Primer group and probe for simultaneously detecting endothelial herpes viruses 1 and 5 and application of primer group and probe

Abstract

The invention relates to a primer group and a probe for simultaneously detecting endothelial herpes viruses 1 and 5 and application, and relates to the technical field of biology. The primer group and the probe not only can be independently used for single detection of EEHV1 and EEHV5, but also can realize rapid, accurate, sensitive and convenient single-tube dual detection of the two viruses at the same time.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a primer set, a probe and application for simultaneously detecting elephant endotheliozoic herpesvirus type 1 and type 5. BACKGROUND

[0002] Asian elephants are listed in the Red List of the International Union for Conservation of Nature (IUCN) as a globally endangered species. Elephant endotheliozoic herpesvirus (EEHV) is a major pathogenic agent of young elephants (especially individuals under 4 years old) in Asia (Elephas maximus) and Africa (Loxodonta africana). More than 20% of Asian elephant calves are susceptible to EEHV. EEHV causes viral hemocytoblastosis, leading to the death of elephants, and the disease has the characteristics of rapid onset and high mortality rate, and many young elephants die within one hour to seven days after the onset of clinical symptoms. Since the early symptoms are not obvious, there is no vaccine for EEHV, and there is no specific treatment method. Early screening is crucial for the prevention and control of elephant diseases and the protection of the species by implementing timely interventions. At present, the main detection method of EEHV is conventional polymerase chain reaction (PCR) or fluorescent quantitative PCR (qPCR). However, this method requires professional equipment, special laboratory facilities, and trained professionals. There are obvious defects in the detection of EEHV, especially in the field environment. Therefore, a simple, rapid and portable detection method is needed.

[0003] LAMP technology was first proposed by Notomi T et al. in 2000, which is a nucleic acid detection technology based on isothermal amplification principle, and has been widely used in the detection of bacterial and viral infections in the field of veterinary medicine. This technology relies on DNA polymerase with strand displacement activity (such as Bst DNA polymerase), and through the design of 6 primers (including two inner primers FIP, BIP and two outer primers F3, B3, and two loop primers LF, LB) targeting 8 specific regions of the target gene, it realizes efficient amplification of nucleic acids at a constant temperature (60-65℃). Among them, each inner primer can bind to 2 adjacent regions of the target gene, and 4 primers collectively recognize 6 independent regions, thereby ensuring high specificity of amplification. Traditional LAMP detection methods usually add fluorescent dyes (such as SYBR Green), metal ions or PH indicators, or determine the results by agarose gel electrophoresis, which is easy to cause false positives and laboratory contamination. SUMMARY

[0004] In view of the above problems, the present application provides a primer set and a probe for simultaneously detecting elephant endotheliozoic herpesvirus type 1 and type 5. The primer set and the probe can not only be used for single detection of EEHV1 and EEHV5, but also can realize rapid, accurate, sensitive and convenient single-tube double detection of the two viruses at the same time.

[0005] In order to achieve the above object, the present application provides a primer set and probe for simultaneously detecting Herpesvirus Saimiri 1 and 5, the primer set being selected from at least one of primer set 1, primer set 2 and primer set 3.

[0006] The primer set 1 comprises the following primer sequences:

[0007] F3: GTAGGGTTCACAGATTCGT (SEQ NO. 11);

[0008] B3: GGTAAATCCATACACGGCA (SEQ NO. 12);

[0009] FIP: CAATTTTTCCCTGACAGCTTTGCAAAACCGCATGTTAGAAAGT (SEQ NO. 13);

[0010] BIP: AGCATTGTAAAGATCCTCTTATGCATGCACGTTAGTTTTAGAGCC (SEQ NO. 14);

[0011] LF: CACGACGTTAACAGTTGCGAG (SEQ NO. 15);

[0012] The primer set 2 comprises the following primer sequences:

[0013] F3: CAGATTCTACTCGACAAACAG (SEQ NO. 21);

[0014] B3: GGCGATATGTCAACTAGAAAGT (SEQ NO. 22);

[0015] FIP: ACGGAAACATGCCTCTGGAAAGCCCTGAAACTTACGTGTA (SEQ NO. 23);

[0016] BIP: TATAGCTGAATCGGTTACCGCCCCAATCGTTAAATCTGTCACAT (SEQ NO. 24);

[0017] LF: ACCGGTAAATCCATATACAGCGT (SEQ NO. 25);

[0018] LB: GGAAGACAGTTGCTAGCCAC (SEQ NO. 26);

[0019] The primer set 3 comprises the following primer sequences:

[0020] F3: GGATGATGACGTTACGACT (SEQ NO. 27);

[0021] B3: GGTAAATCCATATACAGCGTTAC (SEQ NO. 28);

[0022] FIP: CCAGGATGTAAGAAGTTGAGAGAGAGTTACGACTAACACGGGAA (SEQ NO. 29);

[0023] BIP: AAGCCGTGAGAGAAAAGTTAAAACATAAGTTTCAGGGCAAGCT (SEQ NO. 30);

[0024] LF: GAGGTTTTACAAACCTGTGCTTTC (SEQ NO. 31);

[0025] LB: TGTAGTGACCCTTTGATGCAGA (SEQ NO. 32);

[0026] The probe is selected from at least one of: probe 1, probe 2, probe 3, probe 4, probe 5;

[0027] The sequence of the probe 1 comprises: CACGACGTTAACAGTTGCGA (SEQ NO. 33);

[0028] The sequence of the probe 2 comprises: CAGCCACGACGTTAACAG (SEQ NO. 34);

[0029] The sequence of the probe 3 comprises: ACCGGTAAATCCATATACAGCGT (SEQ NO. 35);

[0030] The sequence of the probe 4 comprises: GGAAGACAGTTGCTAGCCAC (SEQ NO. 36);

[0031] The sequence of the probe 5 comprises: TGTAGTGACCCTTTGATGCAGA (SEQ NO. 37).

[0032] The present inventors have studied the detection method of EEHV, and the existing research data on LAMP detection method of EEHV is to add hydroxynaphthol blue (HNB), a metal ion indicator, to visualize the detection results. (Takehana, Kazuya et al. "Rapid and sensitive detection of elephant endotheliotropic herpesvirus 1 (EEHV1) in blood by loop-mediated isothermal amplification (LAMP)." The Journal of veterinary medical science vol. 81, 3 (2019): 504-507. doi:10.1292 / jvms.18-0683). HNB combines with magnesium ions to make the initial color of the reaction system purple, and as the reaction proceeds, Mg 2+ reacts with the precipitated pyrophosphate ions to form magnesium pyrophosphate precipitate, and hydroxynaphthol blue loses magnesium ions, and the color of the system changes to sky blue. Since LAMP reaction needs to add six primers, the primers interact with each other, which easily causes non-specific amplification reaction, and based on the non-specific indicator HNB combined with Mg 2+ , the results of non-specific amplification are easily judged as positive, resulting in false positive results. Moreover, this LAMP is only for EEHV1 detection, and only relying on fluorescent dyes or indicators cannot realize double detection. There is also a method of using RPA to detect EEHV, and the detection results are observed by agarose gel electrophoresis after amplification reaction, which needs to open the tube for electrophoresis, which easily causes environmental pollution, and the detection operation of this method is complex, which is not conducive to realize on-site operation. Based on this, the present inventors propose to design a sequence-specific probe based on the technology of LAMP, which is located between the 3' end of F2c and the 5' end of F1c or between the 3' end of B2 and the 5' end of B1; select a specific sequence with a length of 18-30 bases, a Tm value of 50-65℃, and a GC content of 40-65%; avoid consecutive G / C, and the 3' end sequence does not contain AT; use DNAMAN analysis, the primer itself has no complementarity or complementarity of no more than 3 base pairs, and is not located at the 3' end. It is generally believed that Bst DNA polymerase has 5'→3' DNA polymerase activity and strong strand displacement activity on DNA template, but lacks 5'→3' and 3'→5' exonuclease activity. The detection method based on the above primer group + probe can place two primer groups in the same tube by modifying different fluorescent groups (such as FAM and CY5), detect the corresponding fluorescent signals to realize single-tube double detection, and the detection results have the characteristics of high specificity and high sensitivity.

[0033] In one of the embodiments, the primer set is primer set 1 and primer set 3, and the probe is probe 1 and probe 5.

[0034] In one of the embodiments, the 3' end of the probe is modified with a fluorescent group, and the 5' end of the probe is modified with a quenching group.

[0035] The application also provides application of the primer set and the probe for simultaneously detecting elephant endotheliozoic herpesvirus 1 and 5 in a kit for detecting elephant endotheliozoic herpesvirus 1 and 5, wherein the elephant endotheliozoic herpesvirus includes elephant endotheliozoic herpesvirus 1 and / or 5.

[0036] The application also provides a detection system for elephant endotheliozoic herpesvirus, which includes an isothermal amplification reaction system, and the isothermal amplification reaction system includes the primer set and the probe for simultaneously detecting elephant endotheliozoic herpesvirus 1 and 5.

[0037] In one of the embodiments, the elephant endotheliozoic herpesvirus includes elephant endotheliozoic herpesvirus 1 and / or 5.

[0038] In one of the embodiments, the isothermal amplification reaction system further includes Bst DNA polymerase.

[0039] The application finds that the Bst polymerase has 3'→5' exonuclease activity through experiments, and the activity is used to cut the quenching group at the 3' end of the probe, so that the detection of the fluorescent signal is realized without the participation of high-fidelity DNA polymerase. The method improves the specificity of LAMP by using the probe with sequence characteristics for signal detection.

[0040] In one of the embodiments, the reaction conditions of the isothermal amplification reaction system include 64℃, 1min; and 50 cycles.

[0041] In one of the embodiments, the isothermal amplification reaction system includes the components with the concentrations shown in the following table:

[0042] 1 x Isothermo Buffer / 100 mM MgSO4 4-10 mM 10 mM dNTP 1.0-1.8 mM Bst 6-10U Primer F3 0.05-0.2 μM Primer B3 0.05-0.2 μM Primer FIP 0.8-1.6 μM Primer BIP 0.8-1.6 μM Primer LF 0.2-0.8 μM Primer LB 0.2-0.8 μM Probe 0.1-0.4 μM Template DNA / RNA 2-12 microliters [DdH2O to total volume] 25 μL

[0043] The application also provides a kit for elephant endotheliozoic herpesvirus, which includes the primer set and the probe for simultaneously detecting elephant endotheliozoic herpesvirus 1 and 5 or the detection system.

[0044] The detection system and the kit can not only be used for single detection of EEHV1 and EEHV5, but also can realize rapid, accurate, sensitive and convenient single-tube double detection of the two viruses.

[0045] The application also provides a detection method of elephant endotheliotropic herpesvirus for non-therapeutic and non-diagnostic purposes, comprising the following steps: performing isothermal amplification reaction on a sample to be tested by using the detection system or the kit, and collecting the fluorescence signal.

[0046] Compared with the prior art, the application has the following beneficial effects:

[0047] The primer group, the probe and the application for simultaneously detecting elephant endotheliotropic herpesvirus types 1 and 5 of the application can be used not only for single detection of EEHV1 and EEHV5, but also for rapid, accurate, sensitive and convenient single-tube double detection of the two viruses. The detection system, the kit and the detection method formed on the basis of the primer group and the probe can complete the synchronous detection of EEHV1 and EEHV5 with a copy number of greater than or equal to 100 per reaction within 40 minutes. The detection system relies on isothermal amplification technology and does not require complex temperature control equipment, so that single-tube detection of EEHV1 and EEHV5 can be performed, and double-virus type detection can also be achieved through single-tube reaction, which has the significant advantages of simple operation and efficient detection. The innovative design not only greatly shortens the detection period, but also guarantees the accuracy of typing through the combination of high-specificity primers and probes, and can be widely applied to the rapid identification and early epidemic prevention and control of elephant endotheliotropic herpesvirus in zoos, wildlife reserves and other scenes, thereby providing an instant molecular detection solution for health monitoring of endangered species. BRIEF DESCRIPTION OF DRAWINGS

[0048] Figure 1 Figure 1 is a comparison result graph of detection time of the primer group under the same template concentration; wherein A is the EEHV1 primer group; and B is the EEHV5 primer group;

[0049] Figure 2 Figure 2 is a schematic diagram of self-complementarity of the specific probe designed by DNAMAN analysis;

[0050] Figure 3 Figure 3 is a result graph of verification of the 3'→5' exonuclease activity of the Bst DNA polymerase;

[0051] Figure 4 Figure 4 is a comparison result graph of detection time of the probe group under the same template concentration; wherein A is the EEHV1 probe group; and B is the EEHV5 probe group;

[0052] Figure 5 Figure 5 is a comparison of isothermal amplification effects of the primer group reported in the literature and the EEHV1-s3 primer group of the application; wherein A is a comparison and analysis of dye detection results; and B is a comparison and analysis of probe detection results;

[0053] Figure 6 Figure 6 is a single-tube single-target sensitivity detection result graph of the EEHV1-s3 primer group and the probe.

[0054] Figure 7 Figure 2 is a single tube single target sensitivity detection result diagram of EEHV5-s3 primer group, probe;

[0055] Figure 8 Figure 3 is a single tube double target isothermal amplification method sensitivity detection result diagram of EEHV5-s3 primer group, probe; wherein, the upper graph is EEHV1, and the lower graph is EEHV5. DETAILED DESCRIPTION

[0056] In order to facilitate the understanding of the present application, the present application will be described more fully below with reference to the accompanying drawings. The preferred embodiments of the present application are shown in the drawings. However, the present application can be realized in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided so that the disclosure of the present application can be more thoroughly and completely understood.

[0057] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terminology used in the description of the application herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.

[0058] The reagents, materials and equipment used in the present embodiment are commercially available unless otherwise specified. The test methods are conventional test methods in the art unless otherwise specified.

[0059] Example 1

[0060] Design and optimization of LAMP primer group.

[0061] 1.1 LAMP primer design.

[0062] Download the sequence containing u38 gene in NCBI, perform sequence consistency comparison, according to the u38 gene sequence of EEHV virus reported on NCBI (EEHV1, GenBank: MW015025.1, nt: 92552-93037; EEHV5, GenBank: NC_024696.1, nt: 86742-86961), 3 sets of LAMP primers are designed for EEHV1 and 3 sets of LAMP primers are designed for EEHV5 by using LAMP primer design software. The primer sequences (5'-3') are as shown in Table 1:

[0063] Table 1. Elephant endotheliotropic herpesvirus detection primer group

[0064]

[0065]

[0066] 1.2 Screening of LAMP primers.

[0067] The primer sets designed in Example 1.1 were optimized, in which EEHV1 included 3 sets of newly designed primers, and EEHV5 included 3 sets of newly designed primers, in the following specific ways:

[0068] The primers in Example 1.1 were synthesized by Sheng Wu, and the plasmid containing the target u38 gene (EEHV1, GenBank: MW015025.1, nt: 92552-93037; EEHV5, GenBank: NC_024696.1, nt: 86742-86961) (synthesized by Tong Gong Company) was used as a standard. The concentration was determined using a NanoDrop One concentration detector, and gradient dilution was performed to dilute the template to 10 4 copies / μL.

[0069] Taking 25 μL of isothermal amplification system as an example, 1× isothermal amplification system buffer, 8 U Bst 3.0 DNA polymerase, 6 mM MgSO4, 1.4 mM dNTP, 0.1 0. primer F3 and B3, 1.0 μ. primer FIP and BIP, 0.6 μM primer LF and LB, 0.4 mM SYTO-9, 3 μL of template, and nuclease-free water to 25 μL, the reaction program was 64°C for 1 min / 50 cycles, and the sybrgreen fluorescence signal was collected.

[0070] The detection results are shown in Figure 1 A, compared with other primer sets, the primer set EEHV1-s3 appeared the shortest time of amplification curve; from Figure 1 B, compared with other primer sets, the primer sets EEHV5-s2 and EEHV5-s3 appeared the shortest time of amplification curve; EEHV1-s3 and EEHV5-s2 and EEHV5-s3 were selected as the preferred primer sets, and the following probe screening was performed.

[0071] Example 2

[0072] Design of LAMP probe.

[0073] According to the results of the primer screening, EEHV1-s3, EEHV5-s2 and s3 primer groups are selected for probe design, between the 3' end of F2c and the 5' end of F1c or between the 3' end of B2 and the 5' end of B1; a sequence with a length of 18-30 bases, a Tm value of 50-65°C, and a GC content of 40% to 65% is selected; avoid consecutive G / C, 3' end sequence does not rich in AT; through screening, 5 primers are designed by using DNAMAN analysis, primer self-complementarity. Figure 2 It can be seen that the primer designed in the patent does not have self-complementarity or does not exceed 3 bases and is not located at the 3' end. The specific sequence is shown in Table 2. The probe is synthesized by Shenguo Bioengineering Company.

[0074] Table 2. Fluorescently labeled probe group for detection of equine endotheliotrophic herpesvirus

[0075]

[0076] Example 3

[0077] Experiments show that Bst 2.0 and Bst 3.0 have 3'→5' exonuclease activity.

[0078] It is generally believed that Bst DNA polymerase has 5'→3' DNA polymerase activity and strong strand displacement activity on DNA template, but lacks 5'→3' and 3'→5' exonuclease activity. The present patent finds that the enzyme has 3'→5' exonuclease activity through experiments, and uses this activity to cut the quenching group of the probe to realize the detection of the fluorescent signal, and develops a probe detection method for LAMP.

[0079] The specific method is as follows: taking 25 μL isothermal amplification system as an example, 1× isothermal amplification system buffer, 8U Bst 3.0 or Bst 2.0 DNA polymerase, 6mM MgSO4, 1.4mM dNTP, 0.1 μM primers F3 and B3, 1.0 μM primers FIP and BIP, 0.6 μM primer LF, 0.3 μM LB, 0.3 μM probe, 3 μL template, and nuclease-free water to 25 μL. The reaction program is 64°C for 1 min / 50 cycles, and the CY5 fluorescent signal is collected.

[0080] The control experiment additionally adds 0.15U Q5 (New England Biolabs, MA). Q5 is a thermostable high-fidelity DNA polymerase with 3'→5' exonuclease activity. Figure 3 It can be seen that without adding high-fidelity enzyme, the 3' end quenching group can also be cut to emit fluorescent signal, i.e. Bst has 3'→5' exonuclease activity, which can be used to develop a probe detection method for LAMP.

[0081] Example 4

[0082] Screening of LAMP probes.

[0083] The probe set designed in Example 2 was optimized, and the specific method was as follows: taking 25 μL isothermal amplification system as an example, 1x isothermal amplification system buffer, 8 U Bst 3.0 polymerase, 6 mM MgSO4, 1.4 mM dNTP, 0.1 μM primers F3 and B3, 1.0 μM primers FIP and BIP, 0.6 μM primer LF (or 0.3 μM primer LF and 0.3 μM probe), 0.6 μM LB primer (or 0.3 μM primer LB, 0.3 μM probe), 3 μL template, and nuclease-free water to 25 μL, the reaction program was 64 °C for 1 min / 50 cycles, and the cy5 or FAM fluorescence signal was collected.

[0084] The detection results are shown in Figure 4 As shown in A, compared with other probe sets, the EEHV1-s3 probe probe1 appeared the shortest time of amplification curve, and the EEHV1-s3 probe probe1 was selected. As shown in Figure 4 B, compared with other probe sets, the EEHV5-s3 probe probe3 appeared the shortest time of amplification curve, and the EEHV5-s3 probe probe3 was selected for subsequent double combination.

[0085] Example 5

[0086] Comparison of EEHV1 optimal primer set with primer set reported in literature.

[0087] Currently, there are reports on LAMP method for detecting EEHV1 (Takehana, Kazuya et al. “Rapid and sensitive detection of elephant endotheliotropic herpesvirus 1 (EEHV1) in blood by loop-mediated isothermal amplification (LAMP).” The Journal of veterinary medical science vol. 81, 3 (2019): 504-507. doi:10.1292 / jvms.18-0683). The EEHV1 primer set optimized in the present patent was compared with the primer set reported in the literature, which was divided into two aspects of dye detection comparison and probe comparison.

[0088] 1.1 Dye method detection comparison, as follows: 25 μL isothermal amplification system as an example, 1x isothermal amplification system buffer, 8U Bst 3.0 DNA polymerase, 6mM MgSO4, 1.4mM dNTP, 0.1 μM primers F3 and B3, 1.0 μM primers FIP and BIP, 0.6 μM primers LF and LB, 0.4mM SYTO-9, template 3 μL, nuclease-free water to 25 μL, reaction program: 64℃ 1min / 50 cycles, collect sybrgreen fluorescence signal. The detection results are shown in Figure 5 A.

[0089] 1.2 Probe method comparison, 10 4 copies per microliter as a template, compared with the probe method of the present patent. The specific method is as follows: 25 μL isothermal amplification system as an example, 1x isothermal amplification system buffer, 8U Bst 3.0 polymerase, 6mM MgSO4, 1.4mM dNTP, 0.1 μM primers F3 and B3, 1.0 μM primers FIP and BIP, 0.6 μM primers LF (or 0.3 μM primers LF and 0.3 μM probe), 0.6 μM LB primers (or 0.3 primers LB, 0.3 μM probe), template 3 μL, nuclease-free water to 25 μL, reaction program: 64℃ 1min / 50 cycles, collect CY5 fluorescence signal. The detection results are shown in Figure 5 B.

[0090] In the EEHV1 detection performance comparison experiment, the method of the present application and the isothermal amplification detection method reported in the prior art literature were tested in parallel. The primer set and method reported in the literature is a dye method, as shown in Figure 5 A, the negative control (no template control, NTC) of the isothermal amplification detection method reported in the literature has serious non-specific amplification.

[0091] In order to exclude the difference of the reaction system and determine whether the primer set is feasible, we improved the primers in the literature to our probe method system. According to the primer set LF reported in the literature, the probe was synthesized, and according to the method in the above "1.2 Probe method comparison", the comparison experiment of the probe method was carried out. As shown in Figure 5 B, the primer set in the literature still has non-specific fluorescence signal after modification according to the probe method. The NTC wells of the system of the present application do not appear amplification curve. And the Tt value of the primer set amplification of the present patent is lower than that of the reported literature, and the efficiency of the primer set of the present application is higher. Therefore, the primer set of the present application is superior to the primer set of the reported literature.

[0092] Example 6

[0093] EEHV1 optimal primer set single tube single target sensitivity detection results.

[0094] The LAMP primer set V1-s3 primer set + probe probe1 optimized by the patent was used for single-tube single-target sensitivity verification. 10-fold gradient diluted EEHV1 standard (10 4 to 10 0 copies / μL) was added to 25 μL reaction system with 3 μL template volume. The specific method is as follows: taking 25 μL isothermal amplification system as an example, 1x isothermal amplification system buffer (Xinhai gene), 8U Bst 3.0 polymerase, 6mM MgSO4, 1.4mM dNTP, 0.1 μM primers F3 and B3, 1.0 μM primers FIP and BIP, 0.3 μM primer LF, and 0.3 μM probe, 3 μL template, and nuclease-free water to 25 μL. The reaction program is 64℃ for 1 min / 50 cycles, and the Cy5 fluorescence signal is collected.

[0095] The results show that, as shown in Figure 6 the minimum detection limit: when the template concentration is ≥30 copies / reaction, it can be stably detected. The above data show that the single-target detection system based on V1-s3 primer set has a stable detection limit of 30 copies / reaction for EEHV1 under 3 μL sample volume.

[0096] Example 7

[0097] Single-tube single-target sensitivity detection results of EEHV5 optimal primer set.

[0098] The LAMP primer set V5-s3 primer set + probe probe3 optimized by the patent was used for single-tube single-target sensitivity verification. 10-fold gradient diluted EEHV5 standard (10 4 to 10 0 copies / μL) was added to 25 μL reaction system with 3 μL template volume. The specific method is as follows: taking 25 μL isothermal amplification system as an example, 1x isothermal amplification system buffer (Xinhai gene), 8U Bst 3.0 polymerase, 6mM MgSO4, 1.4mM dNTP, 0.1 μM primers F3 and B3, 1.0 μM primers FIP and BIP, 0.6 μM primers LF, 0.3 primers LB, 0.3 μM probe, 3 μL template, and nuclease-free water to 25 μL. The reaction program is 64℃ for 1 min / 50 cycles, and the FAM fluorescence signal is collected.

[0099] The results show that, as shown in Figure 7 the minimum detection limit: when the template concentration is ≥3 copies / reaction, it can be stably detected. The above data show that the single-target detection system based on V5-s3 primer set has a stable detection limit of 3 copies / reaction for EEHV5 under 3 μL sample volume.

[0100] Example 8

[0101] Sensitivity test results of the single-tube dual-target (EEHV1, EEHV5) isothermal amplification method.

[0102] The sensitivity of the single-tube dual-target (EEHV1, EEHV5) isothermal amplification method was verified using the patented optimized LAMP primer set V1-s3 primer set and EEHV1-s3 probe1; V5-s3 primer set and EEHV5-s3 probe3. The specific method is as follows: taking a 25 μL isothermal amplification system as an example, 1× isothermal amplification system buffer (Xinhai Gene), 8 U Bst 3.0 polymerase, 6 mM MgSO4, 1.4 mM dNTP, EEHV1 primer concentration (0.05 μM primers F3 and B3, 0.5 μM primers FIP and BIP, 0.15 μM primer LF and 0.15 μM probe), EEHV5 primer concentration (0.05 μM primers F3 and B3, 0.5 μM primers FIP and BIP, 0.3 μM primer LF, 0.15 μM primer LB, 0.15 μM primer LB) was used. probe), 3 μL template, and nuclease-free water to 25 μL, reaction program: 64 ° C 1 min / 50 cycles, collecting CY5 and FAM fluorescence signals.

[0103] The results are as follows Figure 8 As shown in the figure, EEHV1 10 copies / μL template can be stably detected; EEHV5 10 copies / μL template still meets the needs of simultaneous screening of two virus types in actual detection.

[0104] Example 9

[0105] Isothermal amplification method for clinical sample testing.

[0106] 200 μL of nucleic acid was extracted from 16 randomly collected serum samples from Asian elephants and 3 African elephants. The nucleic acid was then tested simultaneously with the three known Asian elephant EEHV1-positive nucleic acid samples using the dual isothermal amplification method established in this patent and the reported fluorescent quantitative polymerase chain reaction (qPCR) method. The results are shown in Table 3, demonstrating the consistency between this method and the qPCR method.

[0107] Table 3. Comparison of clinical sample detection results between dual isothermal amplification method and qPCR

[0108]

[0109] In summary, the double-target LAMP real-time fluorescent detection kit and detection method provided by the application can complete the simultaneous detection of EEHV1 and EEHV5 of greater than or equal to 100 copies per reaction within 40 minutes. The system relies on isothermal amplification technology and does not require complex temperature control equipment. The double-virus type identification is realized through a single tube reaction, which has the significant advantages of simple operation and efficient detection. The innovative design not only greatly shortens the detection period, but also ensures the accuracy of typing through the combination of high-specificity primers and probes. It can be widely used in the rapid identification and early epidemic prevention and control of elephant endotheliotrophic herpesvirus in zoos, wildlife reserves and other scenarios, and provides an instant molecular detection solution for the health monitoring of endangered species.

[0110] The technical features of the above-described embodiments can be combined in any manner. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described, but as long as the combinations of the technical features do not contradict, they should be considered as falling within the scope of the present disclosure.

[0111] The above-described embodiments only express several implementation manners of the present application, and the description is relatively specific and detailed, but it should not be understood as a limitation on the scope of the patent. It should be pointed out that for ordinary skilled persons in the art, some modifications and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application should be subject to the appended claims.

Claims

1. A primer set and probe for simultaneously detecting herpes simplex virus type 1 and 5, characterized in that: The primer set is selected from at least one of primer set 1, primer set 2, and primer set 3; The primer set 1 includes the following primer sequences: F3: GTAGGGTTCACAGATTCGT (SEQ NO.11); B3: GGTAAATCCATACACGGCA (SEQ NO. 12); FIP: CAATTTTTCCCTGACAGCTTTGCAAAACCGCATGTTAGAAAGT (SEQ NO.13); BIP: AGCATTGTAAAGATCCTCTTATGCATGCACGTTAGTTTTAGAGCC (SEQ NO.14); LF: CACGACGTTAACAGTTGCGAG(SEQ NO.15); The primer set 2 includes the following primer sequences: F3:CAGATTCTACTCGACAAACAG(SEQ NO.21); B3: GGCGATATGTCAACTAGAAAGT (SEQ NO. 22); FIP: ACGGAAACATGCCTCTGGAAAGCCCTGAAACTTACGTGTA (SEQ NO. 23); BIP: TATAGCTGAATCGGTTACCGCCCCAATCGTTAAATCTGTCACAT (SEQ NO. 24); LF: ACCGGTAAATCCATATACAGCGT(SEQ NO.25); LB: GGAAGACAGTTGCTAGCCAC (SEQ NO. 26); The primer set 3 includes the following primer sequences: F3:GGATGATGACGTTACGACT(SEQ NO.27); B3: GGTAAATCCATATACAGCGTTAC (SEQ NO. 28); FIP: CCAGGATGTAAGAAGTTGAGAGAGAGTTACGACTAACACGGGAA (SEQ NO. 29); BIP: AAGCCGTGAGAGAAAAGTTAAAACATAAGTTTCAGGGCAAGCT (SEQ NO. 30); LF: GAGGTTTTACAAACCTGTGCTTC (SEQ NO. 31); LB: TGTAGTGACCCTTTGATGCAGA (SEQ NO. 32); The probe is selected from at least one of probe 1, probe 2, probe 3, probe 4, and probe 5; The sequence of the probe 1 includes: CACGACGTTAACAGTTGCGA (SEQ NO. 33); The sequence of the probe 2 includes: CAGCCACGACGTTAACAG (SEQ NO. 34); The sequence of the probe 3 includes: ACCGGTAAATCCATATACAGCGT (SEQ NO. 35); The sequence of the probe 4 includes: GGAAGACAGTTGCTAGCCAC (SEQ NO. 36); The sequence of the probe 5 includes: TGTAGTGACCCTTTGATGCAGA (SEQ NO. 37).

2. The method of claim 1, wherein the primer set and probe for simultaneous detection of herpes simplex virus type 1 and type 5 are characterized in that: The primer sets are primer set 1 and primer set 3, and the probes are probe 1 and probe 5.

3. The primer set and probe for simultaneous detection of herpes simplex virus type 1 and type 5 according to any one of claims 1-2, characterized in that: The 3' end of the probe is modified with a fluorescent group, and the 5' end of the probe is modified with a quenching group.

4. Use of the primer set and probe for simultaneously detecting herpes simplex virus type 1 and 5 according to any one of claims 1-3 in a kit for detecting herpes simplex virus type 1, wherein the herpes simplex virus type 1 and 5 comprises herpes simplex virus type 5.

5. A detection system for endothelial herpes simplex virus, characterized in that: The isothermal amplification reaction system comprises a primer set and a probe for simultaneously detecting endothelial herpes virus types 1 and 5 according to any one of claims 1 to 3.

6. The monitoring system according to claim 5, characterized in that: The herpes simplex virus includes herpes simplex virus type 1 and / or type 5.

7. The detection system according to claim 5, characterized in that The isothermal amplification reaction system also includes BstDNA polymerase.

8. The detection system according to claim 5, characterized in that The reaction conditions of the isothermal amplification reaction system include: 64° C., 1 min; and 50 cycles.

9. A kit for use with endothelial herpes simplex virus, characterized in that: The kit comprises the primer set and probe for simultaneously detecting endothelial herpesvirus types 1 and 5 according to any one of claims 1-3 or the detection system according to any one of claims 5-8.

10. A method for detecting endothelial herpes simplex virus for non-therapeutic and non-diagnostic purposes, characterized in that: The following steps are involved: The detection system according to any one of claims 5 to 8 or the kit according to claim 9 is used to perform an isothermal amplification reaction on the sample to be tested, and the fluorescent signal is collected.

Images