Biosensor for detecting tumor cells
By combining a DNA tetrahedral biosensor with fluorescence technology, the problems of insufficient sensitivity and long detection cycle in existing tumor diagnostic methods have been solved, enabling rapid, accurate, and low-cost detection of tumor cell markers with high specificity and sensitivity.
Patent Information
- Application Number
- CN202511050619.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-29
- Publication Date
- 2025-11-04
AI Technical Summary
Existing tumor diagnostic methods are not sensitive enough, are highly invasive, and have long detection cycles, making it difficult to achieve high sensitivity, high specificity, and non-invasive early detection.
Using a DNA tetrahedral biosensor, a composite probe binds to markers on the surface of cancer cells, triggering an entropy-driven chain displacement reaction to form a three-dimensional DNA superstructure. The fluorescence signal is then significantly amplified to achieve real-time in-situ imaging of miRNAs.
It enables rapid, accurate, and low-cost detection of tumor cell markers, avoids false positive results, has high specificity and sensitivity, and simplifies the detection process.
Smart Images

Figure CN120888640A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biomarker detection, and particularly relates to a fluorescent sensor for detecting tumor cell biomarkers. BACKGROUND
[0002] The information disclosed in this background section is intended to provide an overview of the general background of the application and is not necessarily a concession that the information was prior art to the present application.
[0003] Tumors seriously threaten human health, and early and accurate diagnosis is crucial for effective treatment and patient prognosis. Traditional tumor diagnosis methods such as imaging examination and histopathological detection have certain limitations, such as insufficient sensitivity, invasiveness, or long detection period. Therefore, developing new diagnostic techniques with high sensitivity, specificity, and relative non-invasiveness has become a research hotspot.
[0004] MicroRNAs (miRNAs) are a class of non-coding RNA molecules about 22 nucleotides in length, which play an important role in gene expression regulation. Abnormal miRNA expression is closely related to the occurrence and development of various diseases, especially cancer. Therefore, developing techniques to monitor miRNA expression levels is of great significance for early diagnosis and treatment of diseases.
[0005] Fluorescent biosensors are widely used in biological analysis due to their high sensitivity, real-time monitoring, and visualization. Combining DTN with fluorescent biosensors can fully utilize the advantages of both. By loading miRNA-specific probes and entropy-driven auxiliary chains onto DNA tetrahedral structures, a high-order three-dimensional DNA superstructure can be formed by a reliable target-triggered entropy-driven chain displacement reaction in the cell body. The precise multi-directional arrangement of DNA probes and the internal confinement effect can increase the local target concentration, promote the significant amplification of fluorescence signals, and realize real-time in situ imaging of miRNA. SUMMARY
[0006] To solve the problem of complicated pretreatment of tumor cell samples, the application provides a biosensor for detecting tumor cell markers based on fluorescence technology, which has high specificity and sensitivity, low cost, and fast detection speed.
[0007] To achieve the above-mentioned purposes, the application adopts the following technical solutions.
[0008] A DNA tetrahedral biosensor comprises a composite probe, wherein the composite probe is a DNA tetrahedron loaded with MUC1 aptamer chains, L1 chains, H1 hairpins, and H2-L2 composite hairpins. The molar ratio of the DNA tetrahedron and the MUC1 aptamer chain, the L1 chain, the H1 hairpin and the H2-L2 complex hairpin is 1:1:3:3; The DNA tetrahedron (DTN) is formed by T1, T2, T3 and T4 through base complementation; The H2-L2 complex hairpin is formed by H2 hairpin and L2 through base complementation; The nucleotide sequences of the T1, T2, T3, T4, MUC1 aptamer chain, L1 chain, H1 hairpin, H2 hairpin and L2 are shown in SEQ ID NO: 1-9 respectively; The 12th position on the 3' end of the H2 hairpin is modified with a fluorescent group; the 3' of the L2 is modified with a quenching group.
[0009] Preferably, the fluorescent group is FAM; and the quenching group is BHQ1.
[0010] The preparation method of the biosensor comprises the following steps: (1) annealing single-stranded H1 and H2 in a buffer solution to form a hairpin structure to obtain H1 hairpin and H2 hairpin; (2) annealing T1, T2, T3, T4, MUC1 Apt and L1 in a buffer solution in an ice bath to form a DNA tetrahedron (DTN); (3) co-incubating the H1 hairpin, H2 hairpin, L2 and DTN in a buffer solution to obtain a complex probe.
[0011] The application further provides a kit prepared from the above biosensor.
[0012] The kit further comprises a standard of the target.
[0013] The above sensor and kit can be used for tracing detection of a cell, tissue or microenvironment of an organism with high expression of MUC1, mi-R21 and Bcl-2 ASO or for detecting the content of mi-R21 and Bcl-2 mRNA in an environment where the three coexist.
[0014] The detection principle of the application is as shown in the figure. Figure 1 The sequences are as follows: MUC1 aptamer chain (MUC1 Apt): GCAGTTGATCCTTTGGATACCCTGGTAAGCTA; L1: TCAGACTGATGTTGACGCTGGGAGACCACGACCTTACC; H1: CGTGCTGACGCTCCGAGATGGTAAGGTCGTGGTCTCCCAGCGTGAGGACGTACAGTACTAGCACTATGACT; H2: CAGCAAGCTACGATAGCTACACGTCCTCACGCTGGGAGACCACGACCTTTCTCCAGCGTG (FAM) CGCCATTGACTC ; L2: GAGTCAATGGCG (BHQ1); wherein, The different colors of the marks in the T1, T2, T3 and T4 chains are the corresponding complementary base sequences; the bold marked sequence in T1 is the S1 sequence; the T1, T2, T3 all contain the complementary sequences of H1, H2-L2, and the T4 contains the complementary sequences of L1 and MUC1 Apt; The modified fluorescent group on the H2 chain and the quencher group on the L2 form the H2-L2 hybridization chain through base complementary pairing, so that the fluorescent group and the quencher group are close to each other, thereby quenching the fluorescence; Since the T1-T4 contain complementary sequences to each other, a DNA tetrahedron (DTN) can be prepared by annealing, which forms four long overhanging sequences at the four “vertices”, one containing the complementary sequences of MUC1 Apt and L1, and three containing the complementary sequences of H1, H2-L2; the DTN can be assembled with MUC1 Apt, L1, H1, H2-L2 to form a multifunctional DTN, i.e. a composite probe.
[0015] The above composite probe can undergo the following reaction process: The MUC1 aptamer on the composite probe binds to the large amount of MUC1 protein expressed on the surface of the cancer cells, thereby separating from the composite probe, so that the mi-R21 complementary sequence of the composite probe is exposed; the miR-21 in the cancer cells binds to the mi-R21 complementary sequence, causing the release of L1; On the one hand, the released L1 binds to the hairpin H1, which opens the H1 and triggers the generation of the CHA reaction, causing the conformation of the hairpin H2 to change and exposing the Bcl-2 ASO sequence (indicated by bold), and combining with the intracellular Bcl-2 mRNA (ATGGCGCACGCTGGGAGA), thereby releasing L2. At this time, L2 is separated from the hairpin H2, so that the quencher group and the fluorescent group are separated, thereby generating a fluorescence signal.
[0016] On the other hand, the released L1 can be recycled to trigger more CHA reactions to occur, and timely amplify the intensity of the sensor fluorescence signal; After the above process, whether there are cells with high expression of MUC1, mi-R21 and Bcl-2 at the same time can be known by detecting whether the fluorescence intensity in the detection system changes, and the content of the cells can also be judged by detecting the fluorescence intensity.
[0017] The present application has the following advantages: The core of the sensor of the present application is a DNA tetrahedron, which, compared with other DNA nanostructures (such as cubes and icosahedrons), can function without intermediate purification steps, complex annealing and simple modification. The modified nucleic acid sequence of the DTN overhanging part releases a fluorescence signal and undergoes a CHA cycle after binding to the intracellular marker of cancer cells, thereby amplifying the cell imaging results. The reaction process involves a logic circuit, which releases L2 and releases a fluorescence signal only when MUC1, miR-21 and Bcl2 mRNA exist at the same time, thereby effectively avoiding false positive results caused by detection of one marker and having higher accuracy. The sensor has the advantages of fast detection speed, simple operation, low price, low detection limit and high specificity, can make up for the defects and deficiencies of existing detection methods of tumor cells, and realizes rapid and accurate qualitative detection of the tumor cells. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 is a schematic diagram of the detection principle of the sensor; Figure 2 is a verification diagram for synthesis and preparation of the sensor; Figure 3 is a feasibility verification diagram of the sensor; Figure 4 is a performance evaluation of the sensor. DETAILED DESCRIPTION
[0019] The present application will be further described below in combination with examples and drawings, but the present application is not limited by the following examples.
[0020] Example 1 Construction of the sensor T1, T2, T3, T4, MUC1 aptamer chain, L1 chain, H1 hairpin, H2 hairpin and L2 were synthesized according to the nucleotide sequences shown in SEQ ID NO: 1-9; and a fluorescence group FAM was modified on the 12th position from the 3' end of the H2 hairpin; and a quenching group BHQ1 was modified at the 3' of L2.
[0021] (1) Equal amounts (3 μL) of T1, T2, T3, T4, L1 and MUC1 Apt with a concentration of 100 μM were added to 12 μL of assembly buffer, heated at 95℃ in a water bath for 5 min, and cooled to room temperature, and stored at 4℃ for standby; (2) In 36 μL assembly buffer, H2 (100 μM, 9 μL), L2 (20 μM, 45 μL) and 2 μL RNase inhibitor were added, heated at 95 °C in a water bath for 5 min and cooled to room temperature to form H2-L2 hybrid chain, which was stored at 4 °C for standby; (3) In 81 μL assembly buffer, H1 (100 μM, 9 μL) was added, heated at 95 °C in a water bath for 5 min and then quickly placed in an ice bath for 30 min to form H1 hairpin structure, which was moved to 4 °C for storage standby; (4) The solutions obtained in steps (1)-(3) were mixed and incubated at 37 °C for 30 min to obtain the composite probe (MDTN).
[0022] Example 2 Sensor construction verification T1 and T2, T1, T2 and T3, T1, T2, T3 and T4 were respectively heat denatured and annealed to form hybrid structures, which were named as T1+T2, T1+T2+T3, DTN, respectively; 10 μL of T1, T2, T3, T4, T1+T2, T1+T2+T3, DTN, MDTN with a concentration of 1 μM were mixed with 6×DNA loading buffer and placed in the loading well of 12% polyacrylamide gel. Subsequently, electrophoresis was performed in 1×TBE buffer (50 mM Tris-borate, 2 mM EDTA, pH 8.3) at a voltage of 110 V for 90 min. Then the gel after electrophoresis was stained in nucleic acid dye SuperRed for 20 min, and gel imaging analysis was performed using a fluorescence imager under the condition of 365 nm ultraviolet irradiation.
[0023] The results are shown in Figure 2 As shown in Figure A, the band migration speed of lane 6 and lane 7 was slower than that of lanes 2-5, indicating the formation of double-stranded DNA and triple-stranded DNA structure, and the migration speed of lane 8 indicated that the four single strands were successfully assembled into DTN structure, and the lowest migration speed of lane 9 showed the successful preparation of MDTN.
[0024] H2 and L2, DTN and L1, DTN, L1 and MUC1 Apt were respectively heat denatured and annealed to form hybrid structures, which were named as H2+L2, DTN+L1, DTN+L1+MUC1 Apt, respectively; 10 μL of H2, MUC1 Apt, L1, H2+L2, H1, DTN+L1, DTN+L1+MUC1 Apt, MDTN at a concentration of 1 μM were mixed with 6x DNA loading buffer, and placed in the 12% polyacrylamide gel loading well. Then, electrophoresis was performed in 1x TBE buffer at a voltage of 110 V for 90 min. The gel after electrophoresis was stained in nucleic acid dye SuperRed for 20 min, and gel imaging analysis was performed using a fluorescence imager under 365 nm ultraviolet irradiation.
[0025] The results are shown in Figure B, and the process of loading DTN as MDTN can be seen. According to the illustration, it can be observed that the migration speed of lanes 6-8 is significantly slower than that of lanes 1-5, which indicates that L1, MUC1 Apt, H1, H2 and L2 can be successfully assembled on DTN, thereby proving the successful preparation of MDTN. Figure 2
[0026] Example 3 Sensor Feasibility S1, L1 and MUC1 Apt, and S1 and L1 were respectively heat denatured and annealed to form hybrid structures, and were respectively named S1+L1+MUC1 Apt and S1+L1. S1+L1+MUC1 Apt, miR-21 and MUC1 (10 U / mL), and S1+L1+MUC1 Apt and miR-21 were respectively incubated at 37°C for reaction, and were respectively named S1+L1+MUC1 Apt+miR-21+MUC1 and S1+L1+MUC1 Apt+miR-21. The first step reaction of the multifunctional DTN structure was verified by polyacrylamide gel electrophoresis (PAGE). The following reaction systems [L1, miR-21, MUC1 Apt, S1, S1+L1+MUC1 Apt, S1+L1+MUC1 Apt+miR-21+MUC1, S1+L1+MUC1 Apt+miR-21, S1+L1] at a volume of 10 μL and a concentration of 1 μM were placed in the 8% polyacrylamide gel loading well, and electrophoresis was performed at a voltage of 120 V for 50 min. After staining, imaging analysis was performed.
[0027] The results are shown in Figure B, and the process of loading DTN as MDTN can be seen. According to the illustration, it can be observed that the migration speed of lanes 6-8 is significantly slower than that of lanes 1-5, which indicates that L1, MUC1 Apt, H1, H2 and L2 can be successfully assembled on DTN, thereby proving the successful preparation of MDTN. Figure 3 As shown in A, first, L1, MUC1 Apt is loaded using T1 part sequence S1, which is shown by the migration position of lane 6 and lane 9 bands, and a triple helix complex can be successfully formed (lane 6). When only miR-21 is added (lane 8), it does not affect the complex, so the MUC1 Apt does not fall off and expose the miR-21 binding site. When MUC1 and miR-21 are added at the same time, as shown by the migration of lane 7, L1 and MUC1 Apt fall off in the triple helix complex and expose the miR-21 binding site, and miR-21 binds to S1 to form a double-stranded structure, proving that the first step of the reaction requires the presence of MUC1 to promote the multifunctional DTN structure to achieve the purpose of targeted entry into target cells.
[0028] After verifying the role of MUC1, miR-21 and Bcl-2 mRNA were again reacted with MDTN to verify the reaction steps in the schematic diagram under different conditions. Four groups of control experiments were made, and experiments were carried out under four different conditions (1) 0 nM miR-21, 0 nM Bcl-2 mRNA; (2) 100 nM miR-21, 0 nM Bcl-2 mRNA; (3) 0 nM miR-21, 100 nM Bcl-2 mRNA; (4) 100 nM miR-21, 100 nM Bcl-2 mRNA, and then placed in a fluorescence spectrophotometer to detect. Under the condition of 485 nm excitation wavelength, the fluorescence spectrum in the range of 500 nm-650 nm was recorded.
[0029] The results are shown in Figure 3 As shown in B, whether miR-21 or Bcl-2 mRNA is added, there is no obvious fluorescence signal, but when miR-21 and Bcl-2 mRNA are added to the reaction system at the same time, the quenching group (BHQ1) falls off from the H2 complex, so the FAM fluorescence group is excited, and an obvious fluorescence spectrum signal can be detected at 520 nm. Figure 3 C result quantification Figure 3 The fluorescence spectrum signal intensity in B shows that only when miR-21 and Bcl-2 mRNA exist at the same time, the reaction process can produce experimental results with fluorescence signal intensity obviously higher than that of other treatment groups. Therefore, the above results show that the reaction can proceed smoothly according to the steps in the design principle.
[0030] Example 4 Sensor analysis performance 1. Response to miR-21 concentration Under the condition of 100 nM Bcl-2 mRNA, the concentration of miR-21 was changed (0-100 nM), and then the fluorescence spectrum value was recorded. Under the condition of 100 nM Bcl-2 mRNA, with the increasing of the concentration of miR-21 (0-100 nM), the fluorescence signal intensity released by the MDTN structure showed a concentration-dependent manner with miR-21 Figure 4 A、 Figure 4 B) The detection limit is 7.27 pM.
[0031] 2. Specificity to miR-21 Under the condition of 100 nM Bcl-2 mRNA, the following sequences were added to the reaction system respectively: miR-21 (SEQ ID NO: 10): UAGCUUAUCAGACUGAUGUUGA; miR-21 1-Mut (SEQ ID NO: 11): UAGCUUAUCAGUCUGAUGUUGA; miR-21 2-Mut (SEQ ID NO: 12): UAGCUUUUCAGACUGAAGUUGA; miR-21 3-Mut (SEQ ID NO: 13): UAGCAUAUCACACUGAAGUUGA; miR-375 (SEQ ID NO: 14): UUUGUUCGUUCGGCUCGCGUGA; miR-122 (SEQ ID NO: 15): UGGAGUGUGACAAUGGUGUUUG; miR-20a (SEQ ID NO: 16): UAAAGUGCUUAUAGUGCAGGUAG; miR-210 (SEQ ID NO: 17): CUGUGCGUGUGACAGCGGCUGA; Then the fluorescence spectrum value was recorded. When miR-21 and its mismatch sequences (1-Mut, 2-Mut, 3-Mut) and other similar molecules (miR-375, miR-122, miR-20a, miR-210) were added to the reaction system respectively, the fluorescence response signal intensity of the multifunctional DTN structure to miR-21 was significantly higher than that of other experimental groups (Figure 4 C).
[0032] 3. Response to Bcl-2 mRNA concentration Under the condition of 100 nM miR-21, the concentration of Bcl-2 mRNA was changed (0-100 nM), and then the fluorescence spectrum value was recorded. Under the condition of 100 nM miR-21, the fluorescence signal intensity of the multifunctional DTN structure also showed a positive dependence on the concentration of Bcl-2 mRNA (0-100 nM) Figure 4 D, Figure 4 E), and the detection limit was 1.188 pM.
[0033] 4. Specificity to Bcl-2 mRNA Under the condition of 100 nM miR-21, the following sequences were added to the reaction system, respectively: Bcl-2 mRNA (SEQ ID NO: 18): ATGGCGCACGCTGGGAGA; Bcl-2 mRNA 1-Mut (SEQ ID NO: 19): ATGGCGCAGGCTGGGAGA; Bcl-2 mRNA 2-Mut (SEQ ID NO: 20): ATGGGGCACGCTGCGAGA; Bcl-2 mRNA 3-Mut (SEQ ID NO: 21): ATGCCGCACCCTGGGTGA; Bcl-2 mRNA 4Mut (SEQ ID NO: 22): ATCGCGGACGCAGGGTGA; Then the fluorescence spectrum value was recorded.
[0034] When Bcl-2 mRNA and its related mismatch sequences (1-Mut, 2-Mut, 3-Mut, 4-Mut) were added to the reaction system, respectively, the results showed that only in the presence of Bcl-2 mRNA, the multifunctional DTN structure could release a significant FAM fluorescence signal Figure 4 F).
[0035] The above results show that the multifunctional DTN structure has obvious selective specificity for miR-21 and Bcl-2 mRNA, and the fluorescence intensity has a positive correlation with its concentration, indicating that L2 can be successfully released in the presence of the two target substances.
Claims
1. A DNA tetrahedral biosensor, characterized in that, Includes a composite probe, wherein the composite probe is a DNA tetrahedron loaded with a MUC1 aptamer strand, an L1 strand, an H1 hairpin, and an H2-L2 composite hairpin; The molar ratio of the DNA tetrahedron and MUC1 aptamer strand, L1 strand, H1 hairpin and H2-L2 composite hairpin is 1:1:3:3; The DNA tetrahedron is formed by the complementary bases of T1, T2, T3, and T4. The H2-L2 composite hair clip is formed by H2 hairpins and L2 through base complementarity; The nucleotide sequences of T1, T2, T3, T4, MUC1 aptamer chain, L1 chain, H1 hairpin, H2 hairpin and L2 are shown in SEQ ID NO: 1-9, respectively; The H2 hairpin is modified with a fluorescent group at the 12th position of its 3' end; the L2 is modified with a quenching group at its 3' end.
2. The DNA tetrahedral biosensor according to claim 1, characterized in that, The fluorescent group is FAM; the quenching group is BHQ1.
3. A method for preparing a DNA tetrahedral biosensor as described in claim 1 or 2, characterized in that, Includes the following steps: (1) The single-chain H1 and H2 were annealed in a buffer solution to form a hairpin structure, resulting in H1 hairpin and H2 hairpin; (2) T1, T2, T3, T4, MUC1, Apt, and L1 were annealed in a buffer solution in an ice bath to form DNA tetrahedra; (3) Incubate H1 hairpin, H2 hairpin, L2 and DNA tetrahedron in buffer solution to obtain composite probe.
4. A kit for preparing a DNA tetrahedral biosensor as described in claim 1 or 2.
5. The reagent kit according to claim 4, characterized in that, It also includes standard samples of the target object.
6. The DNA tetrahedral biosensor according to claim 1 or 2 and the kit according to claim 4 or 5, characterized in that, This technology is used for tracing and detecting the levels of mi-R21 and Bcl-2 mRNA in cells, tissues, or organisms where MUC1, mi-R21, and Bcl-2 ASO are highly expressed, or in environments where all three coexist.