In-vivo and in-vitro double visual recombinant human coronavirus as well as construction method and application thereof

By inserting Nluc and mCherry reporter genes into the ns2 region of the human coronavirus OC43 genome, and inserting promoters and termination signals at specific positions, a recombinant human coronavirus genome was constructed. This solved the problem of difficulty in achieving dual in vitro and in vivo visualization in existing technologies, and enabled efficient expression and stable passage, making it suitable for drug screening and vaccine research.

CN120905256APending Publication Date: 2025-11-07STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511137202.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-14
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

Existing technologies make it difficult to achieve dual in vitro and in vivo visualization studies of human coronavirus HCoV-OC43, especially due to issues such as large genome size, complex virulence sequences, and the impact of reporter gene insertion on viral replication during the construction process.

Method used

A recombinant human coronavirus genome was constructed by replacing the luciferase reporter gene Nluc and the red fluorescent protein gene mCherry in the ns2 region of the human coronavirus OC43 genome, inserting a CMV promoter at the front of the 5'UTR, and inserting an HDV ribozyme and a BGH termination signal at the tail of the 3'UTR. The recombinant expression was carried out using YAC-BAC reverse genetics technology.

Benefits of technology

It achieves stable and efficient expression of recombinant human coronaviruses, enabling dual visualization in vivo and in vitro, and is suitable for antiviral drug screening and vaccine research, providing a high-throughput, visualized research tool.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905256A_ABST
    Figure CN120905256A_ABST
Patent Text Reader

Abstract

The invention provides an in-vivo and in-vitro double visual recombinant human coronavirus as well as a construction method and application thereof, and belongs to the technical field of recombinant viruses. The invention provides a recombinant human coronavirus genome capable of efficiently expressing dual fluorescence, which is characterized in that on the basis of a human coronavirus OC43 genome, coding sequences of 7-238 amino acids in an ns2 region of the human coronavirus genome are replaced with a luciferase reporter gene Nluc and a red fluorescent protein gene mCherry. According to the invention, a luciferase reporter gene Nluc and a red fluorescent protein reporter gene mCherry are inserted into a human coronavirus OC43 genome in a partial substitution manner to obtain the recombinant human coronavirus genome. The recombinant virus disclosed by the invention can efficiently express luciferase Nluc and red fluorescent protein mCherry, can be stably passed to seven generations, and can meet in-vivo and in-vitro dual visual application.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of recombinant viruses, and particularly relates to a recombinant human coronavirus with in-vivo and in-vitro dual visualization and a construction method and application thereof. BACKGROUND

[0002] Human coronavirus OC43 (HCoV-OC43) belongs to the beta virus in the coronavirus and has the highest detection rate in the human population among the four common coronaviruses, is the most common coronavirus in children's respiratory tract infections, can cause severe infections in immunodeficient patients and infants, and even causes fatal encephalitis, which has important clinical significance. HCoV-OC43 is similar in characteristics to highly pathogenic coronaviruses SARS-CoV-2, SARS-CoV and MERS-CoV, and can be used as a good model for studying coronaviruses in a biosafety level 2 laboratory. Rapid construction of recombinant viruses carrying reporter genes through reverse genetics technology can help overcome the limitations of real-time monitoring difficulties, complicated monitoring steps and low throughput of wild-type viruses, and provide an important technical means for realizing high-throughput, visualized and safe operation of coronavirus research.

[0003] As the largest RNA virus known at present, the genome of coronavirus is relatively large (about 27-32 kb), far exceeding the capacity of many commonly used plasmid vectors. In addition, the presence of toxic sequences in the genome and the complexity of the replicase make the assembly and modification of the full-length genome of coronavirus time-consuming and laborious.

[0004] At present, the infectious cloning platforms applied to coronaviruses mainly include in vitro ligation technology, vaccinia virus vector technology, bacterial artificial chromosome (Bacterial Artificial Chromosome, BAC) technology, yeast artificial chromosome (Yeast Artificial Chromosome) technology, yeast artificial chromosome-bacterial artificial chromosome (Yeast Artificial Chromosome-Bacterial Artificial Chromosome, YAC-BAC) combined technology, circular polymerase extension reaction (Circular Polymerase Extension Reaction, CPER) and infectious subgenomic amplicons (Infectious Subgenomic Amplicons, ISA). However, due to the differences in the genomic structure and toxic sequences of different coronaviruses, there are still certain difficulties in constructing full-length RNA transcripts using the above technologies.

[0005] Reporter genes are commonly used in virology to track viral replication, locate infected cells, and quantify viral load. These genes are usually inserted into non-essential regions of the genome to ensure that they do not affect the virus's ability to replicate, while providing a direct or highly sensitive detection signal. Depending on the detection method, the most widely used reporter genes currently include fluorescent proteins such as EGFP, mCherry, and eYFP, which can be directly observed using a fluorescence microscope. The main advantage of these reporter genes is that they can be used to monitor the spatial and temporal distribution of viral infection in real time and dynamically. In addition, commonly used reporter genes also include enzymes that catalyze the production of chemiluminescence or colorimetric signals, such as Nluc, Rluc, and HiBiT. Due to their high sensitivity and wide dynamic range, they can be used for qualitative analysis of results, making them particularly suitable for high-throughput screening and in vivo infection experiments.

[0006] In 2006, the Talbot team used an in vitro ligation-based technique to construct an infectious clone of HCoV-OC43 VR759 and rescue the virus. Dr. Yang Yang et al. used BAC technology to replace the ns2 and ns12.9 regions of VR759 with reporter genes, and rescued a recombinant virus carrying the green fluorescent reporter gene GFP. However, the virus had poor stability during passage. Dr. Sheng Liang et al. further optimized the reporter gene type, insertion site, and insertion strategy using BAC technology, and constructed an infectious clone of VR759 that could efficiently and stably express Rluc by fusing the reporter gene in the ns2 region. For VR1558, previously constructed recombinant viruses carrying EGFP and Rluc single reporter genes were used. Using an in vitro ligation strategy, the Sheahan research team constructed a Nluc luciferase single reporter gene-carrying HCoV-OC43 VR1558 virus by completely replacing the ns2 region. In addition, research teams in China and Canada used transformation-associated recombination (TAR) technology to insert exogenous genes at the 5' end of the ns12.9 and N proteins, respectively, to construct infectious clones carrying different fluorescent protein reporter genes. However, the current infectious studies of HCoV-OC43 are all single reporter genes, making it difficult to meet the needs of in vivo and in vitro dual visualization research. SUMMARY

[0007] The present application provides a recombinant human coronavirus with in vivo and in vitro dual visualization, as well as a construction method and application. The recombinant human coronavirus can stably and efficiently express luciferase and red fluorescent protein, and can be used for antiviral drug screening and vaccine research, especially for in vivo and in vitro dual visualization research.

[0008] The application provides a recombinant human coronavirus genome, comprising that based on a human coronavirus genome, a coding sequence of amino acids 7-238 in a ns2 region of the human coronavirus OC43 genome is replaced by a luciferase reporter gene Nluc and a red fluorescent protein gene mCherry.

[0009] In a preferred mode of the application, a CMV promoter is inserted at the front of the 5'UTR of the human coronavirus genome, and a HDV ribozyme coding sequence and a BGH termination signal are inserted at the tail of the 3'UTR of the human coronavirus genome.

[0010] In a preferred mode of the application, after the replacement, the nucleotide sequence of the ns2 region of the recombinant human coronavirus genome is shown in SEQ ID No. 45.

[0011] In a preferred mode of the application, the human coronavirus genome comprises a human coronavirus HCoV-OC43 genome.

[0012] The application also provides a primer panel for segmentally cloning the above-mentioned recombinant human coronavirus genome, comprising primer pair F1, primer pair F2, primer pair F3, primer pair F4, primer pair F5, primer pair F6, primer pair F7, primer pair F8, primer pair Nluc-P2A and primer pair P2A-mCherry.

[0013] The nucleotide sequences of the upstream primer and the downstream primer of the primer pair F1 are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively.

[0014] The nucleotide sequences of the upstream primer and the downstream primer of the primer pair F2 are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively.

[0015] The nucleotide sequences of the upstream primer and the downstream primer of the primer pair F3 are shown in SEQ ID No. 5 and SEQ ID No. 6, respectively.

[0016] The nucleotide sequences of the upstream primer and the downstream primer of the primer pair F4 are shown in SEQ ID No. 7 and SEQ ID No. 8, respectively.

[0017] The nucleotide sequences of the upstream primer and the downstream primer of the primer pair F5 are shown in SEQ ID No. 9 and SEQ ID No. 10, respectively.

[0018] The nucleotide sequences of the upstream primer and the downstream primer of the primer pair F6 are shown in SEQ ID No. 11 and SEQ ID No. 12, respectively.

[0019] The nucleotide sequences of the upstream primer and the downstream primer of the primer pair F7 are shown in SEQ ID No. 13 and SEQ ID No. 14, respectively;

[0020] The nucleotide sequences of the upstream primer and the downstream primer of the primer pair F8 are shown in SEQ ID No. 15 and SEQ ID No. 16, respectively;

[0021] The nucleotide sequences of the upstream primer and the downstream primer of the primer pair Nluc-P2A are shown in SEQ ID No. 17 and SEQ ID No. 18, and SEQ ID No. 19, respectively.

[0022] The nucleotide sequences of the upstream primer and the downstream primer of the primer pair P2A-mCherry are shown in SEQ ID No. 20 and SEQ ID No. 21, respectively.

[0023] The present application also provides a recombinant vector comprising the recombinant human coronavirus genome described above.

[0024] The present application also provides a construction method of the recombinant vector described above, comprising the following steps: using a plasmid containing a human coronavirus genome as a template, and using the primer pair F1 and the primer pair F8 in the primer panel described above to perform PCR amplification to obtain two fragments containing transcription elements;

[0025] Using a cDNA of a human coronavirus as a template, and using the primer pair F2, the primer pair F3, the primer pair F4, the primer pair F5, the primer pair F6 and the primer pair F7 in the primer panel described above to perform PCR amplification to obtain six fragments of a full-length gene of a human coronavirus;

[0026] Using a plasmid carrying a luciferase Nluc gene as a template, and using the primer pair Nluc-P2A in the primer panel described above to perform PCR amplification to obtain a luciferase gene Nluc;

[0027] Using a plasmid carrying a fluorescent protein mCherry gene as a template, and using the primer pair P2A-mCherry in the primer panel described above to perform PCR amplification to obtain a red fluorescent protein gene mCherry;

[0028] After mixing the linearized basic vector with the two fragments containing transcription elements, the six gene fragments of the full-length gene of the human coronavirus, the luciferase reporter gene Nluc and the fluorescent protein reporter gene mCherry, the mixture is transformed into a yeast competent cell to perform recombinant expression to obtain the recombinant vector.

[0029] The application also provides a recombinant human coronavirus strain, which comprises the recombinant human coronavirus genome or the recombinant vector or the recombinant vector constructed by the construction method.

[0030] The application also provides a construction method of the recombinant human coronavirus strain, which comprises virus rescue by using the recombinant vector or the recombinant vector constructed by the construction method, to obtain the recombinant human coronavirus strain expressing luciferase Nluc and red fluorescent protein mCherry.

[0031] The application also provides application of the recombinant human coronavirus genome or the primer panel or the recombinant vector or the recombinant human coronavirus strain in antiviral drug screening and / or vaccine preparation.

[0032] Beneficial effects: the application provides a recombinant human coronavirus genome, which comprises replacing the coding sequence of amino acids 7-238 in the ns2 region of the human coronavirus OC43 genome with luciferase reporter gene Nluc and red fluorescent protein gene mCherry based on the human coronavirus genome. The application modifies the ns2 coding region of the human coronavirus OC43 genome, inserts luciferase reporter gene Nluc and red fluorescent protein reporter gene mCherry into the human coronavirus genome by partial substitution, and obtains the recombinant human coronavirus genome.

[0033] The application constructs an HCoV-OC43 VR1558 strain infectious clone carrying Nluc-mCherry reporter gene based on YAC-BAC reverse genetics technology for the first time, and successfully rescues a recombinant virus. The recombinant virus can efficiently express luciferase Nluc and red fluorescent protein mCherry, can be stably passaged to 7 generations, and can meet the dual visualization application in vivo and in vitro. The recombinant virus can be applied to antiviral drug evaluation and animal infection model research, and provides a new tool for the study of the pathogenic mechanism of coronavirus and the research of antiviral vaccines and drugs. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1Figure for rapid construction and verification of pYES1L-HCoV-OC43-Nluc-mCherry, full-length infectious clone of HCoV-OC43 VR1558 strain carrying mCherry reporter gene in Example 1, wherein A is the overall research design process of pYES1L-HCoV-OC43-Nluc-mCherry, B is 10 PCR amplified fragments of HCoV-OC43 infectious clone carrying Nluc-mCherry; C is a yeast single colony, positive clone PCR product nucleic acid gel electrophoresis map verified by colony PCR, and yeast plasmid identification nucleic acid gel electrophoresis map; D is an E. coli single colony, nucleic acid gel electrophoresis map of PCR product of positive clone verified by colony PCR after culture amplification and small extraction, and nucleic acid gel electrophoresis map of E. coli plasmid identification;

[0035] Figure 2 Figure for rescue and verification of rOC43-N-m, recombinant virus of HCoV-OC43 VR1558 strain carrying Nluc-mCherry reporter gene in Example 2, wherein A is the mCherry expression and CPE result of P0 generation of recombinant virus; B is the change of nucleic acid copy number in supernatant of cells transfected with HCoV-OC43 infectious clone carrying Nluc-mCherry; C is the Nluc activity detection result after transfection of HCoV-OC43 infectious clone carrying Nluc-mCherry;

[0036] Figure 3 Figure for biological identification of rOC43-N-m in Example 3, wherein A is the indirect immunofluorescence method for detecting the infectivity of rOC43-N-m P5 in BHK-21 cells; B is the Western blot method for detecting the infectivity of rOC43-N-m P5 in BHK-21 cells; C is the comparison of plaque size and morphology of recombinant virus and wild type VR1558 strain on Mv.1Lu cells; D is the comparison of immunoplaque morphology of recombinant virus and wild type VR1558 strain on BHK-21 cells;

[0037] Figure 4 Figure for replication kinetics infection characteristics of recombinant virus rOC43-N-m in BHK-21 cells in Example 4, wherein A is the mCherry expression of replication kinetics of recombinant virus rOC43-N-m and wild type VR1558 strain in BHK-21 cells; B is the replication kinetics and CPE of recombinant virus rOC43-N-m and wild type VR1558 strain in BHK-21 cells;

[0038] Figure 5Figure 4 is a graph showing the results of replication kinetics analysis of the recombinant virus rOC43-N-m and wild-type VR1558 strain in BHK-21 cells, wherein A is the Nluc activity detection reading of the recombinant virus and wild-type VR1558 strain; B is the RT-qPCR result; C is the TCID 50 results of the recombinant virus rOC43-N-m; D is the correlation analysis between the Nluc activity detection result of the recombinant virus rOC43-N-m and the nucleic acid copy number result of RT-qPCR; E is the correlation analysis between the Nluc activity detection result of the recombinant virus rOC43-N-m and the TCID 50 results of the recombinant virus rOC43-N-m and wild-type VR1558; F is the correlation analysis between the live virus titration results of the recombinant virus rOC43-N-m and wild-type VR1558;

[0039] Figure 6 Figure 5 is a graph showing the results of replication kinetics infection characteristics of the recombinant virus rOC43-N-m in HRT-18 cells in Example 4, wherein A is the mCherry expression of the replication kinetics of the recombinant virus rOC43-N-m and wild-type VR1558 strain in BHK-21 cells; B is the replication kinetics and CPE of the recombinant virus rOC43-N-m and wild-type VR1558 strain in BHK-21 cells;

[0040] Figure 7 Figure 6 is a graph showing the results of replication kinetics analysis of the recombinant virus rOC43-N-m and wild-type VR1558 strain in HRT-18 cells in Example 4, wherein A is the Nluc activity detection reading of the recombinant virus and wild-type VR1558 strain; B is the RT-qPCR result; C is the TCID 50 results of the recombinant virus rOC43-N-m; D is the correlation analysis between the Nluc activity detection result of the recombinant virus rOC43-N-m and the nucleic acid copy number result of RT-qPCR; E is the correlation analysis between the Nluc activity detection result of the recombinant virus rOC43-N-m and the TCID 50 results of the recombinant virus rOC43-N-m and wild-type VR1558; F is the correlation analysis between the live virus titration results of the recombinant virus rOC43-N-m and wild-type VR1558;

[0041] Figure 8Figure for the results of the passage stability of the recombinant virus rOC43-N-m in Example 4, wherein A is the mCherry expression of the rOC43-N-m recombinant virus at different passages; B is the Nluc activity detection results of the rOC43-N-m recombinant virus at different passages; C is the mCherry agarose gel electrophoresis results of the rOC43-N-m recombinant virus at different passages; D is the Nluc agarose gel electrophoresis results of the rOC43-N-m recombinant virus at different passages; E is the Sanger sequencing results of mCherry and Nluc of the rOC43-N-m recombinant virus at different passages; F is the virus titer results of the rOC43-N-m at different passages;

[0042] Figure 9 Figure for the results of the in vivo biological characteristics of the recombinant virus rOC43-N-m in the mouse model in Example 5, wherein A is the Nluc fluorescence signal change of the rOC43-N-m recombinant virus intracranial infection of BALB / c mice in vivo imaging; B is the in vivo imaging numerical analysis of the Mock group and the challenge group; C is the Nluc expression of the Mock group and the challenge group brain, lung, heart, liver, spleen, kidney, intestine tissue; D is the Nluc expression numerical analysis of the challenge group brain, lung, intestine tissue at 24, 72, 120h after infection; E is the viral nucleic acid copy number load of each tissue at different infection time points after intracranial infection of rOC43-N-m in the Mock group and the challenge group;

[0043] Figure 10 Figure for the results of the in vivo biological characteristics of the recombinant virus rOC43-N-m in the mouse model in Example 5, wherein A is the pathological changes of the mouse brain tissue after 24, 72, 120h of viral infection and the tissue condition after 120h of PBS injection; B is the pathological changes of the mouse lung tissue after 24, 72, 120h of viral infection and the tissue condition after 120h of PBS injection; C is the pathological changes of the mouse intestine tissue after 24, 72, 120h of viral infection and the tissue condition after 120h of PBS injection;

[0044] Figure 11 Figure for the results of the in vivo biological characteristics of the recombinant virus rOC43-N-m in the mouse model in Example 5, wherein A is the pathological changes of the mouse liver tissue after 24, 72, 120h of viral infection and the tissue condition after 120h of PBS injection; B is the pathological changes of the mouse spleen tissue after 24, 72, 120h of viral infection and the tissue condition after 120h of PBS injection; C is the pathological changes of the mouse kidney tissue after 24, 72, 120h of viral infection and the tissue condition after 120h of PBS injection;

[0045] Figure 12Fig. 6 is a graph showing the results of in vivo imaging of intracranial infection of the recombinant virus rOC43-N-m in an adult mouse model in Example 5, wherein A is the back in vivo imaging results of Mock group and challenge group mice every 24 h after intracranial injection; B is the abdominal in vivo imaging results of Mock group and challenge group mice every 24 h after intracranial injection; C is the back in vivo imaging results of Mock group and challenge group mice every 24 h after intranasal infection; D is the abdominal in vivo imaging results of Mock group and challenge group mice every 24 h after intranasal infection;

[0046] Figure 13 Fig. 7 is a graph showing the application analysis results of the recombinant virus in the pharmacodynamics evaluation of remdesivir (RDV) in Example 6, wherein A is the mCherry fluorescence image of RDV in vitro against rOC43-N-m; B is the Nluc activity determination effect evaluation of RDV in vitro against rOC43-N-m; C is the RT-qPCR method for determining the in vitro antiviral effect evaluation of RDV; D is the correlation between the Nluc activity determination and the viral nucleic acid copy number results of the recombinant virus; E is the correlation between the nucleic acid copy number results of the recombinant virus and the wild type virus.

[0047] Figure 14 Fig. 8 is a graph showing the application analysis results of the recombinant virus in the pharmacodynamics evaluation of chloroquine (CQ) in Example 6, wherein A is the mCherry fluorescence image of CQ in vitro against rOC43-N-m; B is the Nluc activity determination effect evaluation of CQ in vitro against rOC43-N-m; C is the RT-qPCR method for determining the in vitro antiviral effect evaluation of CQ; D is the correlation between the Nluc activity determination and the viral nucleic acid copy number results of the recombinant virus; E is the correlation between the nucleic acid copy number results of the recombinant virus and the wild type virus. DETAILED DESCRIPTION

[0048] The present application provides a recombinant human coronavirus genome, comprising replacing the coding sequence of amino acids 7-238 in the ns2 region of the human coronavirus genome with a luciferase reporter gene Nluc and a red fluorescent protein gene mCherry based on the human coronavirus genome.

[0049] In one embodiment of the present application, the human coronavirus HCoV-OC43 genome is used as the basis for modification, and the human coronavirus HCoV-OC43 VR1558 strain is a passage-adapted strain WT P5 of the recombinant virus, and its genomic information has been disclosed in the article (Ye F, Wang N, Guan Q, Wang M, Sun J, Zhai D, Huang B, Zhao Y, Tan W. Rapid generation and characterization of recombinant HCoV-OC43-VR1558 infectious clones expressing reporter Renilla luciferase. Biosaf Health. 2024 Nov 19; 6(6): 350-360.).

[0050] In one embodiment of the present application, the human coronavirus HCoV-OC43 genome is used as the basis for modification, and the human coronavirus HCoV-OC43 VR1558 strain is a passage-adapted strain WT P5 of the recombinant virus, and its genomic information has been disclosed in the article (Ye F, Wang N, Guan Q, Wang M, Sun J, Zhai D, Huang B, Zhao Y, Tan W. Rapid generation and characterization of recombinant HCoV-OC43-VR1558 infectious clones expressing reporter Renilla luciferase. Biosaf Health. 2024 Nov 19; 6(6): 350-360.).

[0051] The CMV promoter, HDV ribozyme and BGH termination signal in the application are amplified by using primer pair F1-F and F1-R (SEQ ID No. 1 and SEQ ID No. 2) as templates and pBAC-OC43-ns2DelRLUC vector as templates, and using F8-F and F8-R (SEQ ID No. 15 and SEQ ID No. 16) to amplify the HDV ribozyme and BGH termination signal. The pBAC-OC43-ns2DelRLUC vector has been disclosed in the literature (Shen L, Yang Y, Ye F, Liu G, Desforges M, Talbot PJ, Tan W. Safe and Sensitive Antiviral Screening Platform Based on Recombinant Human Coronavirus OC43 Expressing the Luciferase Reporter Gene. Antimicrob Agents Chemother. 2016 Aug 22; 60(9): 5492-503.).

[0052] The application also provides a primer panel for cloning the recombinant human coronavirus genome, which comprises primer pair F1, primer pair F2, primer pair F3, primer pair F4, primer pair F5, primer pair F6, primer pair F7, primer pair F8, primer pair Nluc-P2A and primer pair P2A-mCherry. The primer information of each primer pair is shown in Table 1.

[0053] Table 1 Primer for constructing HCoV-OC43 VR1558 infectious clone

[0054]

[0055] The application also provides a kit for cloning the recombinant human coronavirus genome, which comprises the above-mentioned primer panel and PCR amplification reagents. The source and specification of the PCR amplification reagents are not particularly limited in the application, and conventional PCR amplification reagents in the art can be used. As an embodiment, the kit further comprises bacterial artificial chromosome (BAC) related reagents and / or yeast artificial chromosome (YAC) related reagents, i.e., the application uses BAC, YAC or BAC and YAC in combination to clone the genome of the recombinant coronavirus OC43. The composition of the artificial chromosome related reagents and the yeast artificial chromosome related reagents is not particularly limited in the application, and conventional artificial chromosome related reagents and yeast artificial chromosome related reagents in the art can be used.

[0056] The application also provides a recombinant vector comprising the recombinant human coronavirus genome.

[0057] The basic vector of the recombinant vector can be a plasmid vector, such as YAC-BAC shuttle plasmid pYES1L selected as the basic vector in an embodiment.

[0058] The application also provides a construction method of the recombinant vector, comprising the following steps: using a plasmid containing a human coronavirus genome as a template, and performing PCR amplification on primer pair F1 and primer pair F8 in the above-mentioned primer panel to obtain two fragments containing transcription elements;

[0059] Using the cDNA of the human coronavirus as a template, PCR amplification is performed on primer pair F2, primer pair F3, primer pair F4, primer pair F5, primer pair F6 and primer pair F7 in the above-mentioned primer panel to obtain six fragments of the full-length gene of the human coronavirus;

[0060] Using a plasmid carrying the luciferase Nluc gene as a template, PCR amplification is performed on primer pair Nluc-P2A in the above-mentioned primer panel to obtain the luciferase gene Nluc;

[0061] Using a plasmid carrying the fluorescent protein mCherry gene as a template, PCR amplification is performed on primer pair P2A-mCherry in the above-mentioned primer panel to obtain the red fluorescent protein gene mCherry;

[0062] The linearized basic vector is mixed with the two fragments containing transcription elements, the six fragments of the full-length gene of the human coronavirus, the luciferase reporter gene Nluc and the fluorescent protein reporter gene mCherry, and then transformed into a yeast competent cell for recombinant expression to obtain the recombinant vector.

[0063] The system for PCR amplification comprises, calculated in 100 μL: 2×PrimeSTAR Buffer 50 μL, 4 μL of each of the upstream primer and the downstream primer, 100 ng of template cDNA and 40 μL of ddH2O. The program for PCR amplification comprises: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 60℃ annealing for 15 s, 72℃ extension for 50 s, 40 cycles; and 72℃ re-extension for 5 min.

[0064] The linearized plasmid vector of the present application can be a commercial linearized plasmid vector, such as YAC-BAC shuttle plasmid pYES1L (Cat No: A13287, purchased from ThermoFisher Scientific) selected in an embodiment, and the fragments used for transformation are mixed in equal amounts, such as 100 ng in the embodiment. And for recombinant expression, the yeast competent cell of the present application is MaV203 yeast competent cell. The method of transformation of the present application is not particularly limited, such as the lithium acetate transformation method used in the embodiment for the transformation of the yeast competent cell. After the transformation, the present application further comprises inoculating the transformed yeast competent cell into a tryptophan-deficient solid medium for screening of positive plasmid clones, and then obtaining the recombinant plasmid.

[0065] The present application also provides a recombinant human coronavirus strain, comprising the recombinant human coronavirus genome or the recombinant vector or the recombinant vector constructed by the construction method described above.

[0066] The recombinant human coronavirus strain rHCoV-OC43-Nluc-mCherry (abbreviated as rOC43-N-m) is constructed by improving the human coronavirus OC43 described above, which can efficiently express Nluc and mCherry and can be stably passaged.

[0067] The present application also provides a construction method of the recombinant human coronavirus strain described above, comprising virus rescue using the recombinant vector described above or the recombinant vector constructed by the construction method described above, to obtain the recombinant human coronavirus strain expressing luciferase Nluc and red fluorescent protein mCherry.

[0068] The present application carries out the virus rescue by the method of co-culturing BHK-21 cells and 293T-ACE2 cells, such as in an embodiment, the recombinant vector is transfected into a co-cultured cell line of BHK-21 cells and 293T-ACE2 cells for culture, and the virus supernatant is collected every 24 hours for red fluorescence observation and CPE observation, to obtain the recombinant coronavirus efficiently expressing luciferase and red fluorescent protein. The specific process of transfection of the present application is not particularly limited, and the steps of conventional cell transfection in the art can be used.

[0069] The present application also provides the application of the recombinant human coronavirus genome or the primer panel or the recombinant vector or the recombinant human coronavirus strain described above in antiviral drug screening and / or vaccine preparation.

[0070] The recombinant virus described in this invention can efficiently and stably express two fluorescent proteins, meeting the requirements for in vivo and in vitro visualization detection. Therefore, it can be used for screening corresponding antiviral drugs and preparing vaccines. The antiviral drugs described in this invention can be drugs against coronaviruses, such as drugs against human coronaviruses, especially drugs against human coronavirus OC43. The vaccines described in this invention can be vaccines against coronaviruses, such as vaccines against human coronaviruses, especially vaccines against human coronavirus OC43.

[0071] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, provides an efficient recombinant human coronavirus expressing dual fluorescence, its construction method, and its applications. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0072] Example 1

[0073] Construction of an infectious clone of HCoV-OC43 VR1558 carrying Nluc-mCherry dual reporter genes

[0074] 1.1 Obtaining fragments of the full-length infectious clone of HCoV-OC43 carrying the Nluc-mCherry gene

[0075] The specific construction process is as follows: Figure 1 As shown in Figure A, the whole genome sequence of HCoV-OC43 VR1558 strain WT P5 was genetically modified using the YAC-BAC shuttle plasmid pYES1L as a vector. An early CMV promoter (obtained by primer pair F1 amplification) was added to the front of the 5' UTR of the genome sequence, while an HDV ribozyme and a BGH termination signal (obtained by primer pair F8 amplification) were designed and added to the tail of the 3' UTR. Nucleotides encoding amino acids 7–238 of the ns2 region were deleted, and Nluc-P2A-mCherry was inserted into this region (the nucleotide sequence of the modified ns2 region is shown in SEQ ID No. 45). To ensure effective ligation between gene fragments, homologous sequences of 47 bp–152 bp were preserved between adjacent fragments.

[0076] Based on the primer pairs shown in Table 1, the full-length genome sequence was divided into 10 fragments, F1 to F8, Nluc, and mCherry, for amplification.

[0077] The HCoV-OC43 VR1558 strain WT P5 RNA (a passage product of a recombinant virus rescued by the inventor team, the construction and rescue process has been disclosed in the literature: Ye F, Wang N, Guan Q, Wang M, Sun J, Zhai D, Huang B, Zhao Y, Tan W. Rapid generation and characterization of recombinant HCoV-OC43-VR1558 infectious clones expressing reporter Renilla luciferase. Biosaf Health. 2024 Nov 19; 6(6): 350-360.) was extracted by Viral RNA Mini kit (Qiagen, Cat No. 52904), and reverse transcribed by Invitrogen Superscript IV reverse transcription system to prepare HCoV-OC43 VR1558 full-length cDNA, and placed in a refrigerator at -20°C for standby.

[0078] When amplifying F1 and F8 fragments, pBAC-OC43-ns2DelRLUC was used as a template, and two pairs of primers F1-F / F1-R and F8-F / F8-R were used for amplification; when amplifying F2 to F7 fragments, HCoV-OC43 VR1558 WT P5 cDNA was used as a template, and six pairs of primers F2-F / F2-R, F3-F / F3-R, F4-F / F4-R, F5-F / F5-R, F6-F / F6-R, and F7-F / F7-R were used for amplification; the reaction system was 2x PrimeSTAR Buffer 50 μL, 4 μL of each of the upstream and downstream primers, 100 ng of template, and 40 μL of ddH2O. The reaction program was 98°C for 2 min; 98°C for 10 s, 60°C for 15 s, 72°C for 50 s, for 40 cycles; 72°C for 5 min. The fragments obtained by PCR were purified, and the concentration was determined using a Qubit kit.

[0079] The Nluc fragment and the mCherry fragment were amplified using the Nluc plasmid (which has been disclosed in the article: Wang T, Zhan Y, Wu D, Chen Z, Wu W, Deng Y, Wang W, Tan W, Tang S. Development and Evaluation of a Universal and Supersensitive NS1-Based Luciferase Immunosorbent Assay to Detect Zika Virus-Specific IgG. Virol Sin. 2020 Feb;35(1):93-102.) and the mCherry plasmid (which has been disclosed in the article: Sun J, Huang B, Wang M, Wu Y, Chu Q, Huo S, Zhao L, Zhai D, Deng Y, Zhao Y, Tan W. Construction and in vitro application of recombinant vaccinia virus WR strain carrying Fluc and mCherry double reporter genes [J]. Acta Microbiologica Sinica, 2024, 64(12): 4789-4803) as templates, and the primers Nluc-P2A-F / Nluc-P2A-R and P2A-mCherry-F / P2A-mCherry-R were designed for amplification. The same PCR amplification system and procedure as described above were used for PCR amplification, and the 10 subgenomic fragments obtained were as shown in Figure 1 Fig. B.

[0080] 1.2 Recombination of full-length cDNA fragments in yeast system

[0081] MaV203 yeast competent cells were used, and lithium acetate was used to destroy the β-glucan in the cell wall, making the cell wall fragile, so that the foreign DNA could effectively penetrate the cell wall into the cytoplasm. In the yeast cells, the homologous sequences of the foreign DNA recombined and then assembled into a full-length plasmid.

[0082] A mixture containing 100 ng of linearized vector pYES1L and cDNA fragments F1-F8, Nluc and mCherry was added to MaV203 yeast competent cells, and the tube wall was gently shaken to mix. Then, 36 μL of PEG / LiAc solution was added and gently inverted for 6-8 times, incubated at 30°C for 30 min; 36 μL of DMSO was added and gently inverted for 5-8 times, incubated at 42°C for 20 min; after heat shock treatment, centrifuged at 1800 rpm for 5 min, and the supernatant was carefully discarded. Then, 1 mL of YPDA medium was added, and the cells were resuscitated on a shaker at 30°C for 1 h; centrifuged and resuspended and spread on SD / Trp solid medium, and cultured at 30°C (Fig. C, left). Figure 1

[0083] ​1.3 Identification of yeast positive clones and amplification in E. coli

[0084] Single colonies were picked and colony PCR was performed using primers designed in Table 2 to screen positive clones. The junction PCR products are shown in Figure 1 Table 1.3. Positive colonies were further amplified and plasmids were extracted using a yeast plasmid maxi kit (Qiagen) and quantified using a Qubit kit. Figure 1

[0085] Due to the low copy number of yeast, the YAC plasmid was transformed into E. coli for amplification. In this study, the recombinant plasmid was introduced into Stbl4 E. coli electrocompetent cells using a Bio-Rad Gene Pulser II Xcell electroporator with the following parameters: 1.2 kV, 200 Ω, and 25 μF. The cells were spread on LB plates containing spectinomycin (0.05 mg / mL) and incubated at 30 °C (Table 1.4, left). The positive clones were further verified by colony PCR (Table 1.4, middle). The positive clones were amplified and plasmids were extracted (Table 1.4, right) and quantified using a Qubit kit. The plasmid was named pYES1L-HCoV-OC43-Nluc-mCherry. Figure 1 Figure 1 Figure 1

[0086] Table 2. Colony PCR primers

[0087]

[0088] Example 2

[0089] Rescue of HCoV-OC43 VR1558 strain recombinant virus carrying Nluc-mCherry

[0090] 2.1 Rescue of recombinant virus

[0091] The co-culture strategy of BHK-21 and 293T cells (purchased from ATCC, catalog numbers CCL-10 and CRL3216, respectively) was used for virus rescue. First, 1 mL of 4 x 10 5 cells / mL BHK-21 cell suspension and 1 mL of 4 x 10 5 ​​​​mL of 293T cell suspension. Subsequently, the cells were placed in a 37℃ constant temperature incubator with 5% CO2 overnight. When the cell confluence reached about 80%, plasmid transfection was performed using Lipofectamine 3000 reagent. The dynamic changes of viral nucleic acid copy number were monitored by aspirating 100 μL of supernatant every day. 72 h after transfection, fresh DMEM containing 2% FBS was used as maintenance liquid, and the cells were transferred to a 33℃ constant temperature incubator with 5% CO2 for further culture for 72 h. The cells and supernatant were harvested after the virus liquid obtained by freeze-thawing was defined as P0 generation, named rHCoV-OC43-Nluc-mCherry (abbreviated as rOC43-N-m).

[0092] 2.2 Passage and amplification of recombinant virus

[0093] When the HRT-18 cells (professor Zhao Jinchuan of Guangzhou Medical University, ATCC number CCL-244) grew to a confluence of 90%, the virus liquid was diluted to a multiplicity of infection (MOI) of 0.01, inoculated into the cells, and cultured in a 33℃ constant temperature incubator with 5% CO2. When about 90% of the cells were observed to have obvious pathological changes, the cell supernatant was harvested. The supernatant was harvested by centrifugation at 3000 rpm for 10 min at 4℃ and stored in a -80℃ refrigerator for standby use.

[0094] 2.3 Titration of recombinant virus

[0095] The virus titer determination was performed using BHK-21 cells in a 96-well plate. 2×10 4 cells were added to each well, 100 μL / well, and cultured in an incubator at a 5% CO2 concentration and a temperature of 37℃ until the cell density reached a confluence of 80%-90%. Serum-free DMEM was used as a diluent, and the virus stock solution was diluted according to a 10-fold concentration gradient to 1×10 2 - 1×10 8 times, with 6 replicate wells for each concentration, and 100 μL of virus diluent was added to each well. At the same time, a control group was set up, and 100 μL of serum-free DMEM was added to each group. After inoculation of the virus, the cell pathological changes were observed and recorded daily. On the 6th day after inoculation, the number of wells with cell pathological changes at each concentration was counted, and the TCID 50 value of the virus was calculated using the Reed-Muench formula.

[0096] 2.4 Extraction of recombinant virus nucleic acid and RT-qPCR detection

[0097] Viral RNA Minikit (Qiagen, item number 52904) was used to extract viral RNA according to the operation steps in the instruction manual. The N gene was used as the detection target, and the primer probe sequences are shown in Table 3. AgPath-IDTM One-Step RT-qPCR Reagents kit according to the manufacturer's instruction. The nucleic acid copy number was calculated by standard curve CT=33.616-3.404lg(copies / μL). The RT-qPCR results are shown in Figure 2 Figure 2B, the viral nucleic acid copy number in the supernatant increased from 3x10 4 copies / μL to 7x10 4 copies / μL at 120-144h post transfection, indicating that the virus replicated.

[0098] Table 3 Primers and probes for HCoV-OC43 N gene

[0099] Name Number Primer sequence (5'-3') HCoV-OC43 F SEQ ID No. 42 GCTCAGGAAGGTCTGCTCC HCoV-OC43 R SEQ ID No. 43 TCCTGCACTAGAGGCTCTGC HCoV-OC43 probe SEQ ID No. 44 FAM-TTCCAGATCTACTTCGCGCACATCC-TAMRA

[0100] 2.5 Recombinant virus Nluc activity detection

[0101] Luciferase detection reagent and transfection samples were equilibrated to room temperature. Luciferase detection reagent was prepared according to the manufacturer's instruction. Equal volume of detection reagent was added to samples, mixed well, and incubated at room temperature for 5min. Luminescence signal was detected. The results are shown in Figure 3C, the Nluc readout of transfection product reached 2.8x10 5 RLU, while the readout of wild type VR1558 strain and Mock were less than 10 RLU, further indicating that the virus was rescued successfully. Figure 2

[0102] Example 3

[0103] Biological characteristics of HCoV-OC43 VR1558 strain carrying Nluc-mCherry dual reporter gene in vitro

[0104] 3.1 Indirect immunofluorescence assay (IFA) to verify viral protein expression

[0105] ​BHK-21 cells were infected with either wild-type VR1558 strain (i.e. HCoV-OC43 VR1558 strain) or recombinant virus (rOC43-N-m) at MOI = 0.1, respectively, and washed once with pre-chilled phosphate-buffered saline (PBS) after 72 h. 400 μL of 4% tissue cell fixative was added to each well, and the fixative was discarded after 30 min of fixation at room temperature, followed by 3 times of PBS washing to remove residual paraformaldehyde. 100 μL of PBS containing 0.1% Triton X-100 was added to each well, and the membrane was permeabilized for 10 min at room temperature. The PBS washing was repeated 3 times, and 100 μL of blocking solution containing 10% normal goat serum was added to each well for incubation at room temperature for 30 min. After completion of the blocking, 50 μL of NP protein antibody (HCoV-OC43 N protein rabbit polyclonal antibody, purchased from Yikai Shenzhou Company, 40643-T62-100) diluted to 1:1000 was added to each well for incubation at 4°C overnight. The primary antibody was removed the next day, and the PBS washing was repeated 3 times. Subsequently, 50 μL of secondary antibody (FITC-labeled anti-rabbit antibody, purchased from Abeam Company) diluted to 1:1000 was added to each well for incubation at room temperature in the dark for 45 min. The PBS washing was repeated 3 times, and 100 μL of 5 μg / mL DAPI solution was added to each well for staining for 10 min. After the PBS washing was repeated, the sample was mounted with glycerol-bicarbonate buffer. Finally, the sample was observed and analyzed in detail using a Leica TCS FP8 confocal microscope.

[0106] The rOC43-N-m and VR1558 strain were synchronously subjected to immunofluorescence identification to evaluate the protein expression of N Protein and mCherry. The results are shown in Figure 3 As shown in FIG. A, the wild-type VR1558 strain could only detect the green fluorescent signal of N Protein protein after infecting BHK-21 cells. In contrast, rOC43-N-m could not only detect the green fluorescent signal of N Protein protein by IFA, but also directly observe the expression of mCherry red fluorescent protein under a microscope without the complex process of immunofluorescence.

[0107] 3.2 Western Blot (WB) analysis to verify the expression of viral proteins

[0108] Western blot analysis, BHK-21 cells were inoculated with 0.01 MOI dose, 72 h post-infection, cell pellets were collected, and subjected to SDS-PAGE gel electrophoresis, and electro-transferred to nitrocellulose membrane (NC membrane). Subsequently, the NC membrane was blocked with 5% skim milk-PBS buffer at room temperature for 2 h. The membrane was incubated with 1:1000 diluted N Protein antibody (HCoV-OC43 N protein rabbit polyclonal antibody, purchased from Yikuo Shenzhou Company, 40643-T62-100) at 4°C overnight. After incubation, the membrane was washed with PBST (phosphate buffer containing Tween-20) for 3 times, 10 min each time. Then, 1:1000 diluted secondary antibody (HRP-labeled goat anti-rabbit secondary antibody, purchased from Thermo Fisher, item number 31460) was used for incubation at room temperature for 1 h in the dark. After incubation, the membrane was washed with PBST for 3 times, 10 min each time. The membrane was scanned and imaged to detect the expression level of the target protein. The results are shown in Figure 3 As shown in FIG. 3B, both Nluc and mCherry proteins can be expressed after the recombinant virus carrying Nluc-mCherry reporter gene infects BHK-21 cells.

[0109] 3.3 Plaque assay of recombinant virus

[0110] Mv.1Lu cells (purchased from the Chinese Academy of Sciences Typical Culture Collection Cell Library, catalog number GNO 8) were inoculated in a 24-well plate at a density of 2 x 10 5 cells per well, and cultured to 90%; the virus was diluted by 10 times, 500 μL of virus liquid corresponding to the dilution degree was added to each well, adsorbed at 33°C for 2 h, the virus liquid was discarded, the negative well discarded the culture medium, and 500 μL of 2% FBS DMEM was used to dilute the sterile 1.5% Avicel to 0.6%, 500 μL per well, incubated in a 5% CO2 incubator at 33°C for 6 days. Discard the covering liquid, add 500 μL / well 1% crystal violet, discard after 30 min, and wash slowly with PBS. After drying, observe. The results are shown in Figure 3 As shown in FIG. 3C, compared with wild-type VR1558, the plaque of rOC43-N-m is smaller, indicating that the partial replacement of ns2 may affect the plaque formation characteristics of HCoV-OC43.

[0111] 3.4 Immunoplaque assay of recombinant virus

[0112] BHK-21 was inoculated at a density of 2 x 10 4 cells per well, 100 μL per well, in a 5% CO2 and 37°C incubator, until the cell density reached 80%-90% confluence. The virus stock was diluted by 10 times in serum-free DMEM to 1 x 10 1 - 1 x 10 750 μL of the solution was seeded onto a cell monolayer and incubated at 33°C for 2 hours. After incubation at 33°C for 48 hours, the cells were fixed with 4% tissue cell fixative at room temperature for 30 minutes, followed by FFA immunostaining. Results are shown below. Figure 3 As shown in Figure D, the immune plaques of rOC43-Nm were also smaller compared to the wild-type VR1558 strain.

[0113] Example 4

[0114] In vitro biological characteristics of recombinant virus of HCoV-OC43 VR1558 carrying Nluc-mCherry

[0115] 4.1 Determination of Replication Kinetics of Recombinant Virus

[0116] BHK-21 and HRT-18 cells were packed at 4 × 10⁶ cells per well. 5 Cells were seeded at a density of 1,000 cells per well in 24-well plates. When the cells reached 90% confluence, the recombinant virus rOC43-Nm and the wild-type VR1558 strain were separately inoculated at 0.01 MOI TCID50. 50 BHK-21 and HRT-18 cells were infected. The culture medium was changed 2 hours after virus adsorption, recorded as infection time 0h. Subsequently, CPE and mCherry red fluorescence expression were observed every 24 hours to understand the viral infection and replication characteristics; infected cells and supernatant samples were collected simultaneously for up to 168 hours. All collected samples underwent Nluc luciferase activity assays, RT-qPCR, and TCID assays using the primers shown in Table 3. 50 The determination was made to clarify the viral replication kinetics and titer.

[0117] Microscopic results in BHK-21 cells are as follows: Figure 4 As shown in Figure A, mCherry red fluorescence begins to be expressed 24 hours after infection, and its fluorescence intensity gradually increases with the extension of infection time, reaching a peak at 120 hours, after which the fluorescence begins to weaken. Bright-field results are shown below. Figure 4 As shown in Figure B, both the recombinant virus rOC43-Nm and the wild-type VR1558 strain showed observable cytopathic effects after infecting BHK-21 cells. Nluc activity, RT-qPCR, and TCID assays were used to analyze the cytopathic effects. 50 The replication kinetics of recombinant virus rOC43-Nm and wild-type VR1558 strain in BHK-21 cells were compared using various indicators. Nluc activity assay results are as follows: Figure 5 As shown in Figure A, rapid proliferation of luciferase was observed in rOC43-Nm 24–48 h after infection with BHK-21, reaching a peak of 2.52 × 10⁻⁶ h. 6RLU), followed by a plateau phase lasting up to 168 hours. RT-qPCR results are as follows. Figure 5 As shown in Figure B, both the rOC43-Nm recombinant virus and the VR1558 strain reached their peak counts at 72 hours, with the recombinant virus reaching a peak nucleic acid copy number of 1.23 × 10⁻⁶. 9 The peak level of VR1558 virus was 2.14 × 10 copies / mL. 9 copies / mL. TCID 50 The measurement results are as follows Figure 5 As shown in Figure C, rOC43-Nm and VR1558 viruses reached peak titers 96 hours post-infection, with the wild-type VR1558 strain reaching a peak titer of 4.9 × 10⁻⁶. 6 TCID 50 / mL, while the peak titer of the recombinant virus rOC43-Nm was 5.1×10⁻⁶. 4 TCID 50 / mL. Correlation analysis results are as follows: Figure 5 As shown in Figures D and E, the results of recombinant virus Nluc activity assay are compared with those of RT-qPCR and TCID. 50 All methods showed good correlation (R0). 2 >0.7, P<0.0001). Furthermore, the recombinant virus rOC43-Nm exhibits similar replication kinetics to wild-type VR1558 (…). Figure 5 (F).

[0118] The results in HRT-18 cells are as follows: Figure 6 As shown in Figure A, the mCherry red fluorescence of the recombinant virus begins to be expressed 48 hours after infection, peaks at 144 hours, and then gradually decreases in fluorescence intensity. Bright-field results are shown below. Figure 6 As shown in Figure B, neither the recombinant virus rOC43-Nm nor the wild-type VR1558 strain showed significant lesions in HRT-18 cells within 96 hours of infection. At 120 hours, shrunken cell aggregates began to appear and float on the surface of a monolayer. Further analysis was performed using Nluc activity, RT-qPCR, and TCID assays. 50 The replication kinetics of recombinant virus rOC43-Nm and wild-type VR1558 strain in HRT-18 cells were compared using various indicators. Nluc activity assay results are as follows: Figure 7 As shown in Figure A, the expression level of Nluc gradually increased with the extension of viral infection time, and continued to increase until it reached a peak of 1.61 × 10⁻⁶ h. 6 RLU). RT-qPCR results are as follows: Figure 7 As shown in Figure B, the viral nucleic acid copy number of both reached its peak at 96 hours post-infection, with the peak value of rOC43-Nm being 1.38 × 10⁻⁶. 9copies / mL, and the peak nucleic acid copy number result of wild-type VR1558 was 1.73 x 10 9 copies / mL. TCID 50 titer results are shown in Figure 7 As shown in Fig. 2C, the titers of both recombinant viruses and wild-type VR1558 strain continued to rise with the extension of infection time, and reached the highest value at 144 h, in which the peak result of rOC43-N-m was 6.6 x 10 7 TCID 50 / mL, and the peak titer result of wild-type VR1558 strain was 2.31 x 10 8 TCID 50 / mL. In HRT-18 cells, the Nluc activity detection results were highly correlated with RT-qPCR and TCID 50 with R 2 values of 0.83 and 0.90, respectively Figure 7 in Figs. 2D and 2E). In addition, the recombinant virus rOC43-N-m also had similar replication kinetics curve Figure 7 in Fig. 2F) as wild-type VR1558 strain.

[0119] 4.2 Analysis of the passage stability of recombinant viruses

[0120] The recombinant viruses were continuously passaged in HRT-18 cells at a 0.01 MOI infection dose. The reporter gene expression, viral titer, and whole gene sequence of the recombinant viruses at different passages after continuous passage were analyzed. The results showed that the reporter gene could be stably expressed to P7 Figure 8 in Figs. 3A and 3B), and the results were verified by fragment-specific PCR amplification Figure 8 in Figs. 3C and 3D) and Sanger sequencing Figure 8 in Figs. 3E and 3F) using primers in Table 2.

[0121] Example 5

[0122] Infection model study of HCoV-OC43 VR1558 strain recombinant virus carrying Nluc-mCherry

[0123] 5.1 Infection model study of recombinant viruses in suckling mice

[0124] 7-day-old BALB / c mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. The recombinant viruses were administered to the mice at a dose of 10 5Seven-day-old BALB / c suckling mice were infected via intracranial injection with an infection dose of FFU / 50 μL. A mock group was simultaneously injected with an equal volume of PBS. In vivo imaging and body weight were measured daily. Mice were sacrificed at 24, 72, and 120 h post-infection, and brain, lung, liver, spleen, kidney, and intestinal tissues were harvested for in vitro organ imaging. Each tissue was then divided into two aliquots. One aliquot was placed in a homogenization tube, weighed, and then PBS containing protease inhibitors was added at a concentration of 100 mg / 100 μL. The aliquots were then homogenized in a tissue homogenizer at 4°C. The homogenate was centrifuged at 5000 rpm for 10 min, and the supernatant was collected. 100 μL of the supernatant was used for nucleic acid extraction, and RT-qPCR was performed using the primers shown in Table 3 to detect viral load in the lung tissue. The remaining aliquot was stored at -80°C. The other aliquot was used for histopathological diagnosis of mouse lung tissue.

[0125] In vivo imaging results as follows Figure 9 As shown in Figure A, Nluc fluorescence signals were observed as early as 24 hours after viral infection in the intracranial challenge group. Mice were continuously observed in vivo for 120 hours. Mock mice were included in each in vivo imaging experiment for simultaneous imaging and served as blank controls for data analysis at each time point. Results are as follows... Figure 9 As shown in Figure B, the recombinant virus reached the peak of Nluc fluorescence signal (5.46 × 10⁻⁶) 48 h post-infection. 5 The concentration of rOC43-Nm at 10 p / s initially decreased, then began to decline. No mice showed mortality or weight loss throughout the infection process. These results preliminarily suggest that rOC43-Nm at 10 p / s... 5 At an infection dose of FFU / 50μL, it is not lethal to suckling mice, but in vivo observation can be performed using the Nluc reporter gene to monitor the site and severity of viral infection in real time.

[0126] Pulpy mice were dissected at 24, 72, and 120 hours post-infection, and the isolated organs were imaged. Based on Nluc imaging results, it was clearly observed that the lesions were mainly concentrated in the brain, lungs, and intestinal tissues. Figure 9 (C) This is consistent with the results of in vivo imaging. Furthermore, the fluorescence readings are as follows: Figure 9 As shown in Figure D, the fluorescence signal in brain tissue peaked at 24 hours post-infection and then declined; the fluorescence signal in lung tissue increased at 120 hours post-infection; and the fluorescence intensity in intestinal tissue increased over time. The results of RT-qPCR-based detection of viral RNA copy number in brain, lung, liver, spleen, kidney, and intestinal tissues are shown below. Figure 9 As shown in Figure E, brain tissue reached its peak nucleic acid copy number (3.8 × 10⁻⁶) 24 hours after infection. 6 The viral load initially decreased (copies / g), then declined; the viral load in lung tissue reached 7.9 × 10⁻⁶ at 120 h. 4copies / g; enterovirus load at 120h was 4.5×10 4 The viral load in the liver, spleen, and kidney tissues remained consistently low (<10 copies / g). 3 The nucleic acid copy number in different tissue sites showed a consistent trend with the imaging results of in vivo and ex vivo organs.

[0127] Brain, lung, intestine, liver, spleen, and kidney tissues from mice in the challenge group and the mock control group were collected at 24, 72, and 120 hours for hematoxylin-eosin (HE) staining pathological analysis. The results showed that the viral infection caused significant damage to the brain, lung, and intestinal tissues. Brain pathological results are as follows: Figure 10 As shown in Figure A, compared with the control group, the pathological changes in the challenge group were most significant at 24 hours post-infection, mainly manifested as inflammatory cell infiltration and increased glial cells, with some neurons showing swelling, nucleus pyknosis, fragmentation, or even disappearance. At 72 hours post-infection, the inflammatory cell infiltration was somewhat alleviated, but neuronal swelling and increased glial cells were still observed. Pathological results at 120 hours showed perivascular lymphocyte infiltration and vascular sheath formation.

[0128] Lung pathology results as follows Figure 10 As shown in Figure B, the challenge group exhibited significant pathological changes compared to the Mock group. At 24 hours post-infection, most alveolar structures in the lung parenchyma of the challenge group remained intact and clear, while some areas showed alveolar structural damage and collapse. The connective tissue around blood vessels showed a loose and edematous state. At 72 hours, alveolar collapse and vascular edema were exacerbated, with a small amount of type II alveolar epithelial cell proliferation. The pathological damage was even more pronounced at 120 hours, with abundant pinkish-brown protein exudate visible in the alveoli, further alveolar collapse accompanied by inflammatory cell infiltration and hemorrhage.

[0129] Transverse sections of intestinal tissue were prepared, and their HE-stained images are shown below. Figure 10 As shown in Figure C, compared with the Mock control group, the colonic tissue of mice in the challenge group showed slight thickening of the intestinal wall, slight abnormalities in the epithelial structure, and a small amount of inflammatory cell infiltration in the mucosa 24 hours after infection; after 72 hours, the colonic tissue wall thickened further, the epithelial structure was significantly irregularly damaged, and the inflammatory cell infiltration in the mucosa was obvious; after 120 hours, the colonic tissue wall thickened significantly, the epithelial structure was significantly damaged, the crypt structure was disordered, the inflammatory cell infiltration in the mucosa was significantly increased, and the intestinal tissue damage was obvious.

[0130] HE results of liver, spleen, and kidney tissues as follows Figure 11As shown, at 24 hours post-infection, relatively clear hepatocyte boundaries were visible in the liver, with erythrocyte aggregation and a small amount of inflammatory cell infiltration observed in local hepatic sinusoids. At 72 hours post-infection, the congestion of the hepatic sinusoids worsened, and lymphocyte infiltration was observed. Section results at 120 hours post-infection showed disordered liver tissue, with indistinct hepatocyte boundaries, cell swelling, degeneration, and necrosis, and some hepatocytes exhibiting foamy degeneration of the cytoplasm. These results indicate that the virus still causes some damage to the liver. HE staining results of the spleen and kidneys showed no significant difference between the challenge group mice at 24, 72, and 120 hours post-infection and the Mock group at 120 hours post-infection.

[0131] 5.2 Study on models of adult rat infection by recombinant virus via two routes

[0132] To further investigate the infection of rOC43-Nm virus in adult mice, female BALB / c mice aged 4–6 weeks were selected as the experimental model. Infection was achieved via intracranial injection and intranasal administration. 5 Mice were infected with an infection dose of FFU / 50μL, and in vivo imaging and body weight were performed daily.

[0133] The fluorescence distribution analysis results of the intracranial infection group are as follows: Figure 12 As shown: (1) When fluorescent signals were collected from the back, expression of the Nluc reporter gene could be seen 24 hours after infection. The virus was mainly distributed in the brain. Transient expression was seen in the liver 48 hours after infection. Transient slight expression was seen in the lungs 96 hours after infection. Fluorescent signals could no longer be collected after 120 hours. Figure 12 (2) When Nluc signals were collected via the abdomen, the results showed that fluorescence expression in the intestinal tissue could be observed as early as 24 hours after infection. The fluorescence signal intensity gradually weakened with the increase of infection time, and a relatively weak Nluc signal was still visible after 120 hours. Overall, the trend of Nluc fluorescence signal change in the abdomen was consistent with the results collected from the back, but the fluorescence intensity was generally higher than that collected from the back. Figure 12 (Middle B). The results on body weight and survival rate showed that no mice died throughout the infection process, and their body weight was consistent with that of the Mock control group.

[0134] Fluorescence distribution analysis of the nasal drop infection group showed that the fluorescence signal collected from the back showed transient expression in the lungs after 48 hours, and the fluorescence signal gradually weakened with the extension of infection time. Figure 12 (C). Results from abdominal sampling indicated that the Nluc reporter gene began to be expressed after 24 hours, with expression mainly concentrated in the intestinal region, gradually decreasing with time after infection. Figure 12 The D mice did not die throughout the infection process, and their body weight was similar to that of the Mock control group.

[0135] The above research results show that the recombinant virus rOC43-N-m carrying double reporter genes can be used as a good substitute model for wild-type virus, and can be applied to the study of HCoV-OC43 animal infection model through Nluc reporter gene, thereby providing a new technical means for realizing the visualization research of coronavirus.

[0136] Example 6

[0137] Application of HCoV-OC43 VR1558 strain recombinant virus carrying Nluc-mCherry in pharmacodynamics evaluation of remdesivir and chloroquine

[0138] In this study, wild-type VR1558 was used as a control to evaluate the pharmacodynamics of rOC43-N-m recombinant virus in remdesivir (RDV) and chloroquine (CQ) in BHK-21 cells.

[0139] 5.1 Cell toxicity detection (CCK-8) 50 )

[0140] In a 96-well plate, 2×10 4 BHK-21 cells were added per well with a volume of 100 μL / well, and the next day the cells reached 90% confluence. Remdesivir (RDV) and chloroquine (CQ) were diluted 5 times from 100 μM, and 100 μL of drug diluent was added per well, with three replicate wells for each drug concentration. At the same time, cell control wells and blank control wells were set up, and the maintenance solution was added. All the plates were placed in a constant temperature incubator at 33°C, 5% CO2 for 72 h. After incubation, the cell activity was detected by CCK-8 kit. The CCK-8 reagent was diluted with maintenance solution at a ratio of 1:10, the supernatant in the 96-well plate was discarded, and 100 μL of reagent diluent was added per well. The culture plate was returned to the incubator for 20 min to allow the reagent to fully react with the cells. Then, the absorbance of each well was measured at 450 nm wavelength using a microplate reader. When the OD value of the control wells reached about 1.5, the inhibition rate of the drug on cell activity was calculated according to the measured data.

[0141] 5.2 Pharmacodynamics evaluation (EC 50 )

[0142] BHK-21 was added to each well at a concentration of 2×10 4Cells were seeded at a density of approximately 90% in 96-well plates. Remdesivir was serially diluted 3-fold starting at 50 μM, and chloroquine was serially diluted 3-fold starting at 10 μM, with 100 μL added to each well. Three replicates were set up for each concentration. Cell control and virus control wells were added to each well with cell maintenance medium. The plates were incubated at 33°C with 5% CO2 for 2 hours. The drug diluent was discarded, and 100 μL of virus solution (MOI = 0.1) was added to each well. The plates were incubated at 33°C for 2 hours. The virus solution was discarded, and 100 μL of the corresponding drug diluent was added to each well. Maintenance medium was added to the virus control wells. The plates were then incubated at 33°C for another 72 hours. Viral RNA was extracted using the Tianlong Nucleic Acid Extraction Kit and detected by RT-qPCR using primers and probes (as shown in Table 3). Finally, the 50% inhibitory concentration (EC50) of the drug against the virus was calculated using Graphpad. 50 Plot the inhibition rate curve and conduct three independent experiments.

[0143] The antiviral pharmacodynamic results of RDV are as follows, based on the expression results of the mCherry reporter gene ( Figure 13 In Figure A), as the concentration of RDV decreased, the expression of red fluorescence gradually increased in a dose-dependent manner. Nluc activity results showed that RDV inhibited the EC50 expression of the recombinant virus. 50 0.63 μM ( Figure 13 (B). RT-qPCR results showed that RDV inhibited the EC50 of wild-type VR1558 strain. 50 The concentration was 0.43 μM, while the EC50 of the recombinant virus was... 50 0.68 μM ( Figure 13 (C). Correlation analysis showed a good correlation between the recombinant virus Nluc results and the RT-qPCR results (R). 2 =0.78, p<0.0001)( Figure 13 Furthermore, the recombinant virus rOC43-Nm showed a good correlation with the RT-qPCR results of the wild-type VR1558 strain (R). 2 =0.84, p<0.0001)( Figure 13 (E).

[0144] The antiviral pharmacodynamic results of CQ are as follows. Based on the expression results of the mCherry reporter gene, ( Figure 14 In the assay (A), the red fluorescence increased with decreasing CQ drug concentration, exhibiting a dose-dependent effect. Nluc assay results showed that CQ inhibited the EC50 of the recombinant virus rOC43-Nm. 50 0.2 μM ( Figure 14 (B). RT-qPCR results showed that CQ was effective against the EC50 of wild-type VR1558 strain.50 was 0.31 μΜ, while the EC 50 was 0.16 μΜ Figure 14 C). Correlation analysis showed that there was a good correlation between the results of recombinant virus Nluc and RT-qPCR (R 2 = 0.71, p < 0.0001) Figure 14 D). Similarly, there was also a good correlation between the results of recombinant virus rOC43-N-m and wild-type VR1558 (R 2 = 0.77, p < 0.0001) Figure 14 E).

[0145] In summary, the double reporter gene of recombinant virus rOC43-N-m can reflect the level of viral replication, and the recombinant virus rOC43-N-m carrying the double reporter gene can be a good substitute model for wild-type virus. Through the two reporter genes Nluc and mCherry, a double-visualization research system in vivo and in vitro was established, which can be applied to the study of viral infection and replication characteristics, evaluation of antiviral drugs, and other researches, and realize the rapid, high-throughput and visualization of coronavirus biological characteristics research and antiviral drug research.

[0146] Although the above embodiments have made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and people can also obtain other embodiments according to the present embodiments without creativity, which all belong to the protection scope of the present application.

Claims

1. A recombinant human coronavirus genome, characterized in that, comprises replacing the coding sequence of amino acids 7-238 of the ns2 region of the human coronavirus OC43 genome with a luciferase reporter gene Nluc and a red fluorescent protein gene mCherry based on the human coronavirus OC43 genome.

2. The recombinant human coronavirus genome of claim 1, wherein, Further comprises inserting a CMV promoter at the front of the 5'UTR of the human coronavirus genome and inserting a HDV ribozyme coding sequence and a BGH termination signal at the tail of the 3'UTR of the human coronavirus genome.

3. The recombinant human coronavirus genome according to claim 1 or 2, wherein, After the replacement, the nucleotide sequence of the ns2 region of the recombinant human coronavirus OC43 genome is shown as SEQ ID No.

45.

4. The recombinant human coronavirus genome of claim 1 or 2, wherein, The human coronavirus genome comprises a human coronavirus HCoV-OC43 genome.

5. A set of primers panel for segmentally cloning the genome of the recombinant human coronavirus according to any one of claims 1 to 4, characterized in that, comprises primer pair F1, primer pair F2, primer pair F3, primer pair F4, primer pair F5, primer pair F6, primer pair F7, primer pair F8, primer pair Nluc-P2A and primer pair P2A-mCherry; The nucleotide sequences of the upstream primer and the downstream primer of the primer pair F1 are shown as SEQ ID No. 1 and SEQ ID No. 2, respectively; The nucleotide sequences of the upstream primer and the downstream primer of the primer pair F2 are shown as SEQ ID No. 3 and SEQ ID No. 4, respectively; The nucleotide sequences of the upstream primer and the downstream primer of the primer pair F3 are shown as SEQ ID No. 5 and SEQ ID No. 6, respectively; The nucleotide sequences of the upstream primer and the downstream primer of the primer pair F4 are shown as SEQ ID No. 7 and SEQ ID No. 8, respectively; The nucleotide sequences of the upstream primer and the downstream primer of the primer pair F5 are shown as SEQ ID No. 9 and SEQ ID No. 10, respectively; The nucleotide sequences of the upstream primer and the downstream primer of the primer pair F6 are shown as SEQ ID No. 11 and SEQ ID No. 12, respectively; The nucleotide sequences of the upstream primer and the downstream primer of the primer pair F7 are shown as SEQ ID No. 13 and SEQ ID No. 14, respectively; The nucleotide sequences of the upstream primer and the downstream primer of the primer pair F8 are shown as SEQ ID No. 15 and SEQ ID No. 16, respectively; The nucleotide sequences of the upstream primer and the downstream primer of the primer pair Nluc-P2A are shown as SEQ ID No. 17 and SEQ ID No. 18, SEQ ID No. 19, respectively; The nucleotide sequences of the upstream primer and the downstream primer of the primer pair P2A-mCherry are shown as SEQ ID No. 20 and SEQ ID No. 21, respectively.

6. A recombinant vector comprising the recombinant human coronavirus genome of any one of claims 1-4.

7. The method of constructing a recombinant vector of claim 6, wherein, comprises the following steps: using the plasmid containing the human coronavirus genome as a template, and using the primer pair F1 and the primer pair F8 in the primer panel of claim 5 to perform PCR amplification, respectively, to obtain two fragments containing transcription elements; PCR amplification of the primer pair F2, the primer pair F3, the primer pair F4, the primer pair F5, the primer pair F6 and the primer pair F7 in the primer panel of claim 5 using the cDNA of human coronavirus as a template, to obtain six fragments of the full-length gene of human coronavirus; PCR amplification of the primer pair Nluc-P2A in the primer panel of claim 5 using the plasmid carrying the luciferase Nluc gene as a template, to obtain the luciferase gene Nluc; PCR amplification of the primer pair P2A-mCherry in the primer panel of claim 5 using the plasmid carrying the fluorescent protein mCherry gene as a template, to obtain the red fluorescent protein gene mCherry; mixing the linearized basic vector with the two fragments containing transcription elements, the six fragments of the full-length gene of human coronavirus, the luciferase reporter gene Nluc and the fluorescent protein reporter gene mCherry, and then transforming into the yeast competent cells for recombination expression to obtain the recombinant vector.

8. A recombinant human coronavirus strain, characterized in that, The recombinant human coronavirus strain comprises the recombinant human coronavirus genome of any one of claims 1-4 or the recombinant vector of claim 6 or the recombinant vector constructed by the construction method of claim 7.

9. The method of constructing a recombinant human coronavirus strain of claim 8, wherein, The virus rescue is performed by using the recombinant vector of claim 6 or the recombinant vector constructed by the construction method of claim 7, to obtain the recombinant human coronavirus strain expressing luciferase Nluc and red fluorescent protein mCherry.

10. Use of the recombinant human coronavirus genome of any one of claims 1-4 or the primer panel of claim 5 or the recombinant vector of claim 6 or the recombinant human coronavirus strain of claim 8 in antiviral drug screening and / or vaccine preparation.