A rare earth binding protein and uses thereof
By developing rare earth binding proteins, the problems of high energy consumption and serious pollution in existing rare earth element extraction and separation processes have been solved, achieving efficient rare earth element recovery and fine separation, especially the separation of light, medium, and heavy rare earth elements and adjacent rare earth elements, thus improving separation efficiency and purity.
Patent Information
- Application Number
- CN202511375628.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-25
- Publication Date
- 2026-02-03
- Estimated Expiration
- 2045-09-25
AI Technical Summary
Existing rare earth element extraction and separation processes are energy-intensive and polluting, and cannot efficiently separate adjacent rare earth elements. Existing rare earth protein affinity materials bind a small number of rare earth ions, resulting in low separation efficiency.
Develop rare earth binding proteins, including proteins with specific amino acid sequences or similar structures, and recover, separate and purify rare earth elements through solid-liquid extraction processes. Improve the protein by using amino acid sequences such as SEQ ID NO.2 or proteins with more than 80% sequence identity, and by using linkers, purified sequences, etc.
It achieves efficient recovery and fine separation of rare earth elements, can separate rare earth elements from non-rare earth elements, and can separate light, medium and heavy rare earth elements as well as adjacent rare earth element pairs, thus improving separation efficiency and purity.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This application belongs to the field of biotechnology, specifically relating to a rare earth binding protein and its uses. Background Technology
[0002] Rare earth elements (REEs), including the lanthanides, yttrium, and scandium, are crucial for the transition from the fossil fuel era to a low-carbon era. The U.S. Department of Energy has specifically highlighted the criticality and supply shortage of five REEs (Tb, Dy, Eu, Nd, and Y) for clean energy technologies such as electric vehicles, wind turbines, and LEDs. However, current REE extraction and separation processes consume significant amounts of energy and cause severe environmental pollution, hindering the development of a diversified REE supply chain and diminishing the environmental benefits of clean energy technologies. Therefore, to meet the demand for REEs in emerging clean energy technology markets, new processing methods must be developed to extract REEs from rare earth mines in an environmentally friendly manner.
[0003] Incorporating bioligands into solid-liquid extraction processes offers potential for developing novel chemical methods and environmentally sustainable rare earth separation processes. For example, lanthanide-binding tags (LBTs), short peptides with affinity and selectivity for rare earth elements, have been exhibited on the surfaces of biomaterials (cells, coiled fibers, etc.) and used in solid-liquid extraction for the selective recovery of neutralized heavy rare earth elements from various feedstock leachates. However, LBTs exhibit limited affinity for Cu... 2+ The selectivity of rare earth elements is low, and the binding of rare earth elements is negligible when the pH value is below 5, which limits the raw material compatibility of LBT.
[0004] Current methods for fine separation of rare earth elements rely on cascade extraction technology, which involves organic solvents, phosphorus ligands, and strong acids. This process is complex and constitutes a highly polluting, energy-intensive industry. Furthermore, it suffers from low separation efficiency and limited binding sites (existing rare earth protein affinity materials can bind at most fewer than four rare earth ions, and sometimes only one). In addition, current technologies cannot directly separate adjacent rare earth elements in a single step.
[0005] Therefore, providing a method to solve the difficulty of fine separation of rare earth elements is of great practical significance. Summary of the Invention
[0006] The purpose of this application is to provide a rare earth-binding protein and its uses.
[0007] Specifically, this application relates to the following aspects:
[0008] A rare earth-binding protein, comprising or composed of any one of the following proteins:
[0009] (I) A protein with the amino acid sequence shown in SEQ ID NO.2;
[0010] (II) Proteins with structures similar to (I);
[0011] (III) Proteins obtained by adding a linker, a sequence for purification, a sequence for cutting, a sequence for solubilization, or a sequence for immobilization to (I) or (II);
[0012] (IV) Proteins that have 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more sequence identity with (I), (II), or (III).
[0013] Optionally, a protein that is structurally similar to (I) is a protein whose structural similarity score to (I) is greater than 400 and whose E value is less than 1e-8, as calculated by a protein structural similarity analysis platform.
[0014] Optionally, the protein structure similarity analysis platform is Foldseek.
[0015] Optionally, T proteins with structures similar to (I) m Temperature greater than 95℃.
[0016] Optionally, the amino acid sequence of the rare earth binding protein is as shown in any one of SEQ ID NO.2, 4, 5-12, 20-33, or has 80%, 85%, 90%, 95%, 96%, 97%, 98% or more sequence identity with any one of SEQ ID NO.2, 4, 5-12, 20-33.
[0017] The use of any of the above-mentioned rare earth binding proteins in the recovery, and / or separation, and / or purification of rare earth elements.
[0018] Optionally, the rare earth element is selected from one or more of lanthanum, cerium, praseodymium, neodymium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, lutetium, and yttrium.
[0019] Optionally, the separation refers to the separation between any two rare earth elements.
[0020] A method for recovering, and / or separating, and / or purifying rare earth elements, comprising treating the rare earth elements with any of the aforementioned rare earth binding proteins.
[0021] Optionally, the rare earth element is selected from one or more of lanthanum, cerium, praseodymium, neodymium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, lutetium, and yttrium.
[0022] Optionally, the separation refers to the separation between any two rare earth elements.
[0023] The rare earth binding protein of this application exhibits a significant affinity for rare earth elements (REEs), and this affinity varies significantly among different REEs. Therefore, the rare earth binding protein of this application can not only separate rare earth elements from non-rare earth elements, but also separate light (lanthanum, cerium, praseodymium, neodymium), medium (samarium, europium, gadolinium, terbium, dysprosium), and heavy (holmium, erbium, thulium, ytterbium, lutetium, yttrium) rare earth elements, as well as adjacent rare earth pairs (europium, gadolinium; dysprosium, holmium; holmium, erbium; erbium, thulium; thulium, ytterbium, etc.), showing promising application prospects in the fine separation of rare earth elements. Attached Figure Description
[0024] Figure 1 The flow-through curves show the rare earth concentrations corresponding to the flow-through of each column volume.
[0025] Figure 2 The adsorption capacity of MIF-agarose and H10MIF-agarose microsphere packed columns was demonstrated;
[0026] Figure 3 Displays column efficiency test results;
[0027] Figure 4 The results show the recovery of rare earth elements from non-rare earth elements;
[0028] Figure 5 The results of ICP-OES for direct separation of various rare earth elements are shown.
[0029] Figure 6 This displays the ICP-OES or ICP-MS results of each fraction in the experiment of preparing rare earth elements with high purity (>99.99%).
[0030] Figure 7 Showing SF_1.5 and SF_max of rare earth binding proteins;
[0031] Figure 8 T showing rare earth-binding protein m The curve showing the relationship between the curve and the score. Detailed Implementation
[0032] The present application is further illustrated below with reference to embodiments. It should be understood that the embodiments are only used to further illustrate and explain the present application and are not intended to limit the present application.
[0033] Unless otherwise defined, technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art. While similar or identical methods and materials may be applied in experimental or practical applications, materials and methods are described herein. In case of conflict, the definitions included herein shall prevail. Furthermore, materials, methods, and examples are for illustrative purposes only and are not intended to be limiting. The present application is further described below with reference to specific embodiments, but is not intended to limit the scope of the application.
[0034] definition
[0035] As used in this article, "rare earth binding protein" refers to a class of proteins that can bind rare earth elements. Based on their ability to bind rare earth elements, rare earth binding proteins can be used to recover, and / or separate, and / or purify rare earth elements.
[0036] As used herein, the terms “gene,” “polynucleotide,” “nucleotide sequence,” and “nucleic acid molecule” are used interchangeably. They refer to a polymer of nucleotides of any length, which may be deoxyribonucleotides or ribonucleotides, or analogs thereof. The nucleic acid molecule may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule may also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.
[0037] As used herein, the percentage of "identity," such as 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%, refers to the degree of similarity between amino acid sequences or nucleotide sequences determined by sequence alignment, and is 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%. For example, it is the percentage of positions with identical bases or amino acid residues determined out of the total number of positions after two sequences have as many identical residues as possible by introducing vacancies, etc. The percentage of "identity" can be determined using software programs known in the art. It is preferred to use default parameters for alignment. A preferred alignment program is BLAST. Preferred programs are BLASTN and BLASTP. Details of these programs can be found at the following internet address: ncbi.nlm.nih.gov / cgi-bin / BLAST.
[0038] As used herein, “expression” includes any step involved in peptide production, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion. Expression can be detected using conventional techniques for protein detection, such as ELISA, Western blotting, flow cytometry, immunofluorescence, immunohistochemistry, etc.
[0039] As used herein, "expression vector" or "recombinant vector" refers to any substance such as plasmids, granules, viruses, self-replicating sequences, bacteriophages, linear or circular single-stranded or double-stranded DNA or RNA nucleotide sequences. Recombinant vectors can originate from any source, are capable of genome integration or self-replication, and contain promoter nucleic acid sequences operatively linked to one or more nucleic acid sequences. Recombinant vectors are typically used to introduce said operatively linked sequences into a suitable host.
[0040] In view of the problems existing in the prior art, this application provides a rare earth binding protein, including or composed of any one of the following proteins:
[0041] (I) A protein with the amino acid sequence shown in SEQ ID NO.2;
[0042] (II) Proteins with structures similar to (I);
[0043] (III) Proteins obtained by adding a linker, a sequence for purification, a sequence for cutting, a sequence for solubilization, or a sequence for immobilization to (I) or (II);
[0044] (IV) Proteins that have 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more sequence identity with (I), (II), or (III).
[0045] Protein (II), which is structurally similar to protein (I), can be a structurally similar protein obtained through analysis using various protein structural similarity analysis platforms known in the art. In some embodiments, the protein structural similarity analysis platform is Foldseek.
[0046] In some embodiments, a protein structurally similar to (I) refers to a protein whose structural similarity score to (I) calculated using a protein structural similarity analysis platform is greater than 400 and whose E value is less than 1e-8. In some embodiments, a protein structurally similar to (I) refers to a protein whose structural similarity score to (I) calculated using Foldseek is greater than 400 and whose E value is less than 1e-8. A structural similarity score greater than 400 can be, for example, 401, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, etc.
[0047] In some implementations, the T protein of a structure similar to (I) mTemperatures greater than 95℃ can be, for example, 95.1℃, 95.5℃, 96℃, 96.5℃, 97℃, 97.5℃, 98℃, 98.5℃, 99℃, 99.5℃, etc.
[0048] In some embodiments, the amino acid sequence of the protein similar to (I) is shown in any one of SEQ ID NO. 5-12, 20-33, or has 80%, 85%, 90%, 95%, 96%, 97%, 98% or more of sequence identity with any one of SEQ ID NO. 5-12, 20-33.
[0049] Class (III) proteins are proteins obtained by adding linkers, purification sequences, cleavage sequences, solubilization sequences, or immobilization sequences to Class (I) or (II) proteins to facilitate purification, immobilization, and other applications. Therefore, Class (III) proteins are not substantially different from Class (I) proteins in function or structure. In some embodiments, the amino acid sequence of Class (III) proteins is shown in SEQ ID NO.4.
[0050] The linker, the sequence for purification, the sequence for cleavage, the sequence for solubilization, or the sequence for immobilization can all be known in the art. For example, the sequence for purification can be His6, His10, Avi tag, etc. The sequence for cleavage can be a TEV site. The sequence for solubilization can be Sumo. The sequence for immobilization can be a spy tag, spy catcher, etc.
[0051] In some embodiments, the amino acid sequence of the rare earth binding protein is as shown in SEQ ID NO.2, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more sequence identity with the sequence shown in SEQ ID NO.2.
[0052] In some embodiments, the amino acid sequence of the rare earth binding protein is as shown in SEQ ID NO.4, or has 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more sequence identity with the sequence shown in SEQ ID NO.4.
[0053] This application also provides the use of the aforementioned rare earth binding protein in the recovery of rare earth elements.
[0054] This application also provides the use of the aforementioned rare earth binding protein in the separation of rare earth elements. The separation of rare earth elements can be used to separate rare earth elements from non-rare earth elements, or to separate different rare earth elements.
[0055] In some implementations, the separation refers to the separation between any two rare earth elements, that is, the separation between any rare earth pairs.
[0056] Among these rare earth pairs, separating adjacent rare earth pairs is the most difficult.
[0057] In some implementations, the separation refers to the separation between adjacent rare earth elements. Adjacent rare earth elements are those with an atomic number difference of 1. For example, La has an atomic number of 57, and Ce has an atomic number of 58, so La and Ce are adjacent rare earth elements. For Pm, due to its radioactivity, Nd with an atomic number of 60 and Sm with an atomic number of 62 are adjacent rare earth elements. Exemplary adjacent rare earth element pairs also include Eu / Gd, Dy / Ho, Ho / Er, Er / Tm, Tm / Yb, and Yb / Lu, etc.
[0058] The rare earth binding protein of this application can not only separate rare earth elements from non-rare earth elements, but also separate any two rare earth elements. Furthermore, it can also separate adjacent rare earth elements.
[0059] This application also provides the use of any of the above-mentioned rare earth binding proteins in the purification of rare earth elements.
[0060] In the above-mentioned applications, the rare earth element can be any rare earth element known in the art. For example, the rare earth element can be selected from one or more of lanthanum, cerium, praseodymium, neodymium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, lutetium, and yttrium.
[0061] This application also provides a method for recovering rare earth elements, including treating rare earth elements using any of the rare earth binding proteins described above.
[0062] This application also provides a method for separating rare earth elements, including treating the rare earth elements with any of the aforementioned rare earth binding proteins. The separation of rare earth elements can be either separating rare earth elements from non-rare earth elements, or separating different rare earth elements.
[0063] In some embodiments, the separation refers to the separation between any two rare earth elements. In some embodiments, the separation refers to the separation between adjacent rare earth elements. For example, adjacent rare earth elements such as Eu / Gd, Dy / Ho, Ho / Er, Er / Tm, Tm / Yb, and Yb / Lu can be classified.
[0064] This application also provides a method for purifying rare earth elements, including treating rare earth elements with any of the rare earth binding proteins described above.
[0065] In the above methods, "processing" can refer to bringing rare earth-binding proteins into contact with rare earth elements, thereby achieving the recovery, separation, or purification of rare earth elements. For example, the rare earth-binding proteins can be directly mixed with rare earth elements to achieve contact, or the rare earth-binding proteins can be filled into a separation device, allowing the rare earth elements to flow through the separation device to achieve contact between the rare earth-binding proteins and rare earth elements.
[0066] In the above method, the rare earth element can be any rare earth element known in the art. For example, the rare earth element can be selected from one or more of lanthanum, cerium, praseodymium, neodymium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, lutetium, and yttrium.
[0067] Experimental results show that the rare earth binding protein of this application can adsorb La ions up to 935.3 mg / L. ICP-OES results show that the rare earth binding protein of this application can successfully separate rare earth elements from non-rare earth elements, with a rare earth element recovery rate of 60.01% and a recovery purity of 99.76%. The rare earth binding protein of this application can also separate and purify multiple rare earth ion pairs, especially adjacent rare earth ion pairs, such as Eu / Gd, Dy / Ho, Ho / Er, Er / Tm, Tm / Yb, and Yb / Lu ion pairs.
[0068] In summary, the rare earth binding protein of this application has a significant affinity for all rare earth elements. It can not only separate rare earth elements from non-rare earth elements, but also separate light (lanthanum, cerium, praseodymium, neodymium), medium (samarium, europium, gadolinium, terbium, dysprosium), and heavy (holmium, erbium, thulium, ytterbium, lutetium, yttrium) rare earth elements as well as adjacent rare earth pairs (europium, gadolinium; dysprosium, holmium; holmium, erbium; erbium, thulium; thulium, ytterbium, etc.). It has good application prospects in the fine separation of rare earth elements.
[0069] Example
[0070] Example 1: Construction of MIF expression vector
[0071] To construct the protein MIF (152 aa), the codons of the fusion gene were optimized according to the codon usage preferences of *E. coli*, and a start codon ATG was added at the beginning. The fusion gene was inserted into the NdeI / BlpI site of the expression vector pET-25b(+) and transformed into *E. coli* BLR(DE3) cells (Novagen) to construct an engineered bacterium expressing the MIF protein.
[0072] SEQ ID NO.1: MIF fusion gene sequence (547bp, where the stop codon is shown in bold, the 5'NdeI restriction site is shown in underline, and the 3'BlpI restriction site is shown in wavy line):
[0073] CATATG GATCACCATTTTCCGAAAGGTAAAGTGAGCCTGGAAACCTGCCTGGAAGCGGCCCTGAAAGCCAAACCGGGCACCGTGGTGAAGGTGGAATATAAACTGGAAGGCGAAACCCCGGTGTACGAATTTGATATTGAAAGCAGCGATAGCACCGCGTGGGATGTGGAATGCGATGCGAACACCGGCAAAATTGTGGAAATTGAACAGGAAGTGGATAGCGCGGATCACCCGCTGTTTAAAGCGAAACAGAAAGTGAGCGAAGCCGAAGCGCGCAAAACCGCCCTGGCGGCGCACCCGGGCGAAATTGTGGAAGTGGAATATGAAATTGAGGAAAATGGCGCAGCCAGCTACGAATTTGACATCAAAACCAAAGACGGCAAAGAATTTAAAGTGGAAGTGGATGCCAGCACCGGTAAAATTGTGGAAGCGAACCAGGAATTTTATCAGATTGGCAAAGAATAACTCGAGATCAAACGGGCTAGCTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCG CTGAGC
[0074] SEQ ID NO.2: Protein sequence of MIF to be expressed (153 aa, containing a Met as the start codon):
[0075] MDHHFPKGKVSLETCLEAALKAKPGTVVKVEYKLEGETPVYEFDIESSDSTAWDVECDANTGKIVEIEQEVDSADHPLFKAKQKVSEAEARKTALAAHPGEIVEVEYEIEENGAASYEFDIKTKDGKEFKVEVDASTGKIVEANQEFYQIGKE
[0076] Example 2: Construction of the expression vector for H10MIF
[0077] A His10-tag consisting of 10 histidine residues (His, H) was added to the N-terminus of the MIF gene sequence and linked using a flexible linker (SGGS) to construct the H10MIF protein. The codons of the fusion gene were then optimized according to the codon usage preferences of *E. coli*, and a start codon (ATG) was added at the beginning. The fusion gene was inserted into the NdeI / XhoI site of the expression vector pET-25b(+) and transformed into *E. coli* BLR(DE3) cells (Novagen) to construct an engineered bacterium expressing the H10MIF protein.
[0078] SEQ ID NO.3: Fusion gene sequence of H10MIF (547bp, where stop codons are shown in bold, 5'NdeI restriction sites are shown underlined, and 3'XhoI restriction sites are shown with wavy lines):
[0079] CATATG AGCGGCGGCCATCATCATCACCACCATCATCATTCGGGCGGCAGCGATCACCATTTTCCGAAAGGTAAAGTGAGCCTGGAAACCTGCCTGGAAGCGGCCCTGAAAGCCAAACCGGGCACCGTGGTGAAGGTGGAATAAACTGGAAGGCGAAACCCCGGTGTACGAATTTGATATTGAAAGCAGCGATAGCACCGCGTGGGATGTGGAATGCGATGCGAACACCGGCAAAATTGTGGAAATTGAACAG GAAGTGGATAGCGCGGATCACCCGCTGTTTAAAGCGAAACAGAAAGTGAGCGAAGCCGAAGCGCGCAAAACCGCCCTGGCGGCGCACCCGGGCGAAATTGTGGAAGTGGAATATGAAATTGAGGAAA ATGGCGCAGCCAGCTACGAATTTGACATCAAAACCAAAGACGGCAAAGAATTTAAAGTGGAAGTGGATGCCAGCACCGGTAAAATTGTGGAAGCGAACCAGGAATTTTATCAGATTGGCAAAGAATAA CTCGAG
[0080] SEQ ID NO.4: Protein sequence of H10MIF to be expressed (170 aa, containing 10 His as His tags, underlined, and including a Met as a start codon, and SGGS and SGG as linkers):
[0081] MSGG HHHHHHHHH SGGSDHHFPKGKVSLETCLEAALKAKPGTVVKVEYKLEGETPVYEFDIESSDSTAWDVECDANTGKIVEIEQEVDSADHPLFKAKQKVSEAEARKTALAAHPGEIVEVEYEIEENGAASYEFDIKTKDGKEFKVEVDASTGKIVEANQEFYQIGKE
[0082] Example 3 Expression and purification of MIF
[0083] After large-scale expression (1 L) of the engineered Escherichia coli BLR(DE3) cells expressing the MIF protein in Example 1, the harvested recombinant bacteria (150 g) were resuspended at a 1:5 (w / v) ratio in Q-lysis (25 mM Tris, 150 mM NaCl, adjusted to pH 5.9 with 12 M hydrochloric acid), containing 1 g / L lysozyme, 5 mg / L DNase, and 30 mM magnesium chloride. The bacterial cells were homogenized using a high-pressure homogenizer (homogenization conditions: pressure 800–1000 Bar, flow rate 40 L / h, homogenization for 10 cycles). After centrifugation, the supernatant was filtered through a 0.45 μm capsule filter, followed by purification by anion exchange column chromatography and molecular sieving. Finally, to analyze protein expression and purification, the desalted protein was confirmed by a 4–20% polyacrylamide gel. The molecular weight of MIF was 16.97 kDa.
[0084] Example 4: Expression and purification of H10MIF
[0085] After large-scale expression (200 L) of the engineered Escherichia coli BLR(DE3) cells expressing the H10MIF protein was constructed in Example 2, the harvested recombinant bacteria (150 g) were suspended at a 1:5 (w / v) ratio in Ni-lysis solution (50 mM Na3PO4, 500 mM NaCl, 20 mM imidazole, adjusted to pH 7.4 with 12 M hydrochloric acid), containing 1 g / L lysozyme, 5 mg / L DNase, and 30 mM magnesium chloride. The bacterial cells were then homogenized using an autoclave (homogenization conditions: pressure 800–1000 Bar, flow rate 40 L / h, homogenization for 10 cycles). After centrifugation, the supernatant was filtered through a 0.45 μm capsule filter and then purified by Ni-sepharose chromatography. Finally, to analyze the expression and purification of the protein, the desalted protein was confirmed by SDS-PAGE on a 4–20% polyacrylamide gel. The molecular weight of H10MIF is 18.83 kDa.
[0086] Example 5: Coupling proteins to agarose microspheres
[0087] 180 mg of protein (MIF obtained in Example 3 and H10MIF obtained in Example 4) were dissolved in 6 mL of coupling buffer (0.1 M NaHCO3, 0.5 M NaCl, pH 8.3) to obtain protein lysate. 6 g of substrate beads (NHS-Activated Chromstar 4FF) were added to a 50 mL three-necked flask and washed 10 times with 18 mL of 1 mM HCl in an ice-water bath. Then, 9 mL of coupling buffer was added to the substrate beads to adjust the pH to 8.5, followed by the addition of the protein lysate. The pH was adjusted to 8.3, and the system was incubated at 24°C. The reaction was stopped when the A280 absorption in the supernatant reached a stable level. After removing the reaction solution, 18 mL of blocking buffer (0.1 M Tris-HCl, pH 8.5) was added to the substrate beads, and the A280 absorption in the supernatant was stopped when it reached a stable level, completing the blocking process. Finally, the microspheres were washed 10 times with 18 mL of 0.1 M acetic acid solution in an ice-water bath, and then 10 times with 18 mL of ultrapure water in an ice-water bath to obtain protein-coupled agarose microspheres (MIF-agarose microspheres and H10MIF-agarose microspheres). The obtained microspheres were stored in purified water at 4 °C.
[0088] Example 6: Determination of the binding capacity of rare earth elements in a protein-agarose microsphere packed column
[0089] Protein-agarose microspheres (MIF-agarose microspheres and H10MIF-agarose microspheres, respectively) were resuspended in ultrapure water (18 MΩ / cm) and then packed into chromatography columns by gravity with a column volume of 1 mL, resulting in protein-agarose microsphere packed columns (MIF-agarose microsphere packed columns and H10MIF-agarose microsphere packed columns, respectively). Before adsorption experiments, the columns were washed with 20.0 g / L citrate buffer (pH=5) and equilibrated with MES buffer (MES concentration 25 mM, pH adjusted to 6 using 12 M hydrochloric acid and concentrated sodium hydroxide). After equilibration, rare earth solution (LaCl3, 1 mM, dissolved in MES buffer at pH 6) was added to the chromatography column at a flow rate of 0.75–1.00 mL / min. The flow-through solution from the column was collected. The lanthanum content in the flow-through solution in the above steps was detected by ICP-OES, and the binding capacity of the protein-agarose microsphere packed columns (MIF-agarose microsphere packed column and H10MIF-agarose microsphere packed column, respectively) was detected.
[0090] The results are as follows Figure 1 and Figure 2 As shown, after the MIF-agarose microsphere packed column adsorbed 6 column volumes of 1.0 mM LaCl3, La ions were detectable in the flow-through solution. Calculations indicate that the adsorption capacity of this MIF-agarose microsphere packed column for La ions is approximately 935.3 mg / L. Similarly, after the H10 MIF-agarose microsphere packed column adsorbed 5 column volumes of 1.0 mM LaCl3, La ions were detectable in the flow-through solution. Calculations indicate that the adsorption capacity of this H10 MIF-agarose microsphere packed column for La ions is approximately 844.6 mg / L. In contrast, the adsorption capacity of the unimmobilized agarose microsphere packed column for La ions is approximately 3.224 mg / L. These results clearly demonstrate the significant affinity of protein-coupled materials for rare earth elements (REEs).
[0091] Example 7: Testing the Cyclic Performance of Protein-Agarose Microsphere Packed Columns
[0092] The MIF-agarose microsphere packed column and the H10 MIF-agarose microsphere packed column prepared in Example 6 can be recycled. Utilizing La... 3+ Forty cycles of adsorption and desorption were performed on 1 mL of the same batch of column material. The adsorption process was the same as in Example 6. The loading buffer was MES buffer (MES concentration of 25 mM, pH adjusted to 6 using 12 M hydrochloric acid and concentrated sodium hydroxide), containing 1.0 mM LaCl. 3, The volume was 15 mL. The results were as follows: Figure 3As shown in the figure. Each cycle used 20.0 g / L citrate buffer (pH=5) for desorption. Before the desorption experiment, the chromatography column was washed with ultrapure water for 10 column volumes. The eluent was collected and its total rare earth content was tested, and the rare earth loading was calculated. The results show that the MIF-agarose microsphere packed column and the H10MIF-agarose microsphere packed column maintained column efficiency during 40 cycles of adsorption and desorption.
[0093] Example 8: Detection of the separation performance of protein-agarose microsphere packed column for rare earth elements and non-rare earth elements
[0094] The MIF-agarose microsphere packed column and the H10 MIF-agarose microsphere packed column prepared in Example 6 can successfully separate rare earth elements and non-rare earth elements (e.g. Figure 4 The loading solution contained equal concentrations of 16 rare earth elements (excluding promethium) (total concentration 1.0 mM), as well as iron, aluminum, and magnesium, which are commonly found in nature as companions to rare earth elements, and calcium, which has properties similar to rare earth elements. The concentration of each element was 1.0 mM. The loading solution was an acetate buffer solution (25 mM acetic acid, pH adjusted using 12M hydrochloric acid and concentrated sodium hydroxide) containing the aforementioned metal ions and their corresponding concentrations. Loading conditions were the same as in Example 6, with a total loading volume of 15 mL. Unbound metal ions were then rinsed with ultrapure water and eluted with a 20.0 g / L citrate buffer solution (pH 5). The concentrations of rare earth ions in the loading solution, flow-through solution, and eluent were measured using ICP-OES.
[0095] ICP-OES results showed that REEs could be successfully separated from non-rare earth elements using MIF-agarose microsphere packed columns and H10MIF-agarose microsphere packed columns, with rare earth element recoveries of 60.01% (MIF) and 54.99% (H10MIF), and recoveries of purities of 99.76% (MIF) and 99.13% (H10MIF), respectively.
[0096] Example 9: Detection of the separation performance of rare earth elements by a protein-agarose microsphere packed column
[0097] The MIF-agarose microsphere packed column prepared in Example 6, H10 MIF-agarose microsphere packed column, can separate and purify all rare earth ion pairs, especially adjacent rare earth ion pairs. Here, the H10 MIF-agarose microsphere packed column is used as an example. The concentration of both rare earth elements in the loading solution is 10 mM, dissolved in MES buffer (MES concentration 25 mM, pH adjusted to 6 using 12M hydrochloric acid and concentrated sodium hydroxide). The loading volume is 100 μL-10 mL, and the total column volume is 2.7 mL-150 mL. Equilibration is performed using MES buffer for a total of 0.5-5 column volumes. Desorption and elution are performed in two steps. The first step is elution with a fixed concentration of citrate buffer (70 mg / L), mainly used to elute any non-rare earth elements and further equilibrate the column, for 0.5-5 column volumes. The second step is gradient elution with citrate buffer at concentrations of 70-400 mg / L. Specifically, different rare earth element pairs can be eluted using the gradient of citrate buffer shown in the table below.
[0098]
[0099] The collection of the flow-through solution was performed in the same manner as in Example 6. ICP-OES results for all rare earth elements directly separated into individual fractions are as follows: Figure 5 As shown in Table 1, the H10MIF-agarose microsphere packed column successfully separated all ion pairs using the above elution method, and the purity is shown in Table 1.
[0100] Methods for calculating the purity of metal ions:
[0101] Purity_(REE1)=(c_(REE1)) / ((c_(REE1))+(c_(REE2)))
[0102] Where c_(REE1) and c_(REE2) are the molar concentrations of REE1 and REE2, respectively.
[0103] Table 1
[0104]
[0105] Example 10: Preparation of high-purity rare earth elements (99.99%+) using protein-agarose microsphere packed columns
[0106] The MIF-agarose microsphere packed column H10 prepared in Example 6 can be used for the preparation and purification of rare earth elements to a purity of 99.99%+. Here, the H10MIF-agarose microsphere packed column is used as an example. Commercially available rare earth elements with a purity of 99%-99.9% are used as the loading solution, with a concentration of approximately 10 mM, and dissolved in MES buffer (MES concentration 25 mM, pH adjusted to 6 using 12M hydrochloric acid and concentrated sodium hydroxide). The loading volume is 100 μL-10 mL, and the total column volume is 2.7 mL-150 mL. Equilibration is performed using MES buffer for a total of 0.5-5 column volumes. Desorption and elution are performed in three steps. The first step is elution with a fixed concentration of citrate buffer, at a concentration of 90% of the citrate concentration corresponding to the initial elution of the target rare earth element. This is mainly used to elute rare earth impurities heavier than the target element, and is performed for 0.5-5 column volumes. The second step involves gradient elution with citrate buffer, starting at 90% of the citrate concentration corresponding to the initial elution of the target rare earth element and continuing up to 1.2 times the citrate concentration. The fractions are collected as high-purity rare earth products. The third step involves elution with a 600-1500 mg / L citrate buffer solution to remove all residual rare earth elements from the column and regenerate the column. The collection of the flow-through solution is the same as in Example 6. The ICP-OES results for each fraction directly separated from all rare earth elements are as follows: Figure 6 As shown in Table 2, high-purity rare earth elements can be prepared using the H10MIF-agarose microsphere packed column elution method described above. Ce, Nd, Gd, Dy, Ho, and Yb are used as example elements, and their purities are shown in Table 2.
[0107] Table 2
[0108]
[0109] Example 11
[0110] Rare earth elements (REEs) in rare earth ores were leached using microorganisms capable of leaching REEs to obtain a leachate, which was then used as a rare earth solution for sample loading. The loading, equilibration, and elution methods were the same as in Example 7. ICP-OES results showed that the REEs in the leachate could be successfully separated from non-rare earth elements using a MIF-agarose microsphere packed column (H10 MIF-agarose microsphere packed column). The results are shown in Table 3; the flow-through contained only rare earth elements, and no non-rare earth elements were detected.
[0111] Table 3
[0112]
[0113] Example 12 Other proteins with MIF structures
[0114] 1) Screening of proteins with MIF structures
[0115] Based on the structure of the MIF (experimental structure, PDB: 9VY3, 9VY4, 9VY5, 9VY6, 9VY7, 9VY8, 9VY9, 9VYA, or based on the reference sequence for AF2, AF3, etc.), a structural similarity comparison platform such as Foldseek is used to perform sequence searches based on structural similarity in various databases (such as ESM, AFDB, etc. Here, we take these two databases as examples).
[0116] Ultimately, 35 proteins were selected from 2000 protein sequences for synthesis and subsequent analysis. Specifically, the structural similarity scores, E-values, and sequence information of these 35 proteins are shown in Table 4.
[0117] Table 4
[0118]
[0119]
[0120]
[0121] 2) Expression of proteins with MIF structures
[0122] The 35 proteins selected above were expressed, and the construction and expression methods of all proteins were the same as in Examples 1-4.
[0123] 3) Performance verification of the protein
[0124] Using the maximum separation coefficient between rare earth pairs (SF) adjacent,max SF adjacent Defined as the ratio of the protein's loading of the two rare earth elements when two adjacent rare earth elements bind to the protein simultaneously, SF adjacent,max SF is defined as the number of adjacent pairs that can be formed between 13 non-radioactive lanthanide elements. adjacent (maximum value) and SF greater than 1.5 adjacent Quantity (SF) 1.5 )Measure the rare earth distinguishing properties of proteins;
[0125] Experimental methods
[0126] This method directly obtains the "binding degree" (D value) of each ion in the protein-rare earth system through ultrafiltration enrichment-separation-quantification steps; and then calculates the maximum separation coefficient SF of adjacent rare earth pairs. adjacent,max and SF 1.5(SF ≥ 1.5 logarithm) is used to quantify the broad-spectrum and fine-resolution ability of proteins to rare earth elements. The method is not limited to protein types and can be applied to any metal-binding protein, as well as to high-throughput screening of subsequent mutants or ligand modifiers.
[0127] Target protein purity ≥ 85%;
[0128] The number of metal sites is known, or it can be estimated based on molecular weight using the method of one site per 3 kDa;
[0129] Prepare a 100 μM protein solution (based on binding sites) after lyophilization or dialyzing into the target buffer.
[0130] The rare earth salts are hydrochloride / nitrate salts containing 14 non-radioactive rare earth elements, analytical grade, with a content / TREO ≥ 99.9%; an approximately 10 mM stock solution was prepared (0.2 μm filtration), and the concentration was accurately determined using ICP-OES / MS.
[0131] The buffer solution was prepared at pH 6 ± 0.1 (25 mM MES) or pH 5 ± 0.1 (30 mM HOMO-PIPES), where the metal content was at the baseline level of ICP-OES / MS.
[0132] The ultrafiltration tube has a 3 kDa molecular weight cutoff (MWCO) for polyethersulfone protein retention ≥ 99% and a rare earth permeability ≥ 95%.
[0133] Step 1 System Preparation
[0134] The protein was mixed with the rare earth solution and diluted with a buffer to achieve the following final concentration:
[0135] Protein concentration 1-50 μM (based on site, the same below).
[0136] The rare earth concentration is 10-50 times the protein site concentration, i.e., 10 μM to 2.5 mM.
[0137] Then incubate at 25, 30, 37°C, 0-300 rpm for 10-120 minutes; for a few systems, incubation may be extended to overnight or up to 16 hours.
[0138] Step 2 Ultrafiltration separation
[0139] Take 0.5-15 mL of incubation solution and load it into a 3 kDa ultrafiltration tube;
[0140] Centrifuge at 4℃, 2000-5000 ×g for 10-240 min;
[0141] Add an equal volume of buffer solution to the threshold liquid for washing to reduce the concentration of free rare earth ions. Repeat the centrifugation-dilution process three times and collect the filtrate and threshold liquid.
[0142] Step 3: ICP Quantification
[0143] Dilute the intercepting and flow-through solutions with ultrapure water / electronic grade nitric acid to an estimated rare earth concentration of 0.01-10 ppm (for ICP-OES) or 0.05-50 ppb (for ICP-MS), with a final nitric acid concentration of approximately 1% to match the test matrix.
[0144] ICP-OES wavelength / -MS mass-to-charge ratio reference national standard
[0145] Obtain the concentration of the filtrate CP (μM) and the concentration of the intercepting fluid CR (μM).
[0146] Step 4: Calculation of Binding Degree (D) and Separation Coefficient (SF)
[0147] D = (CR - CP) / (CP)
[0148] SFX / Y = DX / DY
[0149] SF adjacent The “adjacent pairs” are defined according to the periodic table sequence (La-Ce, Ce-Pr … Yb-Lu), and Nd-Sm is used to replace the Nd-Pm and Pm-Sm pairs containing the radioactive element Pm.
[0150] Experimental results
[0151] The SF values of all 35 proteins and the initial MIF were tested. SF_1.5 and SF_max were calculated and plotted. The results are shown in Table 5. Figure 7 As shown (where SF) 1.5 It has the same meaning as SF_1.5, SF adjacent,max (It has the same meaning as SF_max). Scores < 400 are displayed in blue, and scores > 400 are displayed in red.
[0152] Table 5
[0153]
[0154] The results above show that proteins with a similarity score above 400 perform better than those below 400. Therefore, using a similarity score of 400 as a threshold, proteins with scores above 400 have higher similarity and thus better separation performance. Specifically, if the structural similarity score is greater than 400 and the E-value is less than 1e-8, the corresponding protein is considered to have a MIF structure.
[0155] 4) Heat resistance of protein
[0156] The heat resistance of the above 35 proteins was determined.
[0157] Experimental methods
[0158] Using CD to monitor the temperature decay of secondary structures at T 80% (80% of the temperature of the remaining secondary structure, i.e., T) m (This is) used as the main criterion.
[0159] Variable system:
[0160] Protein concentration (0.05–10 mg / mL) is required to meet CD signal-to-noise ratio requirements;
[0161] Rare earth / protein molar ratio: 1:1–10:1;
[0162] Incubation times: 10, 30, 60, 120 min;
[0163] Temperature scan rate: 0.5 vs 1 ℃ / min;
[0164] Anion selection: Cl - vs NO3 - ;
[0165] pH = 6±0.1 (25 mM MES) or pH = 5±0.1 (30 mM HOMO-PIPES)
[0166] The target protein has a purity greater than 85%, and fresh protein (or lyophilized protein that has been reconstituted and then purified using a molecular sieve of appropriate molecular weight to remove any aggregates) is used. Purity is measured using SDS-PAGE grayscale.
[0167] Experimental Procedure
[0168] 1. Sample preparation: Fresh protein or reconstituted lyophilized protein purified by molecular sieves of appropriate molecular weight was used. First, the A280 value was measured using a UV-VIS spectrophotometer, and the concentration was calculated using ε obtained from ProtParam according to the sequence. Then, it was mixed with a suitable (1-10) molar ratio of rare earth ions (one of 16 kinds), gently swirled for 30s, and allowed to stand at 25 / 30 / 37℃ for 10 / 30 / 60 / 120 min.
[0169] 2. A 0.1 cm screw-cap CD quartz cell with a transmittance of >80% in the 190-260 nm range was used. Nitrogen purging was employed throughout the process to prevent condensation. Scanning was performed at 1 nm steps (190–260 nm) with N = 3. The temperature rise was 25–100℃, with a temperature scan rate of 0.5–1℃ / min, recording a complete CD spectrum every 5℃. The temperature was then lowered from 100℃ to 25℃ at the same rate, and the CD was finally tested after reaching the endpoint. The content of each secondary structure was output using BeStSel, and the temperature at which the secondary structure content first fell below 80% in the heating curve was taken as T. 80% .
[0170] The results are as shown in 6 and Figure 8 As shown.
[0171] Table 6
[0172]
[0173] The results showed that the protein score had a boundary of 400; scores greater than 400 were considered T. m All of them are above 95 degrees Celsius, while those below 400 are almost all below 95 degrees Celsius. This means that proteins with MIF structures have higher denaturation temperatures and better heat resistance.
Claims
1. The use of rare earth binding proteins in the separation of rare earth elements, wherein the separation refers to the separation between any two rare earth elements; The rare earth binding protein is a protein with an amino acid sequence as shown in SEQ ID NO.2 or SEQ ID NO.4; The rare earth elements mentioned therein are selected from two or more of the following: lanthanum, cerium, praseodymium, neodymium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, and lutetium.
2. The use according to claim 1, wherein the separation is a separation between adjacent rare earth elements.
3. A method for separating rare earth elements, comprising treating rare earth elements with a rare earth binding protein, wherein the separation refers to the separation between any two rare earth elements; The rare earth binding protein is a protein with an amino acid sequence as shown in SEQ ID NO.2 or SEQ ID NO.4; The rare earth elements mentioned therein are selected from two or more of the following: lanthanum, cerium, praseodymium, neodymium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, and lutetium.
4. The method according to claim 3, wherein the separation is a separation between adjacent rare earth elements.