, supplemented with acid-reducing non-Saccharomyces yeast and specialized yeast for wine. Specifically, the same strains (with acid-reducing non-Saccharomyces yeast and specialized yeast for wine) were used to ferment different purees (blueberry and pitaya composite puree and blueberry puree) to evaluate the beneficial effects of the pitaya blend.

[0093] (1) Acidity of fruit wine The acidity of the berry wine (BP2 group) prepared by fermenting the blueberry and pitaya compound pulp with acid-reducing non-Saccharomyces cerevisiae and wine-specific yeast was 3.59 g / L, while the acidity of the fruit wine (B2 group) prepared by fermenting the blueberry puree with acid-reducing non-Saccharomyces cerevisiae and wine-specific yeast was 4.91 g / L. It can be seen that the acidity of the berry wine produced by the compound pulp of pitaya can be significantly reduced ( p <0.05), the decline rate was 26.88%.

[0094] (2) Alcohol content of fruit wine The alcohol content of the berry wine (BP2 group) prepared by fermenting blueberry pitaya compound pulp with acid-reducing non-brewery yeast and wine-specific yeast was 11.5 degrees, and the alcohol content of the fruit wine (B2 group) prepared by fermenting blueberry single pulp with acid-reducing non-brewery yeast and wine-specific yeast was 11.8 degrees. There was no significant difference between the two ( p >0.05). It can be seen that under the same fermentation conditions, the berry wine prepared by fermenting the composite dragon fruit pulp with the addition of acid-reducing non-brewery yeast + wine-specific yeast will not significantly affect the final alcohol content of the fruit wine product.

[0095] (3) Color quality test of fruit wine The color quality test of fruit wine is shown in the figure below: Figure 11 As shown, Figure 11 B2 is the control group: blueberry puree, fermented with acid-reducing non-Saccharomyces cerevisiae and wine-specific yeast as fermentation strains to prepare blueberry wine; BP2 is the experimental group: blueberry and pitaya complex puree, fermented with acid-reducing non-Saccharomyces cerevisiae and wine-specific yeast as fermentation strains to prepare berry wine. Different lowercase letters in the figure indicate significant differences between the two groups (p <0.05), the same lowercase letters indicate no significant difference between the two groups ( p >0.05).

[0096] Depend on Figure 11 It can be seen that compared with the control group (B2 group) fruit wine, the b value of the experimental group (BP2 group) fruit wine had no significant difference ( p >0.05); the L value of the experimental group (BP2 group) was significantly greater than that of the control group (B2 group) ( p＜ 0.05), the a value of the experimental group (BP2 group) was significantly lower than that of the control group (B2 group) ( p＜ 0.05), indicating that the addition of pitaya has a certain negative impact on the red color and brightness of the fermented dry red wine. This shows that although a high proportion of pitaya is more beneficial to reducing acidity, the proportion of pitaya cannot be too high, otherwise it will affect the color quality of the dry red wine product.

[0097] (4) Evaluation of volatile flavor substances 1) Sample collection Gas phase ion mobility spectrometry (GC-IMS) was used to compare and analyze the differences in volatile flavor substances between the experimental group fruit wine and the control group fruit wine. In order to facilitate the analysis, the two groups of sample information were first numbered. The sample information table is shown in Table 11.

[0098] Table 11 Sample information table of Example 8

[0099] 2) Comparative analysis of volatile component spectra After obtaining the spectra of each sample, the spectrum of the blueberry pulp sample B0-S before fermentation was used as a reference, and the spectra of other samples were subtracted from the reference to obtain the difference comparison diagram of different samples as shown in the figure below. Figure 12 If the volatile organic compound content in the target sample and the reference is the same, the subtracted background is white, red represents that the concentration of the substance in the target sample is higher than that in the reference, and blue represents that the concentration of the substance in the target sample is lower than that in the reference. Figure 12 It can be seen intuitively that after fermentation, the volatile organic compounds in the blueberry wine with added dragon fruit increased significantly.

[0100] 3) Fingerprint analysis of volatile organic compounds In order to further compare the types and contents of volatile organic compounds in each sample, fingerprint analysis was carried out. The analysis results are as follows: Figure 13 As shown, Figure 13From left to right: 2-ethyl-1-hexanol, (Z)-3-hexenol, 1-hexanol, 1-penten-3-ol, 1-pentanol, 1-butanol, 2-propanol, nonanal, heptaldehyde, hexanal, propionaldehyde, acetaldehyde, acetal, (E) -2-pentenal, 2-heptanone, 3-heptanone, 2-pentanone, 2-butanone, acetone, cis-3-hexenyl acetate, amyl acetate, isopropyl butyrate, methyl butyrate, pinene, benzene, allyl sulfide, dimethyl sulfide, 1-propanol, ethyl propionate, methyl 2-methylbutyrate, methyl hexanoate, butyric acid, linalool, 3-methyl-1-butanol, 2-methyl-1-propanol, ethanol, methanol, ethyl octanoate, ethyl hexanoate, ethyl isobutyrate, ethyl 2-methylbutyrate, ethyl 3-methylbutyrate, isoamyl acetate, isobutyl acetate, ethyl butyrate, methyl 3-methylbutyrate, methyl acetate, hexyl acetate, phenylacetaldehyde, 3-methyl-2-butenal, 2-propanol, cyclopentanone, 2-methylpropanal, acetic acid, acetoin, 3-methylbutanal, linalool oxide, (E) -2-hexenal, (E)-2-hexenal, 1-heptanol, cis-2-penten-1-ol, butyl hexanoate, ethyl acetate, propyl acetate, isobutyl isobutyrate, ethyl lactate, 4-methyl-2-pentanone, 2-methyl-3-heptanone.

[0101] Depend on Figure 13 It can be seen that ① BO-S contains relatively high levels of substances such as 2-ethyl-1-hexanol, Z-3-hexenol, 1-hexanol, 1-penten-3-ol, 1-pentanol, 1-butanol, 2-propanol, nonanal, heptaldehyde, hexanal, propionaldehyde, acetaldehyde, acetal, E-2-pentenal, 2-heptanone, 3-heptanone, 2-pentanone, 2-butanone, acetone, leaf acetate, amyl acetate, isopropyl butyrate, methyl butyrate, β-pinene, benzene, allyl propyl sulfide, and dimethyl sulfide; BO-S also contains relatively high levels of substances such as 2-methylpropanal. This indicates that pitaya contains a relatively high level of 2-methylpropanal.

[0102] ② The contents of 1-propanol, ethyl propionate, methyl 2-methylbutyrate, methyl hexanoate and other substances in B2-M are relatively high; the contents of acetic acid, acetoin, 3-methylbutyraldehyde and other substances in BP2-M ​​are relatively high. It can be seen that the acetic acid content of the composite fruit pulp compounded with pitaya is relatively high in the early stage of fermentation. If the fermentation time is insufficient, it will be detrimental to acid reduction.

[0103] ③ B2-E contains high levels of butyric acid, linalool, 3-methyl-1-butanol, 2-methyl-1-propanol, ethanol, methanol, ethyl octanoate, ethyl hexanoate, ethyl isobutyrate, ethyl 2-methylbutyrate, ethyl 3-methylbutyrate, isoamyl acetate, isobutyl acetate, ethyl butyrate, methyl 3-methylbutyrate, methyl acetate, hexyl acetate, phenylacetaldehyde, 3-methyl-2-butenal, 2-propenal, and cyclopentanone; BP2-E contains high levels of linalool oxide, E-2-heptenal, E-2-hexenal, 1-heptanol, Z-2-penten-1-ol, butyl hexanoate, ethyl acetate, propyl acetate, isobutyl isobutyrate, ethyl lactate, and 4-methyl-2-pentanone. This shows that after the fermentation of the composite pulp compounded with pitaya, the content of organic acids such as butyric acid is significantly reduced, and the content of ester substances is significantly increased.

[0104] 4) Cluster analysis In order to further compare the types of volatile organic compounds in each sample, a cluster analysis of volatile organic compounds was conducted. The results are as follows: Figure 14 As shown. Figure 14 As can be seen, after 48 hours of fermentation, there was no significant difference in the total amount of volatile organic compounds between the fruit wine containing pitaya (BP2-M) and the fruit wine without pitaya (B2-M). After fermentation, there was also no significant difference in the total amount of volatile organic compounds between the berry wine containing pitaya (BP2-E) and the fruit wine without pitaya (B2-E group). However, in general, if too much pitaya is added, it will have a negative effect on the flavor of the fruit wine. Therefore, the pitaya ratio should be controlled within 3:7 to effectively ensure that the flavor quality of the product is not compromised.

[0105] Therefore, when blueberries are combined with pitaya to ferment fruit wine, it will not have a negative impact on the total content of volatile organic compounds, but can actually produce beneficial effects: it can significantly reduce the content of volatile organic acids such as butyric acid and increase the content of volatile esters. However, in general, if too much pitaya is added, it will have a negative effect on the flavor of the wine. Therefore, the ratio of pitaya to blueberries should be controlled within 3:7 to effectively ensure that the flavor quality of the product is not reduced.

[0106] Those skilled in the art should understand that the technical features of the above embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0107] The above embodiments merely illustrate several embodiments of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present application. It should be noted that a person of ordinary skill in the art may make various modifications and improvements without departing from the spirit of the present application, all of which fall within the scope of protection of the present application. Therefore, the scope of protection of the present application shall be determined by the appended claims.

Claims

1. A method for reducing the acidity of berry wine, characterized in that: The following steps are involved: A composite fruit pulp is prepared by compounding blueberry pulp and pitaya pulp in a set ratio; non-brewers' yeast and brewer's yeast are inoculated into the composite fruit pulp together for fruit wine fermentation to obtain berry wine, wherein the non-brewers' yeast is a special microbial strain with the function of reducing organic acids that is screened from blueberry fruit raw materials.

2. The method for reducing acidity of berry wine according to claim 1, characterized in that: The weight ratio of pitaya pulp to blueberry pulp is 2:8~3:

7.

3. The method for reducing acidity of berry wine according to claim 1, characterized in that: The non-brewery yeast is selected from one or any combination of Hansenula vitis spores, Pichia terrestris, Pichia brunnei and Saturnella saito.

4. The method for reducing acidity of berry wine according to claim 3, characterized in that: The strain preservation number of Hansenula viticola is CGMCC No. 28901. It was deposited in the General Microbiology Center of China Culture Collection Administration on November 8, 2023. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

5. The method for reducing acidity of berry wine according to claim 3, characterized in that: The deposit number of the strain of Pichia terrestrialis is CGMCC No. 28903. It was deposited in the General Microbiology Center of the China Culture Collection Administration on November 8, 2023. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

6. The method for reducing the acidity of berry wine according to claim 3, characterized in that: The deposit number of the Pichia brunnensis strain is CGMCC No. 28904. It was deposited in the General Microbiology Center of the China Culture Collection Administration on November 8, 2023. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

7. The method for reducing the acidity of berry wine according to claim 3, characterized in that: The deposit number of the strain of Saturn yeast fungus is CGMCC No. 28902. It was deposited in the General Microbiology Center of China Culture Collection Administration on November 8, 2023. The deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

8. The method for reducing the acidity of berry wine according to claim 1, characterized in that: Process for inoculating non-brewer's yeast and brewer's yeast into composite fruit pulp for fruit wine fermentation The following steps are involved: S1: non-brewer's yeast is prepared into a seed bacterial suspension; S2: the sugar content of the composite fruit pulp is adjusted to 20%-24% to obtain a sugar-adjusted composite fruit pulp; S3: the seed bacterial suspension and brewer's yeast are inoculated into the sugar-adjusted composite fruit pulp for fermentation to obtain berry wine.

9. The method for reducing acidity of berry wine according to claim 8, characterized in that: The concentration of the seed suspension in step S1 is 10 6 -10 9 CFU / mL, the inoculation amount of the seed bacterial suspension in step S3 is 3% to 5% of the weight of the sugar-adjusted composite fruit pulp.

10. The method for reducing the acidity of berry wine according to claim 8, characterized in that: In step S3, the seed fungus suspension and brewer's yeast are inoculated into the sugar-adjusted composite fruit pulp and fermented at 25-30° C. for 20-25 days to obtain berry wine.

Images