Passion fruit virus RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection method based on rapid nucleic acid extraction

Abstract

The invention discloses a passion fruit virus RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection method based on rapid nucleic acid extraction, and belongs to the technical field of molecular biological detection. The RT-PCR detection method for the passion fruit virus is established by introducing a swab and a cleaning solution and optimizing a rapid extraction technology of total RNA (Ribonucleic Acid) of plant tissues. Experimental results show that the RT-PCR detection method provided by the invention can efficiently and stably realize passion fruit virus detection. The rapid nucleic acid extraction step in the RT-PCR detection method provided by the invention reduces the degree of dependence on equipment and reagents, simplifies the operation, shortens the operation time, and does not reduce the quality and concentration of RNA. The invention provides a new strategy for rapid and large-scale detection of the passion fruit virus and prevention and treatment of the passion fruit virus, and has a wide application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology detection, in particular to a guava virus RT-PCR detection method based on nucleic acid rapid extraction. BACKGROUND

[0002] At present, the extraction methods of plant total RNA include guanidine isothiocyanate method, CTAB method, lithium chloride method and various commercial kits. However, these methods all need professional instruments such as low-temperature high-speed centrifuge and toxic and harmful reagents such as chloroform, phenol and mercaptoethanol, and need to transfer liquid for many times, and the extraction operation time is generally about 1 hour. Therefore, high requirements are put forward for the professionalism of laboratory personnel, which limits the popularization of technologies such as molecular detection; at the same time, due to the long operation time and great dependence on instruments, the existing technology is not suitable for large-scale sample detection.

[0003] Therefore, it is urgent to provide an RNA extraction and virus RT-PCR detection method which reduces the dependence on instruments and equipment, shortens the operation time and reduces the operation difficulty, and at the same time does not reduce the quality and concentration of the obtained RNA. SUMMARY

[0004] The purpose of the present application is to provide a guava virus RT-PCR detection method based on nucleic acid rapid extraction, so as to solve the problems existing in the prior art. The RT-PCR detection method provided by the present application can efficiently, quickly and stably realize guava virus detection, and provides a new strategy for rapid and large-scale detection of guava virus and prevention and control of guava virus.

[0005] To achieve the above purpose, the present application provides the following solutions:

[0006] The present application provides a method for detecting guava virus based on nucleic acid rapid extraction, comprising the following steps:

[0007] Taking the guava tissue to be detected, lysing to obtain a lysate;

[0008] Immersing the nucleic acid binding region of the swab into the lysate, taking it out, washing it with a washing solution, and air-drying, immersing the nucleic acid binding region of the air-dried swab into nuclease-free water to obtain sample RNA;

[0009] Reversely transcribing the sample RNA to obtain cDNA;

[0010] Mixing the cDNA with guava virus specific primers, performing PCR reaction, collecting the PCR product after the PCR reaction, and performing agarose gel electrophoresis;

[0011] The swab is a flocked swab with a length of 150 mm; the nucleic acid binding region is a flock with a length of 20 mm; there is a breaking point 30 mm from the flocking end.

[0012] Preferably, the lysing comprises the following steps:

[0013] The guava tissue to be tested is added to a grinding bag, Trizol lysate is added, and grinding is performed, and the lysate is obtained by placing it at room temperature.

[0014] Preferably, the mass-volume ratio of the guava tissue to be tested to the Trizol lysate is 1 mg:0.05 mL; and the time for placing at room temperature is 15 min.

[0015] Preferably, the washing with the washing solution comprises the following steps:

[0016] The swab is immersed in 1 mL of washing solution I for 5 min, shaken for 2 s, taken out, immersed in 1 mL of washing solution II for 1 min, shaken for 2 s, taken out, and dried.

[0017] Preferably, the washing solution I is an ethanol solution with a volume fraction of 75% and containing 0.3 mol / L sodium acetate;

[0018] The washing solution II is an ethanol solution with a volume fraction of 75%;

[0019] Both the washing solution I and the washing solution II are prepared using nuclease-free water.

[0020] Preferably, the immersion in nuclease-free water comprises the following steps:

[0021] The nucleic acid binding region is immersed in 100 μL of nuclease-free water, broken from the breaking point, placed in the nuclease-free water, and the handle is discarded, thereby obtaining the sample RNA.

[0022] Preferably, the reverse transcription comprises the following steps:

[0023] 5 μL of the sample RNA is taken, mixed with 2 μL of 5× reverse transcription buffer, 0.5 μL of M-MLV enzyme, 2 μL of 2.5 mM dNTP, and 0.5 μL of random primer;

[0024] Incubation is performed at 42°C for 40 min and at 85°C for 5 min, thereby obtaining the sample cDNA.

[0025] Preferably, the guava virus-specific primer comprises at least one of the following primer pairs:

[0026] The primer pair for detecting cucumber mosaic virus has nucleotide sequences as shown in SEQ ID NO. 1-2;

[0027] The primer pair for detecting Passiflora edulis virus has nucleotide sequences as shown in SEQ ID NO. 3-4;

[0028] The primer pair for detecting Mirabilis jalapa mosaic virus has nucleotide sequences as shown in SEQ ID NO. 5-6;

[0029] The primer pair for detecting Passiflora mottle virus has nucleotide sequences as shown in SEQ ID NO. 7-8.

[0030] Preferably, the preparation of the reaction system of the PCR reaction comprises the following steps:

[0031] 1 μL of sample cDNA is taken, 12.5 μL of PCR MIX is added, the passion fruit virus specific primer is added to a final concentration of 0.2 μM, and ddH2O is added to make up to 25 μL.

[0032] Preferably, the reaction procedure of the PCR reaction is as follows: 95 ℃ pre-denaturation for 5 min, 95 ℃ denaturation for 30 s, 55 ℃ annealing for 30 s, 72 ℃ extension for 30 s, 30 cycles, and 72 ℃ final extension for 5 min.

[0033] The present application discloses the following technical effects:

[0034] The present application discloses the following technical effects: BRIEF DESCRIPTION OF DRAWINGS

[0035] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments will be briefly introduced as follows. Obviously, the drawings in the following description only constitute some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained from these drawings without creative labor.

[0036] Figure 1Figure 6 is an electrophoretogram of the result of detecting the virus of Passiflora edulis; wherein, lane 1 is DL2000 Marker; lanes 2-3 are positive control of EAPV; lanes 4-8 are 18S internal reference; lanes 9-12 are negative control (four virus primers); lane 13 is no sample; lanes 14-19 are Cucumber mosaic virus CMV; lanes 20-25 are East Asian Passiflora virus EAPV;

[0037] Figure 2 Figure 7 is an electrophoretogram of the result of detecting the virus of Passiflora edulis; wherein, lane 1 is DL2000 Marker; lanes 2-7 are Passiflora Mosaic virus PaMV; lane 8 is 18S internal reference; lanes 9-12 are negative control (four virus primers); lane 13 is no sample; lanes 14-19 are Teja Malva virus TeMV; lanes 20-25 are no sample;

[0038] Figure 3 Figure 8 is a diagram of the swab specification of the present application. DETAILED DESCRIPTION

[0039] The following detailed description of various example embodiments of the present application is not to be taken in a limiting sense, but is understood to be merely a description of certain aspects, features, and embodiments of the present application.

[0040] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, the use of the term "about" in relation to a value or a range of values is understood to include each individual value or range of values falling within the range of the upper and lower limits of the range. Any intermediate value or range of values, whether stated or not, encompassed by the stated range is also included in the present application. The upper and lower limits of these smaller ranges can independently be included or excluded from the range.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned in this specification are herein incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference in this specification is not intended as an admission that the reference is prior art to this application.

[0042] Many modifications and variations of this application can be made without departing from its spirit or scope, which will be apparent to those skilled in the art. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only. It is to be understood that the application is not limited in scope by the specific embodiments described herein. Rather, the specific embodiments are intended to illustrate the general principles of the application.

[0043] As used herein, the terms “comprises,” “comprising,” “includes,” “including,” “has,” “having,” and the like are open-ended terms that are intended to permit but not limit the amount or number of steps, components, members, etc. to follow, and are not limited to members, components, or steps.

[0044] Example 1

[0045] 1. Experimental materials

[0046] 1.1 Reagent information

[0047] The swab of the present application is ZR-A disposable sampler produced by Shijiazhuang Jiayiyuan Technology Co., Ltd., and the medical device record number is Jishixiebe 20210141. Other swabs of the same specification and quality can also be used in the present application. The specific specification is shown in the following table: Figure 3 .

[0048] The lysis solution of the present application is Trizol (purchased from Invitrogen Company) with the following formula: in a 2000 mL beaker, add the following substances and mix evenly: 500 mL of heavy benzene phenol; 250 g of guanidine isothiocyanate; 293 mL of distilled water; 17.6 mL of 0.75 M sodium citrate solution (pH≥7); 26.4 mL of 10% sarcosy (sodium dodecyl sarcosinate) solution; 50 mL of 2M NaAc solution (pH≥4).

[0049] The cleaning solution I of the present application is 75% ethanol (volume fraction) containing 0.3M NaAc prepared from RNase-free H2O.

[0050] The cleaning solution II of the present application is 75% ethanol (volume fraction) prepared from RNase-free H2O.

[0051] 1.2 Primer sequence

[0052] The primer sequence used in the present application is as follows:

[0053] (1) Cucumber mosaic virus CMV

[0054] The primer is shown as SEQ ID NO. 1-2, and the amplification product size is 329 bp;

[0055] CMVsj-1F: GTTGTTGCTWCCTGATTCG (SEQ ID NO. 1);

[0056] CMVsj-1R: GCTCRTCCGTCTCRAGHG (SEQ ID NO. 2).

[0057] (2) East Asian Passiflora virus EAPV

[0058] The primer is shown as SEQ ID NO. 3-4, and the amplification product size is 646 bp;

[0059] EAPVsj-1F: TTCAARGAACTTGCWGCAGC (SEQ ID NO. 3);

[0060] EAPVsj-1R: CGTCCATCATYACCCAYR (SEQ ID NO. 4).

[0061] (3) Night -scented stock mosaic virus TeMV

[0062] Primers are shown as SEQ ID NO. 5-6, and the size of the amplification product is 566bp;

[0063] TeMVsj-2F: GCACTTCACCAGATGTCAATG (SEQ ID NO. 5);

[0064] TeMVsj-2R: GCCACTCTATCRCAATACTYA (SEQ ID NO. 6).

[0065] (4) Passiflora mosaic virus PaMV

[0066] Primers are shown as SEQ ID NO. 7-8, and the size of the amplification product is 448bp;

[0067] PaMVsj-1F: CGAACCAACACGACCATT (SEQ ID NO. 7);

[0068] PaMVsj-1R: GCTGGAGACATAGACAAGTAT (SEQ ID NO. 8).

[0069] (5) Internal reference

[0070] Primers are shown as SEQ ID NO. 9-10, and the size of the amplification product is 140bp;

[0071] 18S-1F: CCAAGCAGAAGCGGTCTT (SEQ ID NO. 9);

[0072] 18S-1R: AGTCAATCTATTCACCCGTCTA (SEQ ID NO. 10).

[0073] 2. Experimental method

[0074] Take 15mg of passion fruit plant tissue into a grinding bag, add 750μL of lysis buffer, grind with a small hammer, and mix the tissue and lysis buffer thoroughly, stand at room temperature for 20min for complete lysis, and obtain the lysis product.

[0075] The nucleic acid binding region (flocked) of the swab is immersed into the lysis product, and is repeatedly in and out for 3 times, so that the lysis product is fully infiltrated into the nucleic acid binding region (flocked) of the swab.

[0076] The swab immersed with the lysis product is immersed into 1 mL of washing solution I, soaked for 5 min, shaken for 1-2 s, taken out, and solid impurities are separated from the flocked swab.

[0077] The swab immersed with the washing solution I is immersed into 1 mL of washing solution II, soaked for 1 min, shaken for 1-2 s, taken out, and gently shaken and air-dried until no obvious liquid drops are observed.

[0078] The swab after air-drying is immersed into 1 mL of washing solution II, soaked for 1 min, shaken for 1-2 s, taken out, and gently shaken or air-dried until no obvious liquid drops are observed.

[0079] The swab immersed with the washing solution II and air-dried is immersed into 100 μL of RNase-free H2O, the nucleic acid binding region is broken at the breaking point, and is placed in the RNase-free H2O, the handle is discarded, and sample RNA is obtained. The sample RNA is stored at -80 ℃.

[0080] 5 μL of sample RNA is taken, 2 μL of 5×RT buffer, 0.5 μL of M-MuLV enzyme, 2 μL of 2.5 mM dNTP, and 0.5 μL of random primer are added, 42 ℃ incubation is performed for 40 min, 85 ℃ incubation is performed for 5 min, and sample cDNA is obtained.

[0081] 1 μL of sample cDNA is taken, 12.5 μL of PCR MIX is added, and upper and lower primers are added to a final concentration of 0.2 μM, and ddH2O is added to 25 μL, which is a PCR reaction solution.

[0082] The PCR reaction solution is placed in a PCR instrument, and the PCR reaction program is 95 ℃ pre-denaturation for 5 min, 95 ℃ denaturation for 30 s, 55 ℃ annealing for 30 s, 72 ℃ extension for 30 s, 30 cycles, and 72 ℃ terminal extension for 5 min. After the reaction is completed, 2.5% agarose electrophoresis is performed.

[0083] 3. Experimental results

[0084] As shown in Figure 1 and Figure 2 , the results show that the RT-PCR detection method provided by the application can accurately amplify the target gene sequence of the guava virus, the bands are uniform and stable, the amplification result is consistent with the expected fragment size, and there is no non-specific amplification. The nucleic acid rapid extraction method of the application shortens the operation time and simplifies the operation process without reducing the quality and concentration of RNA, and lays a foundation for large-scale detection of the guava virus.

[0085] The above described embodiments are only to illustrate the preferred modes of the present application, and are not intended to limit the scope of the present application. Any modification and improvement made by those skilled in the art to the technical solutions of the present application without departing from the design spirit of the present application shall fall within the protection scope of the present application.

Claims

1. A method for detecting a passion fruit virus based on rapid extraction of nucleic acid, characterized by, The method comprises the following steps: taking guava tissue to be tested, lysing to obtain a lysate; immersing a nucleic acid binding region of a swab into the lysate, taking it out, washing with a washing solution, air-drying, immersing the nucleic acid binding region of the swab after air-drying into nuclease-free water to obtain sample RNA; reverse transcribing the sample RNA to obtain cDNA; mixing the cDNA with guava virus-specific primers to perform a PCR reaction, collecting a PCR product after the PCR reaction, and performing agarose gel electrophoresis on the PCR product. The swab is a flocked swab with a length of 150 mm; the nucleic acid binding region is flocked with a length of 20 mm; and there is a breaking point 30 mm from the flocked end.

2. The method of claim 1, wherein, The lysing comprises the following steps: adding the guava tissue to be tested into a grinding bag, adding Trizol lysate, grinding thoroughly, and standing at room temperature to obtain the lysate.

3. The method of claim 2, wherein, The mass-volume ratio of the guava tissue to be tested to the Trizol lysate is 1 mg:0.05 mL; and the standing time at room temperature is 15 min.

4. The method of claim 1, wherein, The washing with the washing solution comprises the following steps: immersing the swab into 1 mL of washing solution I, soaking for 5 min, shaking for 2 s, taking it out, immersing into 1 mL of washing solution II, soaking for 1 min, shaking for 2 s, taking it out, air-drying, immersing into 1 mL of washing solution II, soaking for 1 min, and shaking for 2 s.

5. The method of claim 4, wherein, The washing solution I is an ethanol solution containing 0.3 mol / L sodium acetate with a volume fraction of 75%; The washing solution II is an ethanol solution with a volume fraction of 75%; Both the washing solution I and the washing solution II are prepared using nuclease-free water.

6. The method of claim 1, wherein, The immersing into nuclease-free water comprises the following steps: immersing the nucleic acid binding region into 100 μL of nuclease-free water, soaking for 3 min, breaking the nucleic acid binding region from the breaking point, putting it into the nuclease-free water, and discarding the handle to obtain the sample RNA.

7. The method of claim 1, wherein, The reverse transcription comprises the following steps: mixing 5 μL of the sample RNA with 2 μL of 5× reverse transcription buffer, 0.5 μL of M-MLV enzyme, 2 μL of 2.5 mM dNTP, and 0.5 μL of random primer; incubating at 42℃ for 40 min and at 85℃ for 5 min to obtain the sample cDNA.

8. The method of claim 1, wherein, The guava virus-specific primers comprise at least one of the following primer pairs: a primer pair for detecting cucumber mosaic virus with a nucleotide sequence as shown in SEQ ID NO. 1-2; a primer pair for detecting East Asian passion fruit virus with a nucleotide sequence as shown in SEQ ID NO. 3-4; a primer pair for detecting night-blooming jasmine mosaic virus with a nucleotide sequence as shown in SEQ ID NO. 5-6; a primer pair for detecting passion fruit mottle virus with a nucleotide sequence as shown in SEQ ID NO. 7-8.

9. The method of claim 8, wherein, The preparation of a reaction system of the PCR reaction comprises the following steps: mixing 1 μL of sample cDNA with 12.5 μL of PCR MIX, adding the guava virus-specific primers to a final concentration of 0.2 μM, and adding ddH2O to 25 μL.

10. The method of claim 1, wherein, The reaction procedure of the PCR reaction is as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, 30 cycles, and final extension at 72°C for 5 min. The reaction procedure of the PCR reaction is as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C

Images