Application of primer, probe or kit for targeting citrobacter freundii T6SS effect protein hcp gene

By designing primers and probes targeting the T6SS effector protein hcp gene of Citrobacter freundii and combining RPA and LFD technologies, the problems of insufficient specificity and sensitivity in detecting Citrobacter freundii in existing technologies were solved, and rapid and low-cost detection effects were achieved.

CN120738375AActive Publication Date: 2025-10-03HUNAN AGRI UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511220668.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-29
Publication Date
2025-10-03
Estimated Expiration
2045-08-29

AI Technical Summary

Technical Problem

Existing technologies lack specificity and sensitivity when detecting the crayfish pathogen Citrobacter freundii. Furthermore, the equipment and reagents are expensive and the operation is complicated, making it difficult to be widely used in farms.

Method used

Specific primers and probes for the hcp gene of the T6SS effector protein of Citrobacter freundii were designed, and recombinase polymerase amplification (RPA) and lateral flow immunochromatographic strip (LFD) technology were combined to achieve a rapid and simple detection solution.

Benefits of technology

It achieves rapid detection at room temperature, reduces equipment and reagent costs, improves detection specificity and sensitivity, and is suitable for on-site application in farms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120738375A_ABST
    Figure CN120738375A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biological detection, in particular to application of a primer, a probe or a kit for targeting a citrobacter freundii T6SS effect protein hcp gene, the specific primer (SEQ ID NO: 1-2) and the probe (SEQ ID NO: 3) are designed for the hcp gene of the citrobacter freundii T6SS effect protein for the first time, the target gene has higher pathogenicity, the specificity is high, and the specificity is high. The detection specificity is obviously improved. According to the invention, recombinase polymerase amplification (RPA) and a lateral flow immunochromatography test strip (LFD) are combined for use, so that integration of amplification and detection is realized. According to the method, only one pair of primers is needed, amplification can be completed by reacting for 20-30 minutes at normal temperature (38 DEG C), the result is interpreted by naked eyes for 3-5 minutes in combination with an LFD test strip, precise instruments are not needed in the whole process, and the detection result is objective and reliable.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to the application of primers, probes or kits targeting the T6SS effector protein hcp gene of Citrobacter freundii. Background Art

[0002] Procambarus clarkii, as an important aquaculture species, is widely favored by breeders and consumers at home and abroad because of its delicious meat and rich nutrition. Its shrimp roe is rich in unsaturated fatty acids, protein, free amino acids, vitamins, trace elements, etc., and has high medicinal value. It is a major economic shrimp in my country.

[0003] The HCP gene serves as a structural protein of the T6SS: In bacteria with a T6SS, Hcp is a core component of the T6SS, forming a hexameric tubular structure. Homological to the bacteriophage tail protein, it is a key component of the T6SS secretion apparatus. HCP serves as a chaperone for effector proteins: HCP acts as a chaperone for effector proteins, assisting in their folding and transport. In some bacteria, HCP interacts with effectors and delivers them into host cells, thereby regulating bacterial-host interactions. It participates in the regulation of bacterial virulence: In some bacteria, deletion of the HCP gene significantly reduces bacterial virulence, indicating a key role for this gene in bacterial pathogenicity. Studies have shown that decreased hcp gene expression reduces bacterial biofilm formation and pathogenicity. Studies have also shown that hcp gene deletion significantly reduces bacterial motility (P < 0.01) and the bactericidal activity of antiserum (P < 0.05).

[0004] In recent years, frequent bacterial disease outbreaks in Procambarus clarkii aquaculture have caused significant losses to the industry. Among these bacterial pathogens, Citrobacter freundii is a significant pathogen. Crayfish infected with Citrobacter freundii exhibit sluggish activity, weak chelicerae, reduced or absent feeding, darkening of the body surface, and, upon autopsy, pale hepatopancreas and absence of intestinal food. This infection can severely impact shrimp meat quality and food safety.

[0005] In recent years, the field of molecular biology has witnessed significant technological advancements, with techniques such as reverse transcription (RT)-PCR, nested PCR, real-time quantitative PCR (qPCR), reverse transcription real-time quantitative PCR (RT-qPCR), and reverse transcription droplet digital PCR (RT-ddPCR) reaching a high level of maturity. Studies have shown that reverse transcription (RT)-PCR can be used to identify Citrobacter freundii with class A β-lactamases, carbapenemases, and plasmid resistance to colistin. Studies have also shown that MALDI-TOF mass spectrometry and a biochemical-based automated microbial identification system can be used to identify Citrobacter freundii from California sea bass. Studies have also shown that multiplex PCR can be used to screen for Citrobacter freundii. Studies have also shown that reverse transcription quantitative PCR can be used to demonstrate the presence of Enterobacteriaceae in Japanese adults. However, the widespread application of these techniques is limited by multiple factors: they require specialized, sophisticated equipment and highly skilled technicians. Furthermore, the high cost of thermal cyclers and reagents has hindered their widespread adoption, especially outside of the laboratory setting.

[0006] In addition, molecular detection technologies for this pathogen mostly rely on universal genes such as 16S rRNA and gyrB, or well-known virulence genes such as OMPA, OMPX, ureD, and cfa. The existing technology CN117025802A discloses an RPA primer combination for detecting Citrobacter freundii in sturgeons. The primers are designed using the colonization factor cfa gene in Citrobacter freundii as a template. The combination can visually detect Citrobacter freundii within 30 minutes. However, this gene is currently mostly used to detect Citrobacter freundii in other species (such as sturgeons, Chinese mitten crabs, Chinese soft-shelled turtles, and swimming crabs). The cfa gene is used to detect the pathogenic Citrobacter freundii in swimming crabs; the cfa gene is used to detect the pathogenic Citrobacter freundii in Chinese soft-shelled turtles; and the cfa gene is used to detect virulence-related genes in Chinese mitten crabs. At the same time, this technology lacks specific experiments on species closely related to Citrobacter freundii. The existing technology CN118006814A discloses a LAMP detection primer combination and kit for Citrobacter freundii. It uses the OMPA gene of Citrobacter freundii as a template to design primers for visual LAMP detection. The experimental conditions required by its LAMP technology are relatively complex. The technology requires a large number of primer pairs to be designed, which is complicated to design and has a high failure rate. The required reaction time is long, and a constant temperature equipment is required to maintain the reaction at 60-65°C for 30-60 minutes. At the same time, this experiment uses an ion indicator to observe the results, which will be affected by subjective factors and lacks precise judgment criteria.

[0007] Compared with the above-mentioned existing technologies, the present invention uses the T6SS effector protein HCP gene of Citrobacter freundii to design primers, and is innovative in gene selection; the detection method used in the present invention is recombinase polymerase amplification combined with lateral flow chromatography test strip technology, which has the advantages of simple primer design, usually only a pair of primer probes need to be designed, low failure rate, and short reaction time; at the same time, the present invention combines lateral flow test strip (LFD) technology to quickly detect amplification products within 3 to 5 minutes, and the results can be observed with the naked eye. It is easy to operate and suitable for rapid on-site detection. Summary of the Invention

[0008] The present invention aims to solve the problems existing in the existing technology by developing special primers and probes for the detection of the T6SS effector protein hcp gene of Citrobacter freundii, as well as an innovative kit combining recombinase polymerase amplification technology (RPA) with lateral flow immunochromatographic test strips (Lateral Flow Device, LFD), so as to achieve a more efficient and accurate detection solution.

[0009] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions: An RPA primer combination for rapid detection of the T6SS effector protein hcp gene of Citrobacter freundii comprises an upstream primer containing the nucleotide sequence shown in SEQ ID NO.1 and a downstream primer containing the nucleotide sequence shown in SEQ ID NO:2, wherein the 5' end of the downstream primer is labeled with biotin.

[0010] The sequence of the upstream primer is: SEQ ID NO: 1: 5'-TCCGGATAGCCGTGTGCTGGCAGCATTTCACCGT-3'; The sequence of the downstream primer is: SEQ ID NO: 2: 5'-Biotin-AATCGGCCAGATGAACTTCAAAGTGATGAGC-3'; The sequence of the probe is shown in SEQ ID NO: 3; the 5' end is labeled with carboxyfluorescein FAM, the 3' end is added with an extension blocking group C3 Spacer, and a tetrahydrofuran is added between bases 30 and 31. The sequence of the probe is: SEQ ID NO: 3: [5'FAM]-TCCGGATAGCCGTGTGCTGGCAGCATTTCA[THF]CCGTGGGTATAAACGT-[3'C3spacer] The above RPA-specific primer and probe combination is designed based on the key effector protein HCP gene of the T6SS of Citrobacter freundii. The target gene sequence is: atgatgcagttagaagtcatcacgattgggccagggaagcgggcgaattcaacctgctggttctgccagccgctgccgtagttaccgattaggtgtttgaacttacgcagttccggatagccgtgtg ctggcagcatttcaccgtgggtataaacgttaacaccggtgccttcagtctgctcaagcaggttgtagagatctttcaggtcgtgaccggagatcaggatgcacttaccttcggttgcttttacgtt gacctgagtcggggtcgggtgaccgtatttagtggtttcaccggcgtccagaatgctcatcactttgaagttcatctggccgatttccattgaacactccagcagagcgttcatatcggaaggccag gtacccagccacgccatgattttgtggtactgagcatagatatcgttgtcgtactgaccaagaacgtgggcgtgctccatgtaagctgccgcacctttcaggccgtacagacacagcagacgca (seq ID NO:4); The primer combination and probe can be used to prepare a kit for on-site detection of Citrobacter freundii in Procambarus clarkii.

[0011] The present invention provides an RPA-LFD kit for rapid detection of Citrobacter freundii, comprising at least one of the following reagents: the above-mentioned RPA primer combination or RPA probe.

[0012] In addition to the above primer-probe combination, the method further comprises at least one of the following reagents: an RPA amplification reagent and a lateral flow chromatography test strip. The lateral flow chromatography test strip is preferably a colloidal gold test strip or a rainbow test strip.

[0013] Furthermore, the RPA-LFD kit also includes a positive control and a negative control.

[0014] Furthermore, the positive control was genomic DNA of Citrobacter freundii of Procambarus clarkii, and the negative control was sterilized ddH2O.

[0015] Furthermore, the RPA-LFD kit further comprises a nucleic acid releaser, a recombinase that binds to single-stranded nucleic acid, a single-stranded DNA binding protein, a strand-displacing DNA polymerase, a reaction system buffer, and magnesium acetate.

[0016] The present invention also provides a method for detecting Citrobacter freundii based on RPA-LFD, comprising the following steps: (1) Extract the total DNA of the sample to be tested.

[0017] (2) using the total DNA of the sample to be tested as a template, amplifying using the above-mentioned RPA primer-probe combination and recombinase polymerase; (3) Add the amplified product to the colloidal gold test strip and observe the test line and control line.

[0018] Furthermore, the amplified product can be diluted and then loaded onto the colloidal gold test strip.

[0019] Generally, the control line and the detection line are recorded within 5-10 minutes, and the test results are determined (interpreted).

[0020] If the control line is visible and the test line is not visible, this is a negative result; that is, the analyte corresponding to the DNA template does not contain Citrobacter freundii; If both the test line and the control line are visible, this is a positive result; that is, the analyte corresponding to the DNA template is determined to contain Citrobacter freundii; If both the test line and the control line are not visible, the result is invalid.

[0021] Preferably, the amplification conditions in step (2) are 33-42° C. for 10-60 min, preferably 37-42° C. for 20-40 min, and more preferably 39° C. for 25-30 min.

[0022] The present invention adopts a method combining RPA with a lateral flow immunochromatographic test strip. The reaction principle is that a specific probe labeled with carboxyfluorescein (FAM) combines with a primer labeled with biotin to form a double-labeled nucleic acid amplification product. When the sample end of the test strip is immersed in the amplification product, it will combine with the anti-FAM antibody labeled with colloidal gold to form a ternary complex. When it diffuses to the detection line, the ternary complex is captured by the biotin ligand to form a colored detection line. The method has the advantages of being able to judge the results with the naked eye, convenient detection, reaction time within 10 minutes, and easy portability.

[0023] Compared with the prior art, the present invention has the following beneficial effects: (1) Innovative breakthrough in target genes. For the first time, specific primers (SEQ ID NO: 1-2) and probes (SEQ ID NO: 3) were designed for the hcp gene (C-terminal functional domain, nucleotide positions 450-600) of the T6SS effector protein of Citrobacter freundii. As a core component of T6SS, the hcp gene is directly involved in bacterial virulence regulation and host interaction. Compared with the existing technology that relies on universal genes such as 16S rRNA and gyrB or common virulence genes such as cfa and OMPA, the target gene of the present invention has a higher pathogenicity correlation and significantly improves the detection specificity. Through multiple sequence alignment (hcp genes of 7 closely related strains such as CP140972.1 in GenBank), the intraspecies conservation and interspecies differences of the primers and probes were verified, effectively avoiding cross-reactions with common aquatic pathogens such as Aeromonas freundii and Aeromonas hydrophila, and solving the defect of insufficient specificity in the existing technology.

[0024] (2) Recombinase polymerase amplification (RPA) is combined with lateral flow immunochromatographic test strips (LFD) to achieve integrated "amplification-detection". Compared with LAMP technology, which requires constant temperature equipment (60-65°C) and complex primer design (4-6 pairs of primers), this method only requires one pair of primers and can complete amplification in 20-30 minutes at room temperature (38°C). Combined with LFD test strips, the results can be read by the naked eye in 3-5 minutes, and no precision instruments (such as fluorescent quantitative PCR instruments) are required throughout the process. Compared with the LAMP method based on ion indicators in similar studies (the result interpretation is highly subjective), this technology uses the specific binding of FAM-biotin dual-labeled probes and colloidal gold antibodies to achieve objective and reliable detection results.

[0025] (3) The RPA kit for detecting Citrobacter freundii in crayfish of the present invention has a rapid reaction, is easy to operate, sensitive, and time-saving. The amplification process of the RPA reaction only requires a constant temperature of 38°C and a reaction time of 10-30 minutes. The color development of the test strip can be directly observed by the naked eye. If both the test line and the quality control line are colored, it can be qualitatively determined that the crayfish is positive for Citrobacter freundii. This time is much shorter than PCR. The equipment cost is lower than traditional PCR or real-time PCR, making it suitable for on-site testing in aquaculture sites. It can quickly, simply, and specifically detect Citrobacter freundii in crayfish.

[0026] (4) By eliminating the need for expensive equipment such as thermal cyclers and fluorescence detectors, the reagent cost is reduced by more than 60%, and the operation steps are simplified to "one-step amplification-test strip interpretation", which can be completed by non-professionals after simple training. Compared with traditional molecular detection technology (equipment cost > 50,000 yuan), this kit can achieve "single detection at the level of 100 yuan", providing an economically feasible solution for small and medium-sized farmers, and facilitating large-scale monitoring and precise prevention and control of aquatic diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Figure 3 shows the effect of different reaction temperatures on RPA-LFD amplification. In the figure, N is the negative control, and 25℃, 30℃, 35℃, 38℃, 40℃, and 45℃ represent the experimental groups with reaction temperatures of 25℃, 30℃, 35℃, 38℃, 40℃, and 45℃, respectively.

[0028] Figure 2 Figure 3 shows the effect of different reaction times on RPA-LFD amplification. In the figure, N is the negative control, and 1-6 represent the experimental groups of 10 min, 15 min, 20 min, 25 min, 30 min, and 40 min, respectively.

[0029] Figure 3 These are the detection results of RPA-LFD on different concentrations of Citrobacter freundii. In the figure, N is the negative control, and 10 ng, 1 ng, 100 pg, 10 pg, and 1 pg represent the experimental groups with concentrations of 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, and 1 pg / μL, respectively.

[0030] Figure 4 These are the amplification results of different concentrations of Citrobacter freundii genomic DNA using conventional PCR primers. M is DL2000, N is the negative control; 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg, and 1 fg represent the experimental groups with concentrations of 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, and 1 fg / μL, respectively.

[0031] Figure 5 The results of RPA-LFD detection of different concentrations of Citrobacter freundii are shown in Figure 1. N is the negative control; 1-8 represent the concentrations of 10 cfu / ml, 10 2 cfu / ml, 10 3 cfu / ml, 10 4 cfu / ml, 10 5 cfu / ml, 10 6 cfu / ml, 10 7 cfu / ml and 10 8 cfu / ml of the experimental group.

[0032] Figure 6 The results of PCR detection of different concentrations of Citrobacter freundii, M is DL2000, N is the negative control, 10 8 , 10 7 , 10 6 , 10 5 , 104 , 10 3 , 10 2 and 10 represent the concentration of 10 8 cfu / ml, 10 7 cfu / ml, 10 6 cfu / ml, 10 5 cfu / ml, 10 4 cfu / ml, 10 3 cfu / ml, 10 2 cfu / ml and 10 cfu / ml experimental groups.

[0033] Figure 7 The results of specificity testing for Citrobacter freundii were obtained by RPA-LFD. N is the negative control; 1 is Aeromonas welchii; 2 is Aeromonas hydrophila; 3 is Acinetobacter johnsonii; 4 is Lactococcus garvais; 5 is Elizabeth miltneri; 6 is Aeromonas salmonicida; 7 is Citrobacter brockii; and 8 is Citrobacter freundii.

[0034] Figure 8 These are the clinical sample test results of RPA-LFD. 1-2 are the tissue DNA extracted from the hepatopancreas and gill tissues of healthy crayfish No. 1; 3-4 are the tissue DNA extracted from the hepatopancreas and gill tissues of diseased crayfish No. 1.

[0035] Figure 9 are the test results of clinical samples by PCR, M is DL2000, 1-2 are the hepatopancreas and gill tissues of healthy crayfish No. 1; 3-4 are the hepatopancreas and gill tissues of healthy crayfish No. 2; 5-6 are the hepatopancreas and gill tissues of diseased crayfish No. 1; 7-8 are the hepatopancreas and gill tissues of diseased crayfish No. 2. DETAILED DESCRIPTION

[0036] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.

[0037] The pathogens and reagents used in the following experimental examples are as follows: (1) Test pathogens: Citrobacter freundii; Citrobacter braakii; Aeromonas hydrophila; Lactococcus lactis; Acinetobacter johnsonii; Aeromonas veronii; Elizabethkingia miricola; Aeromonas salmonicida. The above pathogens were provided by Professor Wang Xiaoqing's research group at the College of Fisheries, Hunan Agricultural University.

[0038] (2) Reagents: DNA rapid amplification kit (basic type WLB8201 KIT) and rainbow lateral flow test strips (LFD) were purchased from Weifang Anpu Future Biotechnology Co., Ltd., China; trace sample genomic DNA extraction kit DP316 and bacterial genomic DNA extraction kit (DP302-02) were purchased from Acryl Biotechnology Co., Ltd., and Premix Taq TM (ExTaqTM Version 2.0) was purchased from Takara.

[0039] Example 1: Effects of different RPA reaction conditions on RPA-LFD amplification results for detecting Citrobacter freundii of Procambarus clarkii.

[0040] (1) Extraction of bacterial genomic DNA Extraction method of the kit: Take 1 mL of the activated strain into a 1.5 mL centrifuge tube, extract genomic DNA according to the instructions, measure the purity and concentration of the DNA with Nanodrop2000, and store the obtained DNA at -20°C.

[0041] (2) Design of primers and probes The invention designs primers and probes based on the T6SS effector protein hcp gene of Citrobacter freundii. Simultaneously, by comparing and analyzing the HCP gene nucleic acid sequences of CP140972.1, CP056314.1, CP033744.1, CP167050.1, CP099128.1, CP071834.1, and CP038656.1 from GenBank, the C-terminal functional domain of the HCP gene of Citrobacter freundii is further clarified. Primers are designed using Primer Premier 6.0 software based on the conserved region of the HCP gene of Citrobacter freundii. The primer size is set to 30-35 bp, the product size is set to 100-500 bp, and the GC content is set to 20-80%. Probe design was based on optimal upstream and downstream RPA primers between the appropriate target sequences. Probes were at least 46 nt in length, with a FAM label at the 5' end, a C3 spacer at the 3' end, and a THF base substitution in the middle of the probe, with the THF site at least 30 nt before and 15 nt after. All primers and probes were synthesized by Shanghai Sangon Biotechnology Co., Ltd. The primer sequences are as follows:

[0042] SEQ ID NO: 1: 5'-TCCGGATAGCCGTGTGCTGGCAGCATTTCACCGT-3'; SEQ ID NO: 2: 5'-Biotin-AATCGGCCAGATGAACTTCAAAGTGATGAGC-3'; SEQ ID NO: 3: [5'FAM]-TCCGGATAGCCGTGTGCTGGCAGCATTTCA[THF]CCGTGGGTATAAACGT-[3'C3spacer] The specific conserved sequence of the Citrobacter freundii T6SS effector protein hcp gene in this example is as follows: SEQ ID NO: 4: Atgatgcagttagaagtcatcacgattgggccagggaagcgggcgaattcaacctgctggttctgccagccgctgccgtagttaccgattaggtgtttgaacttacgcagttccggatagccgtgt gctggcagcatttcaccgtgggtataaacgttaacaccggtgccttcagtctgctcaagcaggttgtagagatctttcaggtcgtgaccggagatcaggatgcacttaccttcggttgcttttacgt tgacctgagtcggggtcgggtgaccgtatttagtggtttcaccggcgtccagaatgctcatcactttgaagttcatctggccgatttccattgaacactccagcagagcgttcatatcggaaggcc aggtacccagccacgccatgattttgtggtactgagcatagatatcgttgtcgtactgaccaagaacgtgggcgtgctccatgtaagctgccgcacctttcaggccgtacagacacagcagacgca.

[0043] (3) Preparation of RPA reaction system A basic RPA amplification reaction was performed using DNA extracted from Procambarus clarkii (Citrobacter freundii) as a template. The following reaction system was used: 2 μL of upstream primer (10 μM), 2 μL of downstream primer (10 μM), 29.4 μL of reaction buffer A, 2 μL of DNA, and 12.1 μL of ddH2O (a total of 47.5 μL). The mixture was thoroughly mixed and then added to a reaction tube containing lyophilized enzyme powder, slowly pipetting several times to mix thoroughly. Finally, 2.5 μL of reaction buffer B was added to initiate the reaction. After thorough mixing, the tube was centrifuged at low speed and then placed in a thermocouple at 38°C for 30 minutes. After completion of the reaction, an equal volume of phenol-chloroform was added to purify the RPA. Finally, the mixture was mixed and centrifuged at 12,000 rpm for 3 minutes. The supernatant was the RPA product, which was visualized by 1.5% agarose gel electrophoresis. A negative control was performed, using water as the template.

[0044] (4) PCR was performed using a 25 μL reaction system consisting of: 1 μL Primer F, 1 μL Primer R, 9.5 μL ddH2O, 1 μL DNA, and 12.5 μL Premix TaqTM (Ex Taq TM The amplification program was 30 cycles of pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s.

[0045] (5) Reaction temperature The above primers and probes were used to perform RPA-LFD amplification on the genomic DNA of Citrobacter freundii extracted from Procambarus clarkii in Example 1. The reaction temperatures were set at 25°C, 30°C, 35°C, 38°C, 40°C, and 45°C, respectively. N: negative control; reaction time: 30 min. The results are shown in Figure 2. Figure 1 As shown, a faint band appeared on the test strip's test line at 30°C, a relatively clear band at 25°C, and a distinct band between 35°C and 40°C. However, the test strip's test line was darker at 38°C to 40°C compared to 35°C. The results indicate that the optimal reaction temperature for this experiment is between 38°C and 40°C, and we selected 38°C as the optimal reaction temperature for subsequent experiments.

[0046] (6) Reaction time The above primer probes were used to perform RPA-LFD amplification on the genomic DNA of Citrobacter freundii extracted from Procambarus clarkii in Example 1. The reaction time was set to 10 min, 15 min, 20 min, 25 min, 30 min, and 40 min, respectively. The test results were as follows: Figure 2 As shown, the longer the reaction time, the more obvious the test line on the test strip. Results can be observed after 20 minutes of reaction, and the test line is more obvious after 25 minutes. However, the best results are achieved when the reaction time is 25 minutes or 30 minutes. Based on the stability of the reaction, we selected 25 minutes as the optimal reaction time for subsequent experiments.

[0047] Example 2: RPA-LFD sensitivity detection of Citrobacter freundii in Procambarus clarkii (1) Sensitivity detection using genomic DNA The concentration of the extracted Citrobacter freundii genomic DNA from Procambarus clarkii was measured using a Nanodrop-2000 spectrophotometer and diluted to 10 ng / μl. The 10 ng / μl Citrobacter freundii genomic DNA from Procambarus clarkii was diluted tenfold, and eight concentrations of genomic DNA, ranging from 10 ng / μl to 1 fg / μl, were selected as templates. RPA-LFD amplification was performed using the above primer-probe combination at 38°C for 25 min. No template was added to the negative control, and the template volume was made up with water. The minimum detection concentration of RPA-LFD was determined, and sensitivity analysis was performed. The results were compared with PCR.

[0048] The nucleotide sequences of the primer pairs used in the PCR method are shown below.

[0049] Upstream primer: 5′-CGTGGGTATAAACGTTAACAC-3′ (SEQ ID NO: 5); Downstream primer: 5′-CCTGGCCTTCCGATATGAAC-3′ (SEQ ID NO: 6); The amplification conditions were as follows: pre-denaturation at 94°C for 10 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 30 cycles; and extension at 72°C for another 10 min.

[0050] Test results such as Figure 3-Figure 4 As shown in the figure, the minimum detection concentrations of RPA-LFD and PCR amplification of different concentrations of Citrobacter freundii genomic DNA using the screened optimal primers were 100 pg / μL and 1 ng / μL, respectively. The results showed that the RPA-LFD method had the highest sensitivity and was the fastest.

[0051] (2) Sensitivity testing using pure bacterial solution concentration Citrobacter freundii was inoculated into BHI broth and cultured to the logarithmic phase. The bacterial concentration was measured by plate colony counting method and was 2.3*10 9 cfu / mL, and then diluted by ten-fold serial dilution method to obtain a concentration of 10 8 CFU / mL~10 1 CFU / mL of pure bacterial solution, corresponding to serial number 8-1. Take 1mL of different concentrations of Citrobacter freundii pure bacterial solution in a clean centrifuge tube and use DNA extraction kit to extract DNA. Take 1μL of extracted DNA for RPA-LFD detection and compare the test results with PCR method. The test results are as follows Figure 5-Figure 6 As shown, Figure 5 The results of RPA-LFD detection show that the RPA-LFD method has no reaction when detecting the pure bacterial solution of Citrobacter freundii at sequence 2, indicating that the minimum sensitivity of the RPA-LFD method is 2.3×10 3 CFU / mL. Figure 6 The PCR test results showed that the PCR method could only detect 2.3×10 6 The results showed that the sensitivity of RPA-LFD method in detecting pure Citrobacter freundii was 1000 times higher than that of PCR method.

[0052] Example 3: Specific detection of Citrobacter freundii by RPA-LFD RPA-LFD amplification was performed using genomic DNA of Citrobacter freundii, Aeromonas hydrophila, Lactococcus garvae, Elizabethia miltii, Aeromonas veseri, Acinetobacter johnsonii, Aeromonas salmonicida, and Citrobacter brockii as templates. The negative control was replaced with ddH2O instead of template. Figure 7 As shown, only Citrobacter freundii could be amplified well by the RPA-LFD method, and there was no cross-reaction with other bacteria, indicating that this method has a strong specificity for detecting Citrobacter freundii in Procambarus clarkii.

[0053] Example 4: Detection of Citrobacter freundii by RPA-LFD in Clinical Samples The DNA was extracted from the hepatopancreas and gill tissues of healthy Procambarus clarkii infected with Citrobacter freundii using a micro-sample genomic DNA extraction kit and used as a template for RPA-LFD detection. At the same time, a PCR parallel test was performed using conventional PCR primers. Figure 8-Figure 9 As shown, Figure 8 The results of RPA-LFD test show that 1-2 are crayfish without Citrobacter freundii, and 3-4 are crayfish with Citrobacter freundii. The DNA nucleic acid templates were tested by PCR. The results are as follows: Figure 9 In the figure, there are no bands in 1-4, and target bands are present in 5-8, which is consistent with the RPA-LFD detection results. This shows that the RPA-LFD detection method established in this study can effectively detect Citrobacter freundii in diseased crayfish.

[0054] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. An application of a primer, probe or kit targeting the T6SS effector protein hcp gene of Citrobacter freundii, characterized in that: The application is to detect Citrobacter freundii of Procambarus clarkii, and the application is for in vitro non-diagnostic purposes; The primers and probes were designed based on SEQ ID NO: 4; The primers are shown in SEQ ID NO: 1 to SEQ ID NO: 2; the probe is shown in SEQ ID NO: 3; The kit comprises the primers, the probe, an RPA detection reagent, a positive control, and a negative control.

2. An application of primers and probes targeting the T6SS effector protein hcp gene of Citrobacter freundii, characterized in that: The application is to prepare a reagent for detecting Citrobacter freundii in Procambarus clarkii; the primers and probes are designed based on SEQ ID NO: 4; The primers are shown in SEQ ID NO: 1 to SEQ ID NO: 2; the probe is shown in SEQ ID NO:

3.

3. A method for detecting Citrobacter freundii of Procambarus clarkii, characterized in that: The method is for non-diagnostic purposes and comprises the following steps: (1) Extracting nucleic acid samples from the subject to be tested; (2) RPA-LFD detection using primers, probes, or kits targeting the hcp gene of the T6SS effector protein of Citrobacter freundii; The primers and probes were designed based on SEQ ID NO: 4; The primers are shown in SEQ ID NO: 1 to SEQ ID NO: 2; the probe is shown in SEQ ID NO: 3; The kit comprises the primers, the probe, an RPA detection reagent, a positive control, and a negative control.

Citation Information

Patent Citations

  • PCR (polymerase chain reaction) rapid detection kit and detection method for quasipaa boulengeri infected citrobacter freundii

    CN105734163A

  • RPA primer combination, probe and kit for detecting citrobacter freundii of sturgeon and application of RPA primer combination, probe and kit

    CN117025802A

  • LAMP (loop-mediated isothermal amplification) detection primer combination of citrobacter freundii as well as kit and detection method of citrobacter freundii

    CN118006814A

  • Methods and compositions for aquaculture

    WO2019161380A1