Molecular marker of brassica napus salt-tolerant gene and application

Abstract

The invention discloses a molecular marker of a brassica napus salt-tolerant gene BnaA07.GRP3 and application of the molecular marker, and belongs to the technical field of rape breeding. According to the invention, two haplotypes hap0 and hap1 of the salt-tolerant gene BnaA07. GRP3 are found for the first time, a corresponding molecular marker is provided for the optimal haplotype hap1 of the BnaA07. GRP3, and the optimal haplotype hap1 of the BnaA07. GRP3 is specifically amplified, so that the salt-tolerant material of the brassica napus is identified. The salt-resistant material of the brassica napus can be quickly and accurately identified, and the repeatability is good. The method is applied to auxiliary selective breeding of salt-resistant characters of the brassica napus, the breeding efficiency of the salt-resistant brassica napus can be greatly improved, the selection range of salt-resistant materials is expanded, the method has huge application potential and prospects, and an ideal way is provided for cultivating the salt-resistant brassica napus.

Description

Technical Field

[0001] The invention belongs to the technical field of rapeseed breeding, and particularly relates to a molecular marker of a salt-tolerance gene of Brassica napus and an application thereof. Background Art

[0002] Soil salinization is one of the major factors limiting crop production. China's saline soils are vast, widely distributed, and diverse in types. Nearly 100 million hectares of saline-alkali land resources are experiencing an overall deterioration and increasing area. Approximately 1 / 300 million hectares of saline-alkali land have potential for development and utilization. Physical, chemical, and biological methods are commonly used to improve saline-alkali land. Among these, biological measures, primarily revegetation, are widely considered the most cost-effective amelioration approach.

[0003] Rapeseed is my country's largest oilseed crop, boasting multifunctional applications. Besides its traditional uses as oil and rapeseed cake for feed and fertilizer, fresh rapeseed can also be used as feed, fertilizer, vegetable (rapeseed stalks), honey, and tourism during its flowering period. Practice has demonstrated that rapeseed has a high tolerance for salinity and alkali. Rapeseed bioremediation has been successful in coastal saline-alkali land dominated by sodium chloride, inland saline-alkali land dominated by sodium sulfate and sodium carbonate, and even in soda saline-alkali land dominated by sodium carbonate and sodium bicarbonate, which are generally considered the most difficult to improve.

[0004] Marker-assisted selection (MAS) involves analyzing the genotypes of molecular markers closely linked to target genes and using these markers to select for genotypes that align with target traits. This approach can shorten breeding cycles, accelerate the breeding process, and improve breeding efficiency. The development of new molecular markers has significantly improved crop stress tolerance, yield, and quality. However, there are currently few reports on the development of molecular markers for salt tolerance in Brassica napus. Furthermore, identifying salt tolerance in Brassica napus is complex and labor-intensive. Summary of the Invention

[0005] The purpose of the present invention is to provide a molecular marker of a salt-tolerance gene of Brassica napus and application thereof.

[0006] This study, published in the journal Nature Communications, discovered for the first time that two haplotypes, hap0 and hap1, in the BnaA07.GRP3 gene of Brassica napus, can enhance salt tolerance. Haplotype hap1 is the optimal haplotype. Based on resequencing data and sequence alignment, a specific molecular marker combination for hap1 was developed. This molecular marker combination can be used to rapidly and accurately identify salt-tolerant rapeseed materials, laying the foundation for marker-assisted selection of salt-tolerance genes and providing an ideal approach for breeding new salt-resistant Brassica napus varieties.

[0007] To achieve the above object, the technical solution adopted by the present invention is:

[0008] In a first aspect, the present invention provides an Indels molecular marker site for controlling the salt stress tolerance of Brassica napus; the site is located on chromosome 07 of the Brassica napus genome, at position 6281556 of the BnaA07.GRP3 gene, and the allele is G / TTCTATAA.

[0009] In a second aspect, the present invention provides primer pairs for identifying the aforementioned indels molecular marker sites; the nucleotide sequence information of the primer pairs is shown in Table 1. In all Brassica napus plants, if the primers amplify a given band, the hap1 haplotype is considered to be present; otherwise, the hap1 haplotype is considered to be absent.

[0010] BnaA07.GRP3_hap1-F(SEQ ID NO.12) CGGGTACGTAAAATTAGTATTCTATAATCT BnaA07.GRP3_hap1-R(SEQ ID NO.13) CGGAAGGAGTAGATAACAACATCATAG

[0011] Table 1 Primer information of Indels molecular marker sites

[0012] Furthermore, the plant includes a plant of the genus Brassica in the family Cruciferae.

[0013] Furthermore, the plant includes Brassica napus.

[0014] In a third aspect, the present invention provides the use of the above-mentioned Indels molecular marker sites in the breeding of salt-stress-tolerant Brassica napus.

[0015] In a fourth aspect, the present invention provides a salt-tolerant hap1 haplotype of Brassica napus, comprising the Brassica napus gene BnaA07.GRP3 shown in SEQ ID NO.1, with a length of 2498 bp; the CDS sequence of the Brassica napus gene BnaA07.GRP3 is shown in SEQ ID NO.2, with a length of 372 bp.

[0016] The present invention also provides a Brassica napus salt-tolerant hap0 haplotype, which comprises the Brassica napus gene BnaA07.GRP3 shown in SEQ ID NO.3, with a length of 2491 bp; the CDS sequence of the Brassica napus gene BnaA07.GRP3 is shown in SEQ ID NO.4, with a length of 372 bp.

[0017] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0018] The present invention, based on the initial screening of a large number of loci obtained through resequencing of 164 Brassica napus germplasm samples, has identified a single indel molecular marker associated with salt tolerance in Brassica napus. This allows for rapid and accurate identification of salt-tolerant Brassica napus materials, making genotyping more efficient, stable, accurate, and cost-effective. Based on this indel molecular marker, it can be used for constructing a DNA fingerprint database for Brassica napus, analyzing the genetic diversity of Brassica napus germplasm resources, molecular marker-assisted breeding of Brassica napus, and cultivar purity identification. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0020] Figure 1 : Gel image of the hap0 sequence of the BnaA07.GRP3 gene haplotype cloned in Brassica napus cDNA. Explanation of the reference symbols: DNA marker band sizes (from top to bottom: 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 100 bp).

[0021] Figure 2 Gel images of positive PCR test results and expression level identification of transgenic material. A, positive identification; B, expression level identification. Explanation of the reference symbols: Lane M in A represents the marker (from top to bottom: 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 100 bp).

[0022] Figure 3 Phenotypes of wild-type and hap0-overexpressing accessions under salt stress in soil culture. A, Phenotypes of wild-type and hap0-overexpressing accessions before and after salt stress treatment; B, Fresh weight of wild-type and hap0-overexpressing accessions before and after salt stress treatment; C, Plant height of wild-type and hap0-overexpressing accessions before and after salt stress treatment. Scale bars in phenotypic diagrams are 5 cm.

[0023] Figure 4 :Sequence differences between haplotype hap0 and haplotype hap1 of BnaA07.GRP3 gene.

[0024] Figure 5 : Differences of different haplotypes in SL, SFW and SNC under salt stress.

[0025] Figure 6 Agarose gel electrophoresis analysis of the hap1-specific molecular markers after PCR amplification. Figure 1: M represents a DNA marker (sizes from top to bottom: 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 100 bp); "+" represents a positive control, i.e., a recombinant plasmid; "-" represents a negative control; and "H2O" represents a no-template control. DETAILED DESCRIPTION

[0026] The embodiments of the technical solution of the present invention will be described in detail below with reference to the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present invention and are therefore only used as examples and cannot be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise specified, the technical terms or scientific terms used in this application should be the common meanings understood by those skilled in the art to which the present invention belongs. As a professional agricultural research institution, the applicant has long-term preservation of relevant germplasm materials, and the relevant rapeseed varieties are all publicly available on the market or in existing germplasm banks.

[0027] Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

[0028] Example 1 Cloning of BnaA07.GRP3 gene and construction of overexpression vector

[0029] 1. RNA Extraction and cDNA Preparation

[0030] Westar seedlings germinated for 7 days in liquid nitrogen and saline were collected. Three individual plants were used as biological replicates. RNA was extracted using a kit (Promega), and cDNA was synthesized using 3 μg of RNA as a template (Thermo Fisher). Each cDNA was diluted to 500 μL and stored at -20°C until use.

[0031] 2. Using cDNA as template and pCAMBIA1305 vector plasmid as backbone, PCR amplification was performed using the following primers to construct the BnaA07.GRP3 overexpression vector pCAMBIA1305-BnaA7.GRP3:

[0032] pCAMBIA1305-BnaA7.GRP3-F:gagctcggtacccggggatccATGGCTTCAAAGACTTTGATTATGC; (SEQ ID NO.5)

[0033] pCAMBIA1305-BnaA7.GRP3-R: cttgcatgcctgcaggtcgacGTTGCCAGGCTGAGTCTGAACA (SEQ ID NO. 6).

[0034] PCR reaction conditions were: 95°C for 3 minutes, followed by 34 cycles of 95°C for 30 seconds, 56°C for 30 seconds, and 72°C for 15 seconds; followed by extension at 72°C for 5 minutes. The PCR product was recovered using a purification and recovery kit (Tiangen) and ligated into the pCAMBIA1305 vector using homologous recombination (homologous recombination enzyme purchased from Novezan) at 37°C for 30 minutes. pCAMBIA1305, which has restriction enzymes F: BamHI and R: SalI, was digested with Thermo Fisher restriction enzymes in a 37°C waterbath and purified using a purification and recovery kit (Tiangen).

[0035] 3. The recombinant plasmid was transformed into DH5α (Qingke Biotechnology) by heat shock transformation. After 10-12 hours, single clones were picked for PCR positive detection and sent to Qingke Biotechnology for sequencing. The sequencing primers are as follows:

[0036] pCAMBIA1305-BnaA07.GRP3-F:

[0037] gagctcggtacccggggatccATGGCTTCAAAGACTTTGATTATGC(SEQ ID NO.5)

[0038] 1305-R: GCTGGTGACCTCACTTATCGTCATC(SEQ ID NO.7)

[0039] The sequencing results were aligned with the Westar reference genome, and the coding sequence was shown as SEQ ID NO. 4. The correctly aligned recombinant plasmid was transformed into Agrobacterium tumefaciens and stored at -80°C.

[0040] Example 2 Transformation of BnaA07.GRP3 gene and screening and identification of positive plants

[0041] The test material was Brassica napus Westar.

[0042] The specific steps are as follows:

[0043] 1. Brassica napus seeds were sterilized with 0.1% mercuric chloride solution for 10-12 minutes. The seeds were then rinsed 3-4 times with sterile water and sown in M0 medium for dark culture for 7 days.

[0044] 2. On the evening of day 6, remove Agrobacterium GV3101 containing pCAMBIA1305-BnaA7.GRP3 from a -80°C freezer and inoculate into 50 mL of LB medium containing kanamycin and gentamicin. Incubate overnight at 28°C in a shaker at 200 rpm. Collect colonies and resuspend in acetosyringone (AS).

[0045] 3. Cut the hypocotyls of dark-cultured Brassica napus into small segments of 0.5-1 cm and infect them with suspended Agrobacterium for 10 minutes.

[0046] 4. Place the infected hypocotyls into M1 medium (specific ingredients are described later) and culture in the dark for 24 hours.

[0047] 5. After co-cultivation, the cells were inoculated into M2 medium (specific components are described below) and cultured in a light culture room (16 hours of light, 8 hours of darkness, temperature 22°C).

[0048] 6. After 2 weeks, the cells were inoculated into M3 medium (specific components are described below) and cultured in a light culture room (16 hours light, 8 hours dark, temperature 22°C).

[0049] 7. The redifferentiated tissue culture seedlings are inoculated into M4 medium (specific components are described later) until complete plants are obtained.

[0050] 8. Transplant the rooted plants into pots and extract DNA for positive identification.

[0051] 9. Extract RNA from positive plants and perform qRT-PCR to detect relative expression levels. The target fragment is the BnaA07.GRP3 gene fragment shown in SEQ ID NO.1 or SEQ ID NO.2.

[0052] Qpcr-A7-F: GGAAATGAAGGTTACAACGGAC (SEQ ID NO.8)

[0053] Qpcr-A7-R:GTTATATCCTCCACCTCCCTTG(SEQ ID NO.9)

[0054] and primer BnaActin-F: CTATCCTCCGTCTCGATCTCGC (SEQ ID NO.10)

[0055] BnaActin-R: CTTAGCCGTCTCCAGCTCTTGC (SEQ ID NO.11)

[0056] It was used as an internal reference primer for relative quantitative analysis.

[0057] The results are as follows Figure 2 As shown in B, the BnaA07.GRP3 gene was successfully overexpressed in the positive plants.

[0058] The culture medium formula used in this example

[0059] LB medium: Trypone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L.

[0060] M0 medium: MS 2.2 g / L, sucrose 15 g / L, agar powder 6 g / L, adjust pH to 5.9-6.0.

[0061] M1 medium: MS 4.4 g / L, sucrose 30 g / L, mannitol 18 g / L, 2,4-D 1000 μL / L, KT 1000 μL / L, agar powder 6 g / L, adjust pH to 5.9-6.0. After sterilization, add AS and aliquot for later use.

[0062] M2 medium: MS 4.4 g / L, sucrose 30 g / L, mannitol 18 g / L, 2,4-D 1000 μL / L, KT 1000 μL / L, agar powder 6 g / L, adjust pH to 5.9-6.0. After sterilization, add TMT, kanamycin, and STS and aliquot for later use.

[0063] M3 medium: MS 4.4 g / L, glucose 10 g / L, xylose 0.25 g / L, MES 0.6 g / L, agar powder 6 g / L, adjust pH to 5.9-6.0. After sterilization, add TMT, trans-zeatin, kanamycin, and auxin and aliquot for later use.

[0064] M4 medium: MS 4.4 g / L, sucrose 10 g / L, agar powder 6 g / L, adjust pH to 5.9-6.0. After sterilization, add kanamycin and aliquot for later use.

[0065] The basic MS medium formula described in the above medium formula is: macroelements (KNO31.9g / L, NH4NO31.65g / L, KH2PO4 0.17g / L, MgSO4﹒7H2O 0.37g / L, CaCl2﹒2H2O 0.44g / L), trace elements (KI0.83mg / L, H3BO3 6.2mg / L, MnSO4﹒4H2O 22.3mg / L, ZnSO4﹒7H2O 8.6mg / L, Na2MoO4﹒2H2O0.25mg / L, CuSO4﹒5H2O 0.025mg / L, CoCl2 0.025mg / L), iron salts (Na2﹒EDTA 37.3mg / L, FeSO4﹒7H2O 27.8mg / L), organic components (inositol 100mg / L, Gly 2mg / L, VB 10.1mg / L, VB 60.5mg / L, VB50.5mg / L).

[0066] Example 3 Functional verification of the BnaA7.GRP3 gene

[0067] 1. After the WT, OE#1 and OE#2 rapeseed lines were cultured hydroponically to the two-true-leaf stage, they were transplanted into soil.

[0068] 2. After acclimatization, 500 mM NaCl was applied for stress treatment.

[0069] 3. After 4 weeks, the WT, OE#1 and OE#2 rapeseed plants were removed from the soil, photographed and counted.

[0070] Example 4 Haplotype Analysis of the BnaA7.GRP3 Gene in 164 Germplasm Resources

[0071] Based on the functional verification performed in Example 3, this example further utilized the publicly available resequencing data to perform haplotype analysis on BnaA07.GRP3 in 164 rapeseed germplasm resources. Combining gene cloning and comparative sequencing, two BnaA7.GRP3 haplotypes, hap0 and hap1, were identified in the 164 rapeseed germplasm resources, of which hap0 had 156 haplotypes.

[0072] There are 8 materials for haplotype hap0 and hap1. Figure 4 shown.

[0073] Example 5 Differences in SL, SFW and SNC between different haplotypes under salt stress

[0074] Furthermore, combined with the phenotypic data of aboveground length (SL), aboveground fresh weight (SFW) and aboveground ion content (SNC) of 164 rapeseed germplasm resources under salt stress in this application, the differences in SL, SFW and SNC between different haplotypes hap0 and hap1 under salt stress were analyzed. Figure 5 shown.

[0075] Example 6 Development and Identification of Specific Molecular Markers

[0076] Furthermore, combining the publicly available resequencing data with gene cloning and comparative sequencing, molecular markers for the dominant haplotype hap1 were developed and validated. The details are as follows:

[0077] The DNA of the leaves of the 164 rapeseed materials mentioned above was extracted using the CTAB method.

[0078] 1. Take 1 cm2 of young leaves from each plant and place them in a 2 ml centrifuge tube. Add steel balls and 250 μL of 2% CTAB. Grind on a grinder for 5 minutes. Then add 500 μL of CTAB to the centrifuge tube.

[0079] 2. Place the plant tissue homogenate in the centrifuge tube into a centrifuge tube box, then place it in a 65°C water bath for 60 minutes, shaking every 15 minutes;

[0080] 3. After cooling to room temperature, add a 24:1 volume ratio of chloroform to isoamyl alcohol mixture to the centrifuge tube, gently invert and mix for 15 minutes, and then centrifuge at 12000 rpm for 10 minutes.

[0081] 4. Place the centrifuged tubes on the operating plate in order, and aspirate the supernatant into a new 1.5mL centrifuge tube, with a volume of 500μL;

[0082] 5. Add 50 μL of KAc solution to the supernatant, then add 500 μL of ice-cold ethanol, cover the centrifuge tube, shake gently a few times to mix the ice-cold ethanol and supernatant thoroughly, and then place in a -20°C refrigerator for 20-30 minutes to allow the genomic DNA to precipitate;

[0083] 6. Centrifuge the tube at 12,000 rpm for 6 minutes, discard the supernatant, add 500 μL of 75% ethanol, let it stand for another 5 minutes, and discard the supernatant (sometimes centrifuge for 2 minutes and then discard the supernatant). Repeat this process once. The precipitate is genomic DNA.

[0084] 7. Invert the centrifuge tube containing the DNA and air dry it in a fume hood to obtain the genomic DNA of each plant.

[0085] 8. Add 200 μL ddH2O to the dried centrifuge tube containing DNA to dissolve the DNA. After dissolution, store at -20℃.

[0086] 9. Use

[0087] PCR amplification was performed using primers BnaA07.GRP3_hap1-F CGGGTACGTAAAATTAGTATTCTATAATCT (SEQ ID NO. 12) and BnaA07.GRP3_hap1-R CGGAAGGAGTAGATAACAACATCATAG (SEQ ID NO. 13) and genomic DNA from 164 rapeseed germplasm samples extracted using the CTAB method as template. PCR amplification was performed in a 25 μL reaction system, and each reaction system specifically included:

[0088]

[0089] After mixing all the substances, they were covered with mineral oil. The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 34 cycles; extension at 72°C for 5 min; and finally storage at 4°C.

[0090] 10. After PCR amplification is completed, all amplified products to be tested are electrophoresed on a 1.5% agarose gel, stained with EB (ethidium bromide), and imaged under ultraviolet light to obtain the genotype information of the sample to be tested. Figure 6 shown.

[0091] The test results show that only 8 accessions with the hap1 marker amplified a band of approximately 205 bp, while no band was amplified in 156 accessions with the hap0 marker. This identifies the hap1 haplotype. Therefore, this molecular marker can be used to rapidly and accurately identify salt-tolerant accessions in Brassica napus with high reproducibility. Its application in assisted selection breeding for salt tolerance in Brassica napus could significantly improve the efficiency of salt-tolerant rapeseed and expand the range of salt-tolerant options. It has enormous potential and prospects, providing an ideal approach for breeding salt-resistant Brassica napus.

[0092] The above description is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily thought of by any technician familiar with this technical field within the technical scope disclosed by the present invention should be covered by the scope of protection of the present invention.

[0093] SEQ ID NO.1 (2498 bp)

[0094]

[0095] SEQ ID NO.2(372bp)

[0096] ATGGCTTCAAAGACTTTGATTATGCTAGGTGTCTTTGCAATTCTTTTCGTTGTGTCAGAAATGGCCGCAGCATCTGCACAGAAGTCGGAGAGTGAGGAAACTGTGCAACCTGATCGATATGGTGGTGGCCATGGCGGAAATGAAGGTTACAACGGACGAGGAGGATATAACAGAGGAGGACACAACGGAGGTGGAGGATACAAGGGAGGTGGAGGATATAACGGGGGAGGAGGATACAACGGCGGTGGAGGATACAACGGAGGAAGAGGTGGACGATACAAGGGAGGAAGAGGAGGCCACGGGGGACACGGAGGAAGAGGAGGCCACGGCGGACACGGTCCAGAAGCTGTTCAGACTCAGCCTGGCAACTAA

[0097] SEQ ID NO.3(2491bp)

[0098]

[0099] SEQ ID NO.4(372bp)

[0100] ATGGCTTCAAAGACTTTGATTATGCTGGGTGTCTTTGCAATTCTTCTCGTTGTGTCAGAAATGGCCGCAGCATCTGCACAGAAGTCGGAGAGTGAGGAAACTGTGCAACCTGATCGATATGGTGGTGGCCATGGCGGAAATGAAGGTTACAACGGACGAGGAGGATATAACAGAGGAGGACACAACGGAGGTGGAGGATACAAGGGAGGTGGAGGATATAACGGGGGAGGAGGATACAACGGCAGTGGAGGATACAACGGAGGAAGAGGTGGACGATACAAGGGAGGAAGAGGAGGCCACGGGGGACACGGAGGAAGAGGAGGCCACGGCGGACACGGTCCAGAAGCTGTTCAGACTCAGCCTGGCAACTAA

[0101] pCAMBIA1305-BnaA7.GRP3-F:

[0102] gagctcggtacccggggatccATGGCTTCAAAGACTTTGATTATGC(SEQ ID NO.5)

[0103] pCAMBIA1305-BnaA7.GRP3-R:cttgcatgcctgcaggtcgacGTTGCCAGGCTGAGTCTGAACA(SEQ ID NO.6)

[0104] 1305-R:GCTGGTGACCTCACTTATCGTCATC(SEQ ID NO.7)

[0105] Qpcr-A7-F:GGAAATGAAGGTTACAACGGAC(SEQ ID NO.8)

[0106] Qpcr-A7-R:GTTATATCCTCCACCTCCCTTG(SEQ ID NO.9)

[0107] BnaActin-F:CTATCCTCCGTCTCGATCTCGC(SEQ ID NO.10)

[0108] BnaActin-R:CTTAGCCGTCTCCAGCTCTTGC(SEQ ID NO.11)

[0109] BnaA07.GRP3_hap1-F:CGGGTACGTAAAATTAGTATTCTATAATCT(SEQ ID NO.12)

[0110] BnaA07.GRP3_hap1R:CGGAAGGAGTAGATAACAACATCATAG(SEQ ID NO.13)。

Claims

1. A molecular marker for the salt-tolerance gene BnaA07.GRP3 in Brassica napus, characterized in that: The molecular marker is located on chromosome 07 of the Brassica napus genome and at position 6281556 of the BnaA07.GRP3 gene.

2. The molecular marker according to claim 1, wherein The allele sequence of the molecular marker is G / TTCTATAA.

3. The use of the molecular marker according to claim 1 or 2 in genetic breeding of Brassica napus, characterized in that: Used to cultivate salt-tolerant varieties of Brassica napus.

4. The use according to claim 3, characterized in that The salt-tolerant varieties of Brassica napus include haplotype Hap0 and haplotype Hap1.

5. The use according to claim 4, characterized in that The haplotype Hap1 comprises the Brassica napus gene BnaA07.GRP3 as shown in SEQ ID NO.1; the CDS sequence of the Brassica napus gene BnaA07.GRP3 is shown in SEQ ID NO.

2.

6. The use according to claim 4, characterized in that The haplotype Hap0 comprises the Brassica napus gene BnaA07.GRP3 as shown in SEQ ID NO.3; the CDS sequence of the Brassica napus gene BnaA07.GRP3 is shown in SEQ ID NO.

4.

7. A primer pair for detecting haplotype Hap1 of salt-tolerant varieties of Brassica napus, characterized in that: The sequences of the primer pairs are: BnaA07.GRP3_hap1-F CGGGTACGTAAAATTAGTATTCTATAATCT BnaA07.GRP3_hap1-RCGGAAGGAGTAGATAACAACATCATAG.

Images