Method for improving tomato fruit shape index

By overexpressing the SlbHLH113 protein in tomatoes and changing the expansion direction of fruit cells, the technical difficulty of regulating the shape of tomato fruit was solved, and a significant improvement in the fruit shape index was achieved.

CN120795104APending Publication Date: 2025-10-17ZHEJIANG FORESTRY UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510935617.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-05-19
Filing Date
2025-07-08
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

In the existing technology, research on genes that regulate tomato fruit shape is relatively limited, making it difficult to effectively improve the fruit shape index.

Method used

By overexpressing the SlbHLH113 protein in tomatoes using an overexpression vector driven by the 35S promoter, the expansion direction of the fruit cells was changed, the longitudinal diameter was increased and/or the transverse diameter was reduced, and the fruit shape index was improved.

Benefits of technology

It significantly improves the ratio of the vertical diameter to the horizontal diameter of the tomato fruit, changes the shape of the fruit, makes it more slender, and improves the fruit shape index.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120795104A_ABST
    Figure CN120795104A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and relates to a method for improving a tomato fruit shape index and related genes and proteins. The shape of the tomato fruit is changed by changing the cell expansion direction of the tomato fruit. Experiments prove that SlbHLH113 overexpressed transgenic tomato fruit cells are more inclined to extend along the longitudinal axis than wild tomato fruit cells, so that the longitudinal diameter of the fruits is increased, the transverse diameter is reduced, and the fruit shape index is remarkably improved. Therefore, the SlbHLH113 gene is related to the shape of the tomato fruit; the SlbHLH113 protein and part of coding genes thereof can be used for cultivating new tomato varieties with elongated fruit shapes, and play an important role in the field of plant variety breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a method for changing fruit shape index of tomato, and genes and proteins involved. BACKGROUND

[0002] Tomato, scientific name Solanum lycopersicum is an annual or perennial herbaceous plant of Solanaceae, Lycopersicon esculentum Mill, with high nutritional value.

[0003] Fruit shape is an important agronomic trait, which is closely related to tomato yield, quality and consumption habits, and is an important screening target for tomato breeding. In the production of tomato, yield is a very important indicator. Tomato yield is composed of many factors, one of which is the shape and size of the fruit. Long-term natural selection and domestication improvement process has caused great changes in the size and shape of tomato. Compared with the possible ancestors Solanum pimpinellifolium , the fruit size of modern tomato varieties has increased by more than 100 times, from about 1 gram to several hundred grams. At the same time, wild tomatoes are mostly round, while domesticated cultivated tomatoes have various shapes, such as round, oval, flat round, rectangular, long, pear-shaped, heart-shaped and beef heart-shaped.

[0004] Fruit growth is an important factor affecting fruit size and shape, and is also an important basis for yield and quality formation. Tomato fruit is composed of four parts: pericarp, septum, placenta and seed. From flowering to fruit ripening, the growth and development of tomato fruit can be divided into four periods: fruit setting period, cell division period, cell expansion period and maturation period. Among the four periods, the growth rate of tomato fruit presents an "S-shaped curve": the fruit setting period mainly starts from the formation of flower organs and ends on the day of flowering (pollination and fertilization), which mainly involves the development of flower organs, pollination and fertilization, and fruit setting; the cell division period can be divided into vertical division period and horizontal division period, wherein the vertical division period lasts from the day of pollination and fertilization to 5 days after flowering, mainly affecting the number of cell layers in the vertical direction of the fruit, while the horizontal division lasts from the day of pollination and fertilization to about 9 days after flowering, mainly affecting the number of cells in the horizontal direction of the fruit; the cell expansion period runs through the process of fruit morphological development, starting from the day of pollination and fertilization and lasting until about 33 days (5 weeks) or until the fruit completes green ripening, during which the fruit cells rapidly expand and determine the final cell volume of the fruit; finally, the fruit ripening period, in which the quality traits such as flavor, texture and color gradually change, and the commodity gradually forms. Among the four periods, the main factors determining the final shape of the fruit are the change of cell number in the cell division period and the change of cell shape in the cell expansion period.

[0005] Through the research on tomato genes, a large number of genes affecting the growth of tomato fruits have been identified, most of which regulate fruit size, and a small number of which regulate fruit shape. Fruit shape related genes mainly affect cell division rather than cell expansion.

[0006] In addition, the currently reported genes regulating fruit growth are mainly focused on functional analysis, and the understanding of the regulatory network of fruit growth genes is still limited. Therefore, screening genes with the function of regulating tomato fruit shape has great significance.

[0007] In tomato (Solanum lycopersicum), Solanum lycopersicum Research related to bHLH (basic Helix-Loop-Helix) transcription factors involves multiple gene family members in tomato. CN109161550A discloses that SlbHLH59 gene is used to regulate ascorbic acid content in tomato fruits. CN109402135A provides a salt-tolerant gene SLBHLH of Selaginella moellendorffii.

[0008] The known SlbHLH133, SlbHLH138, and SlbHLH147 are involved in mediating the resistance of tomato to chewing insects and saprophytic pathogenic bacteria. SUMMARY

[0009] The technical problem to be solved by the present application is to provide a new use of SlbHLH113 protein and related biological materials, that is, to provide a method for improving the fruit shape index of tomato.

[0010] To solve the above technical problems, the present application provides SlbHLH113 protein, specifically as follows (A1)-(A4): (A1) a protein with an amino acid sequence of SEQ ID No. 1; (A2) a protein with the amino acid sequence shown in SEQ ID No. 1 after substitution and / or deletion and / or addition of one or more amino acid residues and having the same function; (A3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with the amino acid sequence defined in any one of (A1)-(A2) and having the same function; (A4) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1)-(A3).

[0011] The present application also simultaneously provides a gene encoding the above-mentioned SlbHLH113 protein: gene SlbHLH113 as follows (D1)-(D3): (D1) a DNA molecule as shown in SEQ ID No. 2; (D2) a DNA molecule hybridizing to the DNA molecule defined in (D1) under stringent conditions and encoding the SlbHLH113 protein; (D3) a DNA molecule having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology to any one of the DNA sequences defined in (D1)-(D2) and encoding the SlbHLH113 protein.

[0012] The present application also simultaneously provides a recombinant vector for overexpressing the above-mentioned gene, which is 35Spro: SlbHLH113 -GFP. SlbHLH113 The present application also simultaneously provides a recombinant vector for overexpressing the above-mentioned gene, which is 35Spro: -GFP.

[0013] The present application also simultaneously provides a construction method of the above-mentioned recombinant vector for overexpressing the gene, which comprises the following steps: SlbHLH113 1) connecting a gene with a nucleotide sequence as shown in SEQ ID No. 2 into a gateway entry vector pQB-V3 to construct pQB- 2) using gateway technology to perform LR reaction between pQB- SlbHLH113 and a binary vector PGWB5 (35S promoter, c-GFP) empty vector; SlbHLH113 3) transforming E. coli ToP10 with the LR reaction product, and selecting positive clones, which are recorded as 35Spro: -GFP, a recombinant vector for overexpressing the above-mentioned gene. SlbHLH113 The present application also simultaneously provides a construction method of the above-mentioned recombinant vector for overexpressing the gene, which comprises the following steps: 1) connecting a gene with a nucleotide sequence as shown in SEQ ID No. 2 into a gateway entry vector pQB-V3 to construct pQB- SlbHLH113 2) using gateway technology to perform LR reaction between pQB- SlbHLH113 and a binary vector PGWB5 (35S promoter, c-GFP) empty vector; 3) transforming E. coli ToP10 with the LR reaction product, and selecting positive clones, which are recorded as 35Spro:

[0014] -GFP, a recombinant vector for overexpressing the above-mentioned gene. The present application also simultaneously provides a construction method of the above-mentioned recombinant vector for overexpressing the gene, which comprises the following steps:

[0015] 1) connecting a gene with a nucleotide sequence as shown in SEQ ID No. 2 into a gateway entry vector pQB-V3 to construct pQB- 2) using gateway technology to perform LR reaction between pQB-

[0016] and a binary vector PGWB5 (35S promoter, c-GFP) empty vector; 3) transforming E. coli ToP10 with the LR reaction product, and selecting positive clones, which are recorded as 35Spro:

[0017] -GFP, a recombinant vector for overexpressing the above-mentioned gene. The present application also simultaneously provides a construction method of the above-mentioned recombinant vector for overexpressing the gene, which comprises the following steps:

[0018] 1) connecting a gene with a nucleotide sequence as shown in SEQ ID No. 2 into a gateway entry vector pQB-V3 to construct pQB- 2) using gateway technology to perform LR reaction between pQB- b) a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacteria containing the DNA fragment in a).

[0019] As a further improvement of the method for improving the fruit shape index of tomato of the present application: transforming tomato with a gene SlbHLH113 overexpressing vector to obtain transgenic tomato plants, thereby improving the ratio of longitudinal diameter to transverse diameter of tomato fruits; overexpressing SlbHLH113 The gene vector is 35Spro: SlbHLH113 -GFP.

[0020] In the present application: The new use provided by the present application is specifically the application of the protein or its related biological material in regulating fruit shape; the related biological material is a nucleic acid molecule capable of expressing the protein, or an expression cassette, a recombinant vector, a recombinant bacteria or a transgenic cell line containing the nucleic acid molecule; the protein is SlbHLH113 protein.

[0021] In application, the higher the expression amount and / or activity of the protein in the plant, the higher the fruit shape index of the plant.

[0022] The present application also provides the application of a substance capable of increasing the expression amount and / or activity of the protein in the recipient plant in improving the fruit shape index of the plant; the SlbHLH113 protein is any of the proteins described in (A1)-(A4) above.

[0023] Further, the "substance capable of increasing the expression amount and / or activity of the protein in the recipient plant" can be any of the following: a) a DNA fragment for expressing the coding gene of the SlbHLH113 protein for overexpression; b) a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacteria containing the DNA fragment in a).

[0024] Further, the nucleotide sequence of the DNA fragment in a) is SEQ ID No. 2.

[0025] Another object of the present application is to provide a method for changing the shape of tomato fruits (i.e., a method for improving the fruit shape index of tomato).

[0026] The method for changing the shape of tomato fruits provided by the present application can specifically include the following steps: increasing the expression amount and / or activity of the protein in the recipient plant to obtain tomato plants with changed fruit shape; the protein is SlbHLH113 protein; the SlbHLH113 protein is any of the proteins described in (A1)-(A4) above.

[0027] In the method of the present invention, the “increasing the expression level and / or activity of the protein in the recipient plant” can be achieved by overexpressing the gene encoding the protein in the recipient plant.

[0028] Furthermore, it can be achieved through any technical means that can achieve the purpose of "overexpressing the gene encoding the protein in the recipient plant".

[0029] More specifically, in one embodiment of the present invention, the gene encoding the protein in the recipient plant is overexpressed by introducing into the recipient plant 35S The overexpression vector driven by the promoter is realized; the overexpression vector is PGWB5 The two attL1 and attL2 sites of the vector were subjected to LR reaction respectively, and the sequence of SEQ ID No. 2 was inserted into the resulting recombinant vector.

[0030] In the above method, the overexpression vector is introduced into the recipient plant, specifically by transforming plant cells or tissues using conventional biological methods such as direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, and cultivating the transformed plant tissues into plants.

[0031] In the method, the change in fruit shape may be specifically embodied as follows 1) and / or 2): 1) The fruit shape index of the fruit on the plant with the changed fruit shape is greater than that of the fruit on the recipient plant; 2) The longitudinal diameter of the fruit on the plant with the changed fruit shape is larger than that of the fruit on the recipient plant and / or the transverse diameter is smaller than that of the fruit on the recipient plant.

[0032] In each of the above applications and methods, the plant is a dicot or a monocot. Further, the dicot is a Solanaceae plant. Further, the Solanaceae plant is a tomato.

[0033] In the above applications and methods, the "nucleic acid molecule capable of expressing the protein" is the gene encoding the SlbHLH113 protein.

[0034] Furthermore, the gene encoding the SlbHLH113 protein may be any one of the following (D1)-(D3): (D1) DNA molecule represented by SEQ ID No. 2; (D2) a DNA molecule that hybridizes with the DNA molecule defined in (D1) under stringent conditions and encodes the SlbHLH113 protein; (D3) A DNA molecule having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with any one of the DNA sequences defined in (D1)-(D2) and encoding the SlbHLH113 protein.

[0035] As preferred: the gene of the present application for improving the fruit shape index of tomato SlbHLH113 , the nucleotide sequence of which is shown as SEQ ID No. 2; the gene SlbHLH113 The amino acid sequence of the encoded protein is shown as SEQ ID No. 1.

[0036] The above stringent conditions can be hybridization at 65℃ with a solution of 6×SSC, 0.5% SDS, and then washing the membrane with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS, respectively.

[0037] The "substance capable of increasing the expression amount and / or activity of a protein in a recipient plant" described above also falls within the protection scope of the present application.

[0038] The present application realizes the change of the shape of tomato fruit by changing the direction of cell expansion of tomato fruit. Experiments prove that, SlbHLH113 The transgenic tomato fruit with overexpression of the gene tends to elongate along the longitudinal axis more than the wild type tomato fruit cell, so that the longitudinal diameter of the fruit is increased, the transverse diameter is reduced, and the fruit shape index is significantly improved. Therefore, SlbHLH113 The gene is related to the shape of tomato fruit; the SlbHLH113 protein and the partial coding gene thereof can be used for cultivating a new variety of tomato with elongated fruit shape, and has an important role in the field of plant variety breeding.

[0039] It should be noted that the currently known tomato fruit shape related genes include LC / WUS, SUN, OVATE, GLOBE, FAS / CLV3, which have low homology (only about 7.34%, 17.58%, 2.38%, 21.62%, 2.85%) with the gene SlbHLH113 of the present application, and further have the following differences: for example, different chromosomal locations, different gene regulation functions of fruit, different numbers of amino acids, etc. BRIEF DESCRIPTION OF DRAWINGS

[0040] The specific embodiments of the present application will be further described in detail below with reference to the accompanying drawings.

[0041] Figure 1 For SlbHLH113 Comparison of red ripe fruits of transgenic tomato with overexpression of the gene and red ripe fruits of wild type tomato; Figure 1 In the middle: A is the comparison of fruit appearance, and B is the comparison of longitudinal section of fruit.

[0042] Figure 2 For SlbHLH113 Statistical results of longitudinal diameter, transverse diameter and fruit shape index of red ripe fruits of transgenic tomatoes with gene overexpression and wild type tomatoes; Figure 2 Medium: A is the statistical result of longitudinal diameter, B is the statistical result of transverse diameter, and C is the statistical result of fruit shape index.

[0043] Figure 3 For SlbHLH113 Comparison of paraffin sections of the cell morphology of the central column of red ripe fruits of transgenic tomatoes with gene overexpression and wild type tomatoes under a microscope; left: transgenic tomato; right: wild type tomato; scale: 20 μm.

[0044] Figure 4 For SlbHLH113 Statistical results of the length-width ratio of the central column cells of red ripe fruits of transgenic tomatoes with gene overexpression and wild type tomatoes. DETAILED DESCRIPTION

[0045] The application will be further described below in conjunction with specific examples, but the scope of protection of the application is not limited thereto: In the following examples, the experimental methods used are conventional methods unless otherwise specified. For example, step 2) of Example 1 can be performed according to the published literature "Nakagawa T, Kurose T, Hino T, et al. Development of series of gateway binary vectors, pGWBs, for realizing efficient construction of fusion genes for plant transformation. J Biosci Bioeng. 2007; 104(1): 34-41."

[0046] In the following examples, the materials, reagents, etc. used are commercially available unless otherwise specified.

[0047] In the following examples, the amino acid sequence of SlbHLH113 protein is SEQ ID No. 1, and the nucleotide sequence of its encoding gene is SEQ ID No. 2. SlbHLH113

[0048] In the following examples, tomato is used as a conventional variety M82 (hereinafter also referred to as wild type tomato).

[0049] In the following examples, the PGWB5 vector is a product of Invitrogen Company.

[0050] Example 1, overexpression SlbHLH113 ​Obtaining recombinant gene vectors 1) Extract tomato ( Solanum lycopersicon ) Total RNA of variety M82 was used as template for PCR amplification using primers 1 and 2. SlbHLH113 .

[0051] Primer 1: SlbHLH113-F: ATGGTTACTGGGAATATGTTG (SEQ ID No. 3) Primer 2: SlbHLH113-R: TTGCCCTACCGGTGAAAGTTG (SEQ ID No. 4) PCR amplification system: KOD-Plus-Neo (1U / ul) 1 ul, 10× PCR Buffer for KOD-Plus-Neo 5 ul, 2 mM dNTPs 5 ul, 25 mM MgSO4 3 ul, template cDNA (50 ng / ul) 2 ul, SlbHLH113-F (10 uM) 1.5 ul, SlbHLH113-R (10 uM) 1.5 ul, autoclaved distilled water 31 ul; PCR amplification program: 94°C 2 min, 98°C 10 sec, 56°C 30 sec, 68°C 2 min, 16°C 10 min; 98°C 10 sec, 56°C 30 sec, 68°C 2 min, this step was repeated 35 times; Amplified SlbHLH113 The nucleotide sequence is shown in SEQ ID No. 2 (SEQ ID No: 2 includes the terminator TAA), and the protein amino acid sequence is shown in SEQ ID No. 1.

[0052] 2) To generate 35Spro: SlbHLH113 -GFP construct, the PCR amplified SlbHLH113 Ligated into the entry vector pQB-V3 to construct pQB- SlbHLH113 .

[0053] Using Gateway technology, the connected pQB- SlbHLH113 LR reaction was performed with the binary vector PGWB5 (35S promoter, c-GFP) empty vector to obtain pGWB5- SlbHLH113 .

[0054] The resulting LR reaction product pGWB5- SlbHLH113The transformed E. coli ToP10 was selected, i.e. colony PCR amplification was performed using primers PGWB-F and PGWB-R, and the length of the amplified fragment was 1815 bp (remove the stop codon TAA in SEQ ID No: 2), and the PCR amplification system was Green Taq Mix 25 ul, pGWB5- SlbHLH113 Template bacterial liquid 1 ul, PGWB-F (10 uM) 2 ul, PGWB-R (10 uM) 2 ul, Autoclaved distilled water 20 ul; PCR amplification program: 95℃ 3 min, 95℃ 15 sec, 56℃ 15 sec, 72℃ 2 min, 16℃ 10 min; 95℃ 15 sec, 56℃ 15 sec, 72℃ 2 min, this step was repeated for 35 cycles.

[0055] The plasmid of the positive clone was extracted for sequencing, which was the LR reaction at the two attL1 and attL2 sites of the PGWB5 vector, and the SEQ ID No. 2 sequence was inserted, indicating that the recombinant vector was correctly constructed, and was recorded as 35Spro: SlbHLH113 -GFP, overexpression SlbHLH113 of the gene.

[0056] PGWB-F: ACAAGTTTGTACAAAAAAGCAGGCT (SEQ ID No. 5) PGWB-R: ACCACTTTGTACAAGAAAGCTGGGT (SEQ ID No. 6).

[0057] Example 2, overexpression SlbHLH113 of the gene transgenic tomato and functional identification I. Overexpression SlbHLH113 of the gene transgenic tomato 1. Overexpression SlbHLH113 of the gene recombinant bacteria The overexpression SlbHLH113 of the gene recombinant vector 35Spro: SlbHLH113 -GFP obtained in Example 1 was transformed into Agrobacterium GV3101, single colonies were picked, and the transformants were obtained by overnight shaking culture at 28℃ in LB liquid medium containing kanamycin (concentration of 50 ug / mL) and rifampicin (concentration of 25 ug / mL).

[0058] The transformants were identified by bacterial liquid PCR, and primers PGWB-F and PGWB-R (same as Example 1) were used, and the PCR identification obtained SlbHLH113The sequence (SEQ ID No. 2) is a positive recombinant bacteria, and the positive recombinant bacteria is named GV3101 / 35Spro: SlbHLH113 GFP, and stored at -70°C for standby.

[0059] 2. Overexpression SlbHLH113 Obtaining of transgenic tomato with overexpression of gene 1) Preparation of tomato transformation-related medium Liquid MS medium: 4.4 g MS salt (Murashige and Skoog Basal Salt Mixture, PhytoTech LABS), 30 g sucrose and water are mixed, and water is added to 1 L, and pH is adjusted to 5.8-6.0 with 1 mol / L KOH, and autoclaved.

[0060] Seed growth medium (1 / 2 MS medium): 2.2 g MS salt, 30 g sucrose and water are mixed, and water is added to 1 L, and pH is adjusted to 5.8-6.0 with 1 mol / L KOH, and 0.8% agar is added, and autoclaved.

[0061] Pre-culture medium (D1): 4.4 g MS salt, 1.0 mg zeatin and 30 g sucrose are dissolved in water, and water is added to 1 L, and pH is adjusted to 5.8-6.0 with 1 mol / L KOH, and 0.8% agar is added, and autoclaved.

[0062] Screening differentiation medium (2Z): 4.4 g MS salt, 2.0 mg zeatin, 50 mg kanamycin, 100 mg myo-inositol, 0.5 mg folic acid and 20 g sucrose are dissolved in water, and water is added to 1 L, and pH is adjusted to 5.8-6.0 with 1 mol / L KOH, and 0.8% agar is added, and autoclaved.

[0063] Rooting medium: 4.4 g MS salt, 50 mg kanamycin, 0.5 mg folic acid, 0.5 mg indolebutyric acid and 30 g sucrose are dissolved in water, and water is added to 1 L, and pH is adjusted to 5.8-6.0 with 1 mol / L KOH, and 0.8% agar is added, and autoclaved.

[0064] 2. Overexpression 35Spro:SlbHLH113 Preparation of transgenic tomato with overexpression of gene (1) Preparation of transformed explants Select plump, large seeds from wild-type tomato (variety M82), soak them in 75% ethanol for 2 min, then in 30% NaClO for 10 min, rinse five times with sterile water, sow them on seed growth medium, and culture them under light conditions at 25°C, 16 h light / 8 h dark. After germination for 8 days, cut the cotyledons into small cubes using sharp scissors under sterile conditions (the action should be quick). Inoculate the cotyledon cubes into pre-culture medium and culture them at 25°C, 16 h light / 8 h dark. After 2 days, they can be used for tomato transformation.

[0065] The light intensity is 800-1200 lx.

[0066] (2) Preparation of infection solution Will save the spare GV3101 / 35Spro -GFP was inoculated into LB liquid medium containing kanamycin (50 μg / mL) and rifampicin (25 μg / mL) and cultured overnight at 28°C and 200 rpm. The next day, the cells were transferred to fresh LB liquid medium containing kanamycin (50 μg / mL) and rifampicin (25 μg / mL) at a 1:100 volume ratio and cultured at 28°C and 200 rpm until an OD600 of 0.7 was reached. The culture was centrifuged at 5000 rpm for 10 minutes, the supernatant discarded, and the cells collected. The cells were resuspended in liquid MS medium and diluted to an OD600 of 0.4. This was used as the infection medium and reserved for future use.

[0067] (3) Transformation, screening and rooting of explants The cotyledon pieces obtained in step (1) were immersed in the infection solution prepared in step (2) for 10 minutes, then inoculated on D1 culture medium (with filter paper on the culture medium) and cultured for 2 days. They were transferred to screening and differentiation culture medium (2Z) for screening and culture. The plants were subcultured every 2 weeks. After 8 weeks of culture, resistant buds were produced (buds with growth points under 50 ug / mL kanamycin resistance conditions were resistant buds). When the adventitious buds were elongated to 3 cm, they were cut off with a scalpel and transferred to the rooting culture medium for rooting culture. The rooting culture was terminated until the root system grew vigorously, there were many lateral roots, and the adventitious buds grew 3 to 5 leaves. The rooting culture was terminated. The rooted T0 transgenic plants were transplanted into the soil for routine management and the T1 transgenic plants were harvested. SlbHLH113 : SlbHLH113 -GFP ( SlbHLH113 -OE) transgenic tomato seeds.

[0068] The conditions for the above co-cultivation, screening culture, and rooting culture were: temperature 25°C, 16 h light / 8 h dark.

[0069] 3) Overexpression 35SproIdentification of genetically modified tomatoes The T1 generation SlbHLH113 : SlbHLH113 -GFP ( SlbHLH113 -OE) transgenic tomato seeds were routinely cultured, and the aerial parts of tomato plants at the two-leaf and one-heart stage of 18 days were cut, quickly frozen with liquid nitrogen, and stored at -80℃. SlbHLH113 -OE transgenic tomato leaf RNA was reverse transcribed to obtain cDNA, and RT-PCR was performed using wild-type tomato M82 as a control.

[0070] For RT-PCR detection SlbHLH113 Expression level primers (amplified at SlbHLH113-OE The 178 bp fragment at the 3' end of the coding region, i.e., bases 1629 to 1806 of SEQ ID No. 2, is: Upstream primer SlbHLH113-QF: 5′- AATCATCCAAATATTCAAAGAG -3′ (SEQ ID No. 7); Downstream primer SlbHLH113-QR: 5′-CGGTGAAAGTTGCCTTAA -3′ (SEQ ID No. 8).

[0071] With actin2 as the internal reference, the primers used to amplify the internal reference gene are: Upstream primer SlACT2-QF: 5′- TTGCTGACCGTATGAGCAAG -3′ (SEQ ID No. 9); Downstream primer SlACT2-QR: 5′-GGACAATGGATGGACCAGAC-3′ (SEQ ID No. 10).

[0072] The RT-PCR amplification system consisted of 10 ul of 2×SYBR Green qPCR Mix, 0.5 ul of upstream primer, 0.5 ul of downstream primer, 0.5 ul of template cDNA, and 8.5 ul of autoclaved distilled water. The RT-PCR amplification program was 95°C for 2 min, 95°C for 15 sec, and 60°C for 15 sec; then 95°C for 2 min, 95°C for 15 sec, and 60°C for 15 sec, and this step was repeated for 40 cycles.

[0073] Wild-type tomato materials and T1 generation SlbHLH113-OE Each transgenic tomato material had three biological replicates (i.e., three cDNA samples of wild-type tomato material, cDNA1, cDNA2, cDNA3; T1 generation SlbHLH113Three cDNA samples of transgenic tomato materials (cDNA4, cDNA5, cDNA6) were used for three technical replicates. SlbHLH113 The relative expression of genes was expressed using 2- △△CT The calculation method of wild-type tomato SlbHLH113 The relative expression of the gene is 1, and the T1 generation SlbHLH113 -OE genetically modified tomatoes SlbHLH113 The relative expression level of the gene is 15. It can be seen that compared with the wild-type tomato, the T1 generation SlbHLH113 -OE genetically modified tomatoes SlbHLH113 The gene was overexpressed and the plants were positive for transgenic plants.

[0074] 4) Obtaining homozygous transgenic plants The T1 generation identified as positive SlbHLH113 -OE transgenic tomato plants were harvested to obtain T2 generation seeds, which were sterilized and sown on 1 / 2 MS medium containing 50 ug / mL kanamycin for screening (the lateral roots of wild-type M82 were severely inhibited and no lateral roots grew on 1 / 2 MS medium containing 50 ug / mL kanamycin; the lateral roots of transgenic materials were basically not inhibited due to their kanamycin resistance). If a T1 generation SlbHLH113 If the seeds harvested from the -OE transgenic plants all show resistance to kanamycin, then the T1 generation transgenic plants are homozygous and the seeds harvested from them are also homozygous.

[0075] After identification, T2 generation SlbHLH113 -OE transgenic tomato 6# T1 generation harvested seeds all showed resistance to kanamycin, that is, T2 generation SlbHLH113-OE -OE transgenic tomato line 6# is homozygous.

[0076] SlbHLH113 Effects of transgenic tomatoes on fruit shape Wild-type tomato and homozygous SlbHLH113-OE -OE transgenic tomatoes were grown under solar greenhouse conditions.

[0077] First, soak the seeds in warm water, that is, soak the above-mentioned tomato seeds (wild type M82 and SlbHLH113Transgenic tomato 6#T2 generation was incubated for 15 minutes, then soaked in a waterbath at 55°C for 30 minutes. The seeds were then removed and soaked in cold water (room temperature, 25°C) for 2 hours. A piece of filter paper was then placed on a plastic Petri dish and moistened with water. The seeds were then placed on this filter paper and germinated at room temperature (25°C). After the seeds germinated, they were sown in 4 × 8 plug trays filled with seedling medium ("Golden No. 3" farmer-specific plug tray seedling medium purchased from Hangzhou Jinhai Agricultural Technology Co., Ltd.) and grown in a light incubator with an 18 h / 6 h photoperiod, a day / night temperature of 25°C / 18°C, and a light intensity of 22,000 lux. When the seedlings reached a sufficient height (approximately 15 cm), they were transplanted into round pots 28 cm in diameter and 18 cm in height in a field greenhouse, using the same medium. Spray a mixture of nitenpyram and spirotetramat (purchased from Henan Bisier Agricultural Technology Co., Ltd., at a rate of 30-40 ml / mu) weekly at a ratio of 1:3000 nitenpyram to 1:1500 spirotetramat. Apply a compound slow-release fertilizer (purchased from Henan Yongguan Qiaodi Agricultural Technology Co., Ltd., at a rate of 4000-5000 times diluted) monthly. Flowering occurred approximately one month after planting. Flowers that bloomed that day were artificially pollinated and labeled at around 10:00 AM. Fruits ripened about 40 days after flowering. When fully ripe and red, they were removed, washed, and cut in half along the central axis. Dry the surface with a paper towel and scanned using a scanner. A ruler was placed above the fruit and the label below. Scans were performed at 300 DPI. Scanned images were saved in JPG format. Images were analyzed using Tomato Analyzer 3.0, and fruit diameters and shape index were measured.

[0078] The experimental results showed that compared with the wild-type tomato M82, the homozygous Figure 1 -OE transgenic tomato fruit shape index increased significantly. Specifically: (1) The shape of transgenic tomato fruits changes.

[0079] The results are as follows Figure 2 As shown, transgenic tomato fruits are oval in shape compared to wild-type fruits.

[0080] (2) The longitudinal diameter of transgenic tomato fruits increased, while the transverse diameter decreased.

[0081] The results are as follows Figure 2 As shown in the figure, statistics show that the longitudinal diameter of the fruit of transgenic tomatoes is significantly increased compared with wild-type tomatoes ( Figure 2 A), while the transverse diameter is significantly reduced ( Figure 2 B), which ultimately resulted in the fruit shape index of the transgenic tomato red ripe fruit being significantly higher than that of the wild type tomato ( Figure 3 C).

[0082] Note: Fruit shape index = fruit length / fruit diameter.

[0083] Changes in fruit morphology are often based on changes in cell morphology. The present application detects the size of fruit cells in wild-type and transgenic lines as follows: Paraffin sectioning; Fixation: Fresh samples of style tissue in the breaker stage were cut into about 2-4 mm square blocks with a scalpel and quickly placed in FAA fixing solution. A 2XZ-2 rotary vacuum pump from the Linhai Yonghao Vacuum Equipment Co., Ltd. was used to vacuum for 30 min, and the samples were stored in a 4°C refrigerator for later use.

[0084] Dehydration: The fixed samples were removed, and the fixing solution was discarded. The samples were treated with gradient ethanol according to Table 1 below.

[0085] Table 1 Gradient ethanol treatment

[0086] Transparency: After dehydration, the samples were transparentized, and the anhydrous ethanol was discarded. The samples were treated with gradient xylene according to Table 2 below.

[0087] Table 2 Gradient xylene treatment

[0088] Note: 2 ethanol: 1 xylene (V / V), i.e., the volume ratio of ethanol to xylene is 2:1.

[0089] Wax immersion: The transparentized samples were moved into a chloroform / xylene mixed solution, and an appropriate amount of cut paraffin wax was added. The samples were left overnight. The next day, the samples were placed in a 42°C constant temperature water bath along with the chloroform / xylene mixed solution and the incompletely dissolved cut paraffin wax. After the cut paraffin wax was completely dissolved, new cut paraffin wax was added until the cut paraffin wax no longer dissolved. The chloroform / xylene mixed solution with dissolved cut paraffin wax was discarded, and pure cut paraffin wax that had been previously melted in a 60°C constant temperature water bath was added. The constant temperature water bath was set to 60°C. New cut paraffin wax was added every 4 hours, and the process was repeated 3 times a day. The constant temperature water bath was set to 60°C overnight (without replacing the cut paraffin wax), and the process was repeated for a total of 3 days, with 9 replacements of cut paraffin wax.

[0090] Embedding: A constant temperature metal bath was used to heat the embedding base to 70°C for later use. After the samples in the 60°C constant temperature water bath were removed, the cut paraffin wax was also poured into the embedding base. The position of the sample was adjusted with tweezers, and a plastic base was placed on top of the embedding base and covered with paraffin. The embedding base was quickly moved to an ice box to cool, and after the cut paraffin wax completely cooled and solidified, the base and the wax block with the sample were removed, numbered, and stored in a 4°C refrigerator.

[0091] Slicing: The wax block stored in the 4℃ refrigerator was taken out and placed in an ice box for incubation, and then sliced using a slicer with a thickness of 10 μm. The cut strip was spread in a water bath at 42℃, and then the intact and undamaged slice was quickly taken out with a glass slide. The glass slide with the sample was dried in the spreader, dyed with fast green, and then washed with 95% ethanol to remove excess dye. The sample was observed and photographed using an optical microscope, and the cell morphology, number, and other indicators were analyzed and statistically processed to calculate the difference.

[0092] The results are shown in Figure 4 and SlbHLH113-OE , SlbHLH113 The ratio of length to width of the funiculus cells in the transgenic tomato and wild-type tomato fruits showed significant differences. Specifically, the funiculus cells in the transgenic tomato fruits were more elongated than those in the wild-type tomato fruits, with a ratio of length to width of about 1.82, while the wild-type was about 1.37. This result is consistent with the difference in fruit shape index between the wild-type tomato fruits and the transgenic tomato fruits. The above results show that the morphological difference of the funiculus cells is the cause of the morphological difference between the transgenic tomato fruits and the wild-type tomato fruits.

[0093] The above results prove ​ that the gene is related to the shape of the tomato fruit, and that the SlbHLH113 protein and its encoding gene can be used for the cultivation and identification of new tomato plant varieties with special fruit shapes, and has an important role in the field of breeding.

[0094] Finally, it should be noted that the above enumeration is only a few specific embodiments of the present application. Obviously, the present application is not limited to the above embodiments, and there can be many variations. All variations that can be directly derived or inferred from the disclosure of the present application by those of ordinary skill in the art should be considered within the scope of the present application.

Claims

1. SlbHLH113 protein, characterized in that: The SlbHLH113 protein is any one of the following proteins (A1)-(A4): (A1), protein with amino acid sequence SEQ ID No. 1; (A2) A protein having the same function as that of the amino acid sequence shown in SEQ ID No. 1 after one or more amino acid residues are substituted and / or deleted and / or added; (A3) A protein having an amino acid sequence homology of 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more to any of the amino acid sequences defined in (A1) to (A2) and having the same function; (A4) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of any of the proteins defined in (A1) to (A3).

2. The gene encoding the SlbHLH113 protein according to claim 1, wherein: Gene SlbHLH113 Any one of the following (D1)-(D3): (D1) DNA molecule represented by SEQ ID No. 2; (D2) a DNA molecule that hybridizes with the DNA molecule defined in (D1) under stringent conditions and encodes the SlbHLH113 protein; (D3) A DNA molecule that has a homology of more than 99%, more than 95%, more than 90%, more than 85% or more than 80% with any of the DNA sequences defined in (D1) to (D2) and encodes the SlbHLH113 protein.

3. Overexpression SlbHLH113 A recombinant gene vector, characterized in that: For 35Spro: SlbHLH113 -GFP.

4. Overexpression as claimed in claim 3 SlbHLH113 A method for constructing a recombinant gene vector, characterized in that The following steps are involved: 1) The nucleotide sequence of the gene shown in SEQ ID No.2 SlbHLH113 Connect to the entry vector pQB-V3 to construct pQB- SlbHLH113 ; 2) Using Gateway technology, pQB- SlbHLH113 LR reaction was performed with the binary vector PGWB5 empty vector; The LR reaction product was transformed into E. coli ToP10, and the positive clone was selected and recorded as 35Spro: SlbHLH113 -GFP, for overexpression SlbHLH113 Recombinant gene vector.

5. The use of the gene according to claim 2, characterized in that: Improve tomato fruit shape index.

6. The use of the gene according to claim 5, characterized in that: Increase the longitudinal diameter of tomato fruits, and / or reduce the transverse diameter of tomato fruits.

7. The use of the gene according to claim 6, characterized in that: Make the pith cells more slender.

8. A method for improving the fruit shape index of tomatoes, characterized by: The expression level and / or activity of the SlbHLH113 protein in the recipient tomato is increased.

9. The method for improving tomato fruit shape index according to claim 8, characterized in that Any of the following: a) a DNA fragment for overexpressing the gene encoding the SlbHLH113 protein; b) a recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing the DNA fragment described in a).

10. The method for improving tomato fruit shape index according to claim 8 or 9, characterized in that: Gene SlbHLH113 Transforming tomatoes with the overexpression vector to obtain transgenic tomato plants, thereby increasing the ratio of the longitudinal diameter to the transverse diameter of the tomato fruit; Overexpression SlbHLH113 The gene carrier is 35Spro: SlbHLH113 -GFP.

Citation Information

Patent Citations

  • SlbHLH59 gene capable of regulating ascorbic acid content in tomato fruit and application method of SlbHLH59 gene

    CN109161550A

  • SLT (sedum lineare thunb) salt-tolerant gene SLBHLH and application thereof

    CN109402135A