Method for preventing and controlling brown planthopper by dsRNA (double-stranded ribonucleic acid) and application

Abstract

The invention relates to the technical field of agricultural insect and pest control and bioinformatics, in particular to a method for controlling brown planthopper by dsRNA and application. According to the application disclosed by the invention, a brown planthopper lethal gene segment Nlug010626.1 (SEQ ID NO.1) is screened, brown planthopper injection is carried out by utilizing dsRNA (SEQ ID NO.4) of the gene segment, the brown planthopper can be effectively killed by interfering the brown planthopper lethal gene segment Nlug010626.1, and the application has environmental ecological safety and food safety and provides a new way for establishing a biological control method of the brown planthopper.

Description

Technical Field

[0001] The present invention relates to the technical field of agricultural pest control, and in particular to a method and application of controlling brown planthoppers using dsRNA. Background Art

[0002] Brown planthoppers (Nilaparvata lugens) are a common rice pest. For a long time, chemical pesticides have been the primary means of controlling them. However, with the overuse of chemical pesticides, problems such as pesticide resistance, environmental pollution, and damage to non-target organisms have become increasingly prominent, seriously impacting the sustainability of the agricultural ecological environment. Therefore, the search for more efficient, safe, and environmentally friendly pest control technologies has become a focus of current agricultural research. As an emerging molecular biology tool, RNA interference (RNAi) technology has shown significant potential in agricultural pest control due to its high specificity, low toxicity, and broad application prospects. RNAi targets and degrades the mRNA of pest genes through specific short double-stranded RNA (dsRNA), thereby inhibiting the expression of specific genes, thereby interfering with the physiological functions of the pest and achieving the purpose of pest control. Compared with traditional chemical control methods, RNAi is highly targeted and can reduce negative impacts on the environment and non-target organisms.

[0003] It is of great significance to develop targeted and sustainable RNA interference technology for brown planthoppers. In view of this, the present invention is proposed. Summary of the Invention

[0004] In order to solve the above technical problems, the present invention provides a method and application of controlling brown planthopper using dsRNA.

[0005] Specifically, the technical solutions provided by the present invention are as follows:

[0006] In a first aspect, the present invention provides a method for controlling brown planthoppers, which kills brown planthoppers by interfering with a brown planthopper lethal gene fragment, wherein the brown planthopper lethal gene fragment is Nlug010626.1, and its nucleotide sequence is shown in SEQ ID NO.1.

[0007] Preferably, the present invention utilizes dsRNA to interfere with the lethal gene fragment of brown planthopper.

[0008] Preferably, the nucleotide sequence of the dsRNA of the present invention is shown as SEQ ID NO.4.

[0009] Preferably, the dsRNA of the present invention is administered by microinjection.

[0010] Preferably, the concentration of the microinjected dsRNA of the present invention is 150-350 μg / mL.

[0011] In a second aspect, the present invention provides a biological material containing the dsRNA as described in SEQ ID NO. 4 or a gene encoding the dsRNA.

[0012] Preferably, the biological material of the present invention is a nucleic acid sequence, a recombinant vector or a host cell.

[0013] In a third aspect, the present invention provides the use of the biological material in controlling brown planthoppers.

[0014] In a fourth aspect, the present invention provides use of the biological material in preparing a product for controlling brown planthoppers.

[0015] In a fifth aspect, the present invention provides a preparation for controlling brown planthoppers, which contains biological materials such as the nucleic acid sequence, recombinant vector or host cell, and can effectively kill brown planthoppers by injection.

[0016] Beneficial effects:

[0017] The present invention provides a method and application for controlling brown planthoppers based on the gene fragment Nlug010626.1. The method screens out the brown planthopper lethal gene fragment Nlug010626.1 (SEQ ID NO. 1) and uses dsRNA (SEQ ID NO. 4) of this gene fragment for injection into brown planthoppers. By interfering with the lethal gene fragment Nlug010626.1, the brown planthoppers can be effectively killed. This method is environmentally and ecologically safe and provides food safety, providing a new approach for establishing a biological control method for brown planthoppers. DETAILED DESCRIPTION

[0018] The present invention utilizes the transcriptome of brown planthoppers to screen target genes through gene co-expression network analysis, and discovers an important target gene (brown planthopper lethal gene fragment Nlug010626.1) that can cause the death of brown planthoppers after interference. At the same time, the present invention provides the dsRNA of the lethal gene fragment Nlug010626.1 and its synthesis method, providing a sequence and data basis for establishing a new strategy for controlling pests using RNA interference technology.

[0019] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention are described clearly and completely below. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0020] The endpoints and any values ​​of the ranges disclosed in this specification are not limited to the exact ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be considered to be specifically disclosed herein.

[0021] In the description of this specification, the reference terms "one embodiment", "some embodiments", "specific implementation methods", or "some specific implementation methods" and the like mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the embodiments of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0022] Unless otherwise specified, the materials and reagents used in the following examples are all commercially available. Experimental methods without specific conditions specified in the examples are generally performed under conventional conditions or the conditions recommended by the manufacturer.

[0023] The sequences involved in the following embodiments include:

[0024] SEQ ID NO.1:

[0025]

[0026] SEQ ID NO.2:

[0027] CATAGAGGAGCCGAACGAAG。

[0028] SEQ ID NO.3:

[0029] CCTCATCACCATCCATTTCC。

[0030] SEQ ID NO.4:

[0031] GCAGTCCAACTCCATAGAGGAGCCGAACGAAGGTCTGCCGGACACCACGGTGCTCGACGGAAAGGTCACCAAACTCGACGAGTTGGCGCCTGTCATCTTCCTCAACCGCACCAAGGCCTACCTCAACTGTGCCGCTGGCTATATGCAGATCGAGCTCAAGTTTGAGGAGCCTTTCTACGGGATTGCATACGCCGACTTCGACAGGTCGAGTGCCTGTCAGGTGGCGGGTCGCGGCAACAAGACAGCCAGGATAGATCTCCCGCTCAAAGGATGCGGAACCAGACAGGATCCAACAAGAGTGTTCACAAACAATATCGTGGTTCGATTCCACCCAGCGCTGGAAATGGATGGTGATGAGGTCATAACTATTGTCTGTAGATATCCTCCTCCGGTGGCACCCCCTCCCGCTGGAATTCCTAACTTCATAAAAGAGGAACCAGCACCAGCTCTGCC。

[0032] SEQ ID NO.5:

[0033] TAATACGACTCACTATAGGGCATAGAGGAGCCGAACGAAG。

[0034] SEQ ID NO.6:

[0035] TAATACGACTCACTATAGGGCCTCATCACCATCCATTTCC。

[0036] Example 1

[0037] Cloning of Nlug010626.1 gene fragment:

[0038] Total RNA from brown planthopper was extracted using Trizol method.

[0039] RNA was reverse transcribed using the HiScript IIQ Select RT SuperMix for qPCR kit produced by Vazyme.

[0040] The cDNA obtained by reverse transcription was diluted 10 times with RNase-free H2O and used in the subsequent PCR reaction. The PCR primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0041] DNA fragments were recovered using the FastPure Gel DNA Extraction Mini Kit produced by Vazyme.

[0042] Using Takara's pMD TM The DNA clone fragments were obtained by ligation using 19-T Vector Cloning Kit and ligation transformation using E. coli DH5α Competent Cells.

[0043] Example 2

[0044] dsRNA synthesis of Nlug010626.1 gene fragment:

[0045] Enter the target gene sequence at https: / / www.flyrnai.org / cgi-bin / RNAi_find_primers.pl to design primers. Try to limit the product length to around 500 bp and add the T7 promoter sequence: 5'-TAATACGACTCACTATAGGG-3' to the 5' end. The primer sequences are shown in SEQ ID NO. 5 and SEQ ID NO. 6.

[0046] This example uses the Novozymes T7 RNAi Transcription Kit.

[0047] Example 3

[0048] Microinjection of dsRNA into brown planthoppers:

[0049] (1) Prepare the gel base for microinjection: Prepare 2% agarose gel and fully melt it under high temperature. Then, pour the melted agarose gel into a sterile culture dish, ensuring that its thickness is uniform and sufficient to cover the toothpick and capillary placed in it, so as to form a groove suitable for a specific instar of brown planthopper. After the agarose is completely cooled and solidified, gently remove the toothpick and capillary, leaving a groove on the gel base that matches the insect's body shape to provide a stable support for subsequent microinjection.

[0050] (2) Drawing capillary needles for injection: Use a P-97 Micropipette Puller microinjection needle puller for drawing. The material used is a microelectrode glass capillary (B10024F) produced by Chengdu Weitan Scientific Instruments. Set the drawing program parameters according to the experimental requirements: the heating temperature (Heat) is set to 650, the pulling force (Pull) is set to 300, the pulling speed (Vel) is set to 150, and the heating time (Time) is set to 150ms.

[0051] (3) Microinjection: Inject the dsRNA liquid into a capillary needle and fix it on the microinjector. Use a blade to cut the needle into the appropriate thickness and length according to the age of the brown planthopper. Use the joystick to control the mechanical arm of the injection instrument to insert the capillary needle into the middle of the thorax between the hind legs of the brown planthopper. Then inject the dsRNA. The brown planthopper's abdomen will be slightly swollen during the injection. In addition to injecting the dsRNA of the target gene, dsGFP is also injected as a control group. Each group is repeated for 50 heads, and the injection dsRNA concentration is about 150–350 μg / ml.

[0052] (4) Phenotypic observation: The injected brown planthopper nymphs were immediately transferred to glass test tubes containing fresh rice plants for rearing, and their mortality within 8 days was counted. The results are shown in Table 1.

[0053] Table 1

[0054] deal with 1d 2d 3d 4d 5d 6d 7d 8d Mortality of brown planthopper treated group (%) 40 56 84 88 94 94 96 96 Mortality of brown planthopper control group (%) 0 10 10 10 10 10 10 10

[0055] As shown in Table 1, the injection of dsRNA of Nlug010626.1 had a significant lethal effect on brown planthoppers.

[0056] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A method for controlling brown planthoppers, which kills brown planthoppers by interfering with the lethal gene fragment of the brown planthopper, characterized in that: The brown planthopper lethal gene fragment is Nlug010626.1, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. The method for controlling brown planthopper according to claim 1, wherein: Use dsRNA to interfere with the lethal gene fragment of brown planthopper.

3. The method for controlling brown planthopper according to claim 2, characterized in that: The nucleotide sequence of the dsRNA is shown in SEQ ID NO.

4.

4. The method for controlling brown planthopper according to claim 2 or 3, characterized in that: dsRNA is delivered via microinjection.

5. The method for controlling brown planthopper according to claim 4, characterized in that: The concentration of microinjected dsRNA was 150-350 μg / mL.

6. Biomaterial, characterized in that It contains the dsRNA as described in SEQ ID NO. 4 or its encoding gene.

7. The biomaterial according to claim 6, characterized in that: The biological material is a nucleic acid sequence, a recombinant vector or a host cell.

8. Use of the biological material according to claim 6 or 7 in controlling brown planthopper.

9. Use of the biological material according to claim 6 or 7 in preparing a product for controlling brown planthopper.

10. A preparation for controlling brown planthopper, characterized in that: It contains the biomaterial according to claim 6 or 7.