Visual LAMP detection method for Atractylodes lancea light mottle virus

Abstract

The invention belongs to the technical field of rapid diagnosis of plant viruses, and particularly relates to an innovative application based on a loop-mediated isothermal amplification (LAMP) technology, in particular to a rapid detection method aiming at an atractylodes lancea light mottle virus. The invention discloses a specific primer combination specially used for detecting a light mottle virus of rhizoma atractylodis. The specific primer combination comprises an outer primer pair, an inner primer pair and two loop primers. Meanwhile, the invention also provides an efficient and convenient detection process which comprises the following steps: setting a reaction system by using the primers, and amplifying for 30 minutes at the constant temperature of 63 DEG C; if the color of the reaction liquid is kept in the yellowish purple, judging that the reaction liquid is a negative result; if the color is turned into light blue, the sample is positive. The method has the advantages of being high in sensitivity, easy and convenient to operate, rapid in reaction and the like, and can be widely applied to on-site rapid screening and diagnosis of the atractylodes lancea light mottle virus.

Description

Technical Field

[0001] This invention belongs to the field of virus detection, specifically relating to a visual LAMP rapid detection method for the plant disease Atractylodes lancea mild mottle virus. Background Technology

[0002] Atractylodes mild mottle virus (AMMV) is a newly discovered plant virus, first identified in the medicinal plant Atractylodes macrocephala. Subsequently, cases of infection were found in the Atractylodes macrocephala producing area of ​​Huanggang City, Hubei Province, China.

[0003] AMMV belongs to the genus *Cauliflowervirus* in the family Cauliflowerviridae. It is a pararetrovirus with a circular double-stranded DNA (dsDNA) genome that replicates via reverse transcription. Current research on its pathogenic mechanism and transmission routes is limited, but reasonable inferences can be made based on its taxonomic position and biological characteristics. The pathogenic process of AMMV is closely related to its replication strategy. After the virus enters the host cell, its dsDNA genome enters the nucleus and is transcribed into a "pregenomic RNA" containing all viral genes. This RNA is transported to the cytoplasm, where it serves as a template for translating viral proteins and, under the action of viral reverse transcriptase, generates a new dsDNA genome. This replication process consumes a large amount of host resources, interferes with normal cellular function, and ultimately leads to disease.

[0004] There is currently no direct experimental evidence regarding the transmission vector of AMMV. However, most members of the genus *Camellia virus* are transmitted semi-persistently via aphids. Therefore, it can be inferred that aphids are the primary vector for the natural spread of AMMV in the field. In addition, asexual reproduction through virus-carrying propagules (such as rhizomes) and mechanical damage caused by contaminated tools during agricultural operations may also be important modes of transmission.

[0005] AMMV virus infection causes mosaic symptoms that reduce photosynthetic efficiency, leading to stunted growth, reduced biomass, and impacting rhizome yield and quality. Given the widespread transmission of this virus in Hubei province, a major production area for Atractylodes lancea, it poses a significant potential risk to the Atractylodes lancea industry both locally and nationwide.

[0006] Atractylodes mild mottle virus is a newly discovered Atractylodes virus, and currently there is no rapid and efficient detection method. To ensure the sustainable development of this medicinal herb industry, it is urgent to develop rapid and sensitive detection technologies, assess the economic losses it causes to yield and quality, and formulate comprehensive prevention and control measures. Summary of the Invention

[0007] The purpose of this invention is to provide a visual LAMP detection method for detecting Atractylodes lancea mild mottle virus. This method can detect Atractylodes lancea mild mottle virus simply and efficiently, and has good specificity and high sensitivity.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] In a first aspect, this invention claims protection for a visual LAMP rapid detection method for Atractylodes lancea mild mottle virus. This detection method uses the Rep gene region sequence of Atractylodes lancea mild mottle virus as the target gene, designs specific primers to perform a loop-mediated isothermal amplification reaction, and then allows direct visual observation of the detection results.

[0010] Furthermore, the dye is hydroxynaphthol blue dye (HNB).

[0011] Further: The nucleotide sequence of the Rep gene of the Atractylodes lancea mild mottle virus is shown in SEQ ID NO. 1.

[0012] Further: The specific primers include F3, B3, FIP, BIP, LF, and LB.

[0013] F3: 5'-GCACACTTGTTCAAAACAAAGA-3';

[0014] B3: 5'-CTTAAGTTTAGCTTGAAAAGGTT-3';

[0015] FIP: 5' - CTGGGAACTTATGAATGTGTTCCAATTAGGTTTAGAAATTGATCAAGGC -3';

[0016] BIP: 5'-TAGAAGACAAGAAGCAGTTGCAATAATCTGAGCTAACTTAGGAATG -3';

[0017] LF: 5'-TTCTGAGGCTTGTGAG-3';

[0018] LB: 5'-AGATTCCTCGGGATCC-3'.

[0019] The FIP and BIP are synthesized by polymerizing F2 and F1c, and B2 and B1c, respectively.

[0020] F2: 5'-TTAGGTTTAGAAATTGATCAAGGC-3';

[0021] F1c: 5' - CTGGGAACTTATGAATGTGTTCCAA -3';

[0022] B2: 5'-TAATCTGAGCTAACTTAGGAATG-3';

[0023] B1c: 5'-TAGAAGACAAGAAGCAGTTGCAA-3';

[0024] In a specific embodiment of the present invention, the 25 μL reaction system for loop-mediated isothermal amplification is as follows: 2.5 μL of 10×Bst DNA polymerase buffer, 1.2 μL of Bst DNA Polymerase (8 U / μL), 0.5 μL of F3 / B3 (10 mM), 1.5 μL of FIP / BIP (20 mM), 1 μL of LF / LB (10 mM), 1.5 μL of MgSO4 (100 mM), 8 μL of dNTPs (10 mM), 1 μL of hydroxynaphthol blue (HNB) aqueous solution (3 mM), 3.8 μL of ddH2O, and 1 μL of plant cDNA sample.

[0025] Further: The loop-mediated isothermal amplification was carried out under isothermal reaction conditions of 63℃ for 30 minutes.

[0026] Secondly, this invention claims protection for a primer set for rapid visual LAMP detection of Atractylodes lancea mild mottle virus, wherein the primer set is a specific primer designed with the Rep gene region sequence of Atractylodes lancea mild mottle virus as the target gene, including F3, B3, FIP, BIP, LF, and LB:

[0027] F3: 5'-GCACACTTGTTCAAAACAAAGA-3';

[0028] B3: 5'-CTTAAGTTTAGCTTGAAAAGGTT-3';

[0029] FIP: 5' - CTGGGAACTTATGAATGTGTTCCAATTAGGTTTAGAAATTGATCAAGGC -3';

[0030] BIP: 5'-TAGAAGACAAGAAGCAGTTGCAATAATCTGAGCTAACTTAGGAATG -3';

[0031] LF: 5'-TTCTGAGGCTTGTGAG-3';

[0032] LB: 5'-AGATTCCTCGGGATCC-3'.

[0033] Thirdly, the present invention seeks protection for the use of the above-mentioned primer set in the preparation of a kit for the visual rapid detection of Atractylodes lancea mild mottled virus.

[0034] Fourthly, this invention seeks protection for the use of the Rep gene of Atractylodes lancea mild mottle virus, with a nucleotide sequence as shown in SEQ ID NO. 1, as a target gene in the preparation of a visual rapid detection kit for Atractylodes lancea mild mottle virus or in the visual rapid detection of Atractylodes lancea mild mottle virus.

[0035] Fifthly, the present invention seeks protection for the application of the above-described method, primer set, or kit in the visual rapid detection of Atractylodes lancea mild mottled virus.

[0036] In a specific embodiment of this invention, the Rep gene region sequence of Atractylodes lancea mild mottle virus is used as the target gene. Six specific primers (F3, B3, FIP, BIP, LF, LB) were designed to perform loop-mediated isothermal amplification of plant cDNA samples at 63°C for 30 minutes. The amplification system contains HNB dye, thereby enabling visual detection of the presence of Atractylodes lancea mild mottle virus in plant cDNA samples. This method is suitable for rapid detection of Atractylodes lancea mild mottle virus in the field and at the grassroots level, and can provide technical support for the field detection, identification, control, and disease resistance breeding of this virus.

[0037] In a specific embodiment of the present invention, the above-mentioned primer set and method for loop-mediated isothermal amplification are obtained through the following steps:

[0038] (1) The Rep gene nucleotide sequence in the AMMV genome was selected as a template. The top 5 basic LAMP primers (F3, B3, FIP, BIP) with the highest comprehensive scores were designed using the online website PrimerExplorer V5. Corresponding loop primers were designed for each basic primer group for screening experiments.

[0039] (2) To avoid the risk of aerosol contamination from opening the lid, we screened and optimized the concentrations of LAMP basic primers, loop primers and components of the amplification system using a real-time quantitative PCR instrument.

[0040] (3) After component optimization, hydroxynaphthol blue dye was added to the system to make the detection results visible to the naked eye, and its concentration was optimized. Before adding HNB dye, the final concentrations of dNTP and Mg²⁺ in the LAMP reaction system need to be adjusted to 3.2 mmol / L and 6 mmol / L, respectively, to ensure the normal progress of the colorimetric reaction.

[0041] (4) The cDNA sample of the plant to be tested was added to the optimized LAMP system to achieve visual detection of Atractylodes lancea mild mottle virus.

[0042] The technical solution of this invention contains two innovative points:

[0043] (1) The Rep gene region sequence in the genome of Atractylodes lancea mild mottle virus was selected as the target gene, and specific primers were designed to detect Atractylodes lancea mild mottle virus in the test plants. The Rep gene is a key gene related to viral replication. Previous studies have found that the gene sequence is highly conserved in multiple isolates of Atractylodes lancea mild mottle virus in the main producing areas of Atractylodes lancea. Therefore, using the Rep gene as the detection target will help improve the accuracy of detection.

[0044] (2) Design of specific primers. The six primers designed in this invention have the highest specificity. When we analyzed the melting curves of the amplification products of these six primers using a qPCR instrument, we found that the melting curves showed a single peak shape and no other impurity peaks, indicating that they have good specificity.

[0045] The present invention has the following beneficial effects:

[0046] 1. At 63℃, an isothermal amplification reaction using 6 primers for 30 minutes can effectively detect the presence of Atractylodes lancea mild mottle virus in plant cDNA samples;

[0047] 2. By introducing HNB dye into the detection system, the visual detection of Atractylodes lancea mild mottle virus was achieved. Attached Figure Description

[0048] Figure 1 Agarose gel electrophoresis image of the sensitivity of routine RT-PCR detection of Atractylodes lancea mild mottled virus.

[0049] Lane M is the marker, lane P is the positive control using total RNA cDNA solution as template, and the recombinant plasmid template concentration used in lanes 1-10 is 1×10⁻⁶. 9 1×10 8 1×10 7 1×10 6 1×10 5 1×10 4 1×10³, 1×10², 1×10¹, 1×10 0 Copy, lane CK is a blank control with ddH2O as the template.

[0050] Figure 2 Real-time fluorescence image of the sensitivity of real-time fluorescence LAMP detection of Atractylodes lancea mild mottled virus.

[0051] The x-axis represents isothermal amplification time in minutes; the y-axis represents fluorescence intensity; and the concentration of the recombinant plasmid template used is 1×10⁻⁶. 6 1×10 5 1×10 4 1×10³, 1×10², 1×10¹, 1×10 0 Copy; CK is a blank control with ddH2O as the template.

[0052] Figure 3 Visual observation of the sensitivity of LAMP detection of Atractylodes lancea mild mottled virus.

[0053] NC is the blank control with water as the template; the recombinant plasmid template added to amplification tube 9-0 is 1×10⁻⁶. 9 1×10 8 1×10 7 1×10 6 1×10 5 1×10 4 1×10³, 1×10², 1×10¹, 1×10 0 copy.

[0054] Figure 4 Melting curves of a specific test for Atractylodes lancea mild mottled virus detection using LAMP visualization

[0055] Wherein, total RNA represents a cDNA solution using the sample's total RNA as a template; 1×10 6 `copies` indicates that the template is 1×10. 6 Copy, ddH2O represents the blank control, and water is the template.

[0056] Figure 5 Comparison of results of conventional RT-PCR and visual LAMP assay for detecting Atractylodes lancea mild mottle virus in 24 field samples.

[0057] Results A show the RT-PCR results of 24 field samples, as shown in the agarose gel image.

[0058] Results B show the results of visual LAMP detection for 24 field samples;

[0059] The results show the agarose gel images of the visualized LAMP detection results for 24 field samples;

[0060] In this design, lane M in lanes A, B, and C is the marker; lane P is the positive control using cDNA of total RNA as the template; and lane CK is the blank control using ddH2O as the template. Detailed Implementation

[0061] The technical solution of the present invention will be clearly and completely described below with reference to embodiments thereof. The embodiments described below are only a part of the embodiments of the present invention.

[0062] Example 1. Design and establishment of primer set and method for LAMP detection of Atractylodes lancea mild mottle virus

[0063] 1. Design LAMP primers

[0064] Using the Rep gene sequence of Atractylodes lancea mild mottle virus isolated from leaf samples exhibiting viral infection symptoms from four planting bases in Yingshan County, Huanggang City, Hubei Province as a template, primer screening experiments were conducted using the five highest-scoring LAMP base primers (F3, B3, FIP, BIP) designed online using Primer Explorer V5, along with their corresponding loop primers (LF, LB). The optimal primer combination was ultimately determined. Primer sequences are shown in Table 1.

[0065] Table 1 shows the primer sequences used in the technical solution of this invention.

[0066] Primer name Primer sequence (5'-3') F3 GCACACTTGTTCAAAACAAAGA B3 CTTAAGTTTAGCTTGAAAAGGTT FIP CTGGGAACTTATGAATGTGTTCCAATTAGGTTTAGAAATTGATCAAGGC BIP TAGAAGACAAGAAGCAGTTGCAATAATCTGAGCTAACTTAGGAATG LF TTCTGAGGCTTGTGAG LB AGATTCCTCGGGATCC

[0067] 2. Establishment of LAMP detection method for Atractylodes lancea mild mottled virus

[0068] (1) Preparation of dye working solution: Accurately weigh an appropriate amount of HNB powder and prepare a 100× stock solution with a concentration of 12 mmol / L. The stock solution needs to be diluted to a 25× working solution before use.

[0069] For the colorimetric reaction of this working solution to proceed normally, the final concentrations of dNTP and Mg²⁺ in the LAMP reaction system need to be adjusted to 3.2 mM and 6 mM, respectively.

[0070] (2) Preparation of LAMP reaction stock solution: First, mix 0.5 μL of F3 / B3 (10 mM), 1.5 μL of FIP / BIP (20 mM) and 1 μL of LF / LB (10 mM), then mix 2.5 μL of 10×Bst DNA polymerase buffer, 1.2 μL of Bst DNA Polymerase (8 U / μL), 1.5 μL of MgSO4 (100 mM) and 8 μL of dNTPs, and then mix the two solutions together to prepare the LAMP reaction stock solution.

[0071] (3) Preparation of the visualization detection system: In a dry, clean, and sealable PCR test tube, add the LAMP reaction stock solution described in step (2), then add 1 μL of dye working solution, and then add DEPC water to make the total volume of the working solution in the reaction system reach 24 μL. Finally, add 25 μL of paraffin oil vertically above the system to seal the reaction system and prevent aerosol contamination.

[0072] 3. Visual LAMP Detection Procedure for Atractylodes lancea Mild Mottled Virus

[0073] (1) Preparation of LAMP reaction system: Take 1 tube of 24 μL detection system with added paraffin oil, use a pipette to pick up 1 μL of cDNA solution of RNA extracted from the sample to be tested, and inject it below the surface of the paraffin oil to form an independent 25 μL LAMP reaction system.

[0074] (2) The reaction system obtained in step (1) was subjected to LAMP isothermal amplification reaction. The reaction procedure was as follows: the amplification reaction was carried out at a constant temperature of 63℃ for 30 minutes, and after the amplification was completed, the reaction was terminated by incubating at 80℃ for 10 minutes;

[0075] (3) Result determination: After the reaction is completed, directly observe the color change of the liquid in the reaction tube to determine the result. If the liquid color is still light purple, consistent with that before the addition of the nucleic acid of the sample to be tested, it is determined to be negative, indicating that AMMV nucleic acid was not detected; if the liquid turns light blue, it is determined to be positive, indicating that AMMV nucleic acid was detected.

[0076] Example 2. Comparison of sensitivity of conventional RT-PCR, real-time fluorescence LAMP, and visual LAMP methods for detecting Atractylodes lancea mild mottled virus.

[0077] Using the mixed sample from Example 1 as a template, the AMMV Rep gene was amplified by RT-PCR using specific primers. The amplified product was recovered and ligated into a vector, which was then transformed into competent cells. After transformation, the cells were plated on LB plates, and positive single colonies were selected for Sanger sequencing. After successful sequencing, the plasmid was extracted, yielding a recombinant plasmid containing the AMMV Rep gene. Its concentration was determined using a micro spectrophotometer, and the copy number was calculated. When using the recombinant plasmid, the volume was increased from 1×10⁻⁶ cells / mL. 9 Up to 1×10 0 Perform a 10-fold serial dilution (copies / μL) and set aside.

[0078] 1. Sensitivity of conventional RT-PCR detection of Atractylodes lancea mild mottled virus

[0079] Using the outer primers (F3 / B3) of this invention as RT-PCR detection primers, for 1×10⁻⁶ primers respectively... 9 1×10 81×10 7 1×10 6 1×10 5 1×10 4 1×10³, 1×10², 1×10¹, 1×10 0 The recombinant plasmid was copied and tested for AMMV, with ddH2O as a negative control and cDNA from total RNA of a mixed sample of multiple Atractylodes lancea leaves from which the Rep gene sequence of Atractylodes lancea mild mottle virus was isolated as a positive control. The test results are as follows: Figure 1 As shown.

[0080] 2. Sensitivity of real-time fluorescence LAMP detection of Atractylodes lancea mild mottled virus

[0081] Using the LAMP primer set (F3 / B3 / FIP / BIP / LF / LB) designed in this invention as detection primers, a real-time fluorescence spectrometer was used, and LAMP fluorescent dye was added to the detection system to detect primers with a concentration of 1×10⁻⁶. 9 1×10 8 1×10 7 1×10 6 1×10 5 1×10 4 1×10³, 1×10², 1×10¹, 1×10 0 The recombinant plasmid was copied and tested for AMMV, with ddH2O as a negative control. The results are as follows: Figure 2 As shown.

[0082] 3. Sensitivity of visual LAMP detection for Atractylodes lancea mild mottled virus

[0083] Using the LAMP primer set (F3 / B3 / FIP / BIP / LF / LB) designed in this invention as detection primers, and following the detection steps of Example 1, the primers were tested for 1×10⁻⁶ LAMP primers. 9 1×10 8 1×10 7 1×10 6 1×10 5 1×10 4 1×10³, 1×10², 1×10¹, 1×10 0 The recombinant plasmid was copied and tested for AMMV, with ddH2O as a negative control. The results are as follows: Figure 3 As shown.

[0084] Experimental data show that the limit of detection for AMMV by conventional RT-PCR is 1 × 10³ copies. Figure 1 The detection limit of real-time fluorescence LAMP for Atractylodes lancea mild mottled virus is as low as 1×10² copies. Figure 2The results show that the LAMP protocol provided by this invention improves the sensitivity of nucleic acid detection by an order of magnitude (10-fold) compared to conventional methods. However, after adding HNB dye to visualize the LAMP results, the detection sensitivity of AMMV drops to 1 × 10³ copies. Figure 3 The results suggest that the dye (HNB) may slightly inhibit enzyme activity. Although the sensitivity decreased after adding the dye, it remained consistent with the detection limit of conventional RT-PCR, indicating that it still has good sensitivity.

[0085] Example 3. Specificity test for detecting Atractylodes lancea mild mottled virus using the visual LAMP method.

[0086] Since Atractylodes lancea mild mottle virus is the first plant virus discovered to infect Atractylodes lancea, this study used qPCR to analyze the melting curves of LAMP amplification products using cDNA solutions of total RNA from a mixed sample of multiple Atractylodes lancea leaves with the Rep gene sequence isolated from Atractylodes lancea mild mottle virus as templates. The analysis was performed at a 1×10⁻⁶ mcg ratio. 6 The recombinant plasmid was used as a positive control, and ddH2O was used as a blank control. When the melting curve showed a single peak without other impurities, the designed LAMP primers were considered to have good specificity.

[0087] Upon testing, when using total RNA cDNA solution samples and positive control samples as LAMP amplification templates, their melting curves all exhibited typical single-peak patterns with no extraneous peaks; meanwhile, no effective amplification signal was detected in the blank control group. Figure 4 The characteristic amplification pattern demonstrates that the LAMP primer set screened in this study has significant detection specificity for AMMV.

[0088] Example 4. Detection of field samples

[0089] Based on the optimized LAMP detection system with added dye, AMMV was simultaneously detected in 24 field samples. A positive control (same as in Example 2: cDNA solution of total RNA) and a negative control (ddH2O) were set up. 25 μL of paraffin oil was added to the reaction system to block the reaction environment before performing the conventional LAMP amplification reaction. Subsequently, 5 μL of the amplification product was mixed with 1 μL of 6× loading buffer and analyzed by agarose gel electrophoresis. The results are shown below. Figure 5 As shown.

[0090] Furthermore, an RT-PCR detection system for Atractylodes lancea mild mottle virus (AMMV) was constructed using the outer primers (F3 / B3) of the LAMP primer set as detection primers, and parallel detections were performed on the same set of samples. The applicability of the visualization dye LAMP method was evaluated by comparing the differences in detection results of the two methods for AMMV and AVA. The detection results are shown below. Figure 5 As shown.

[0091] Experimental results showed that in the detection of 24 field samples, the positive rate of AMMV detection by both the LAMP visualization method and the conventional RT-PCR method was 66.67% (16 / 24). The results of the two detection methods showed a high degree of consistency, effectively verifying the applicability of the LAMP detection system established in this invention in actual field samples. However, it is worth noting that the agarose gel electrophoresis results showed that the positive detection rate of AMMV by the LAMP method was increased to 75% (18 / 24), indicating that it has higher detection sensitivity than conventional RT-PCR.

[0092] SEQ ID NO. 1: Nucleotide sequence of Rep gene of Atractylodes lancea mild mottled virus

[0093]

Claims

1. A rapid and visual detection method for Atractylodes lancea mild mottled virus, characterized in that: Includes the following steps: (1) Extract total RNA from the plant sample tissue to be tested, reverse transcribe it into cDNA, and then add it into a loop-mediated isothermal closed amplification reaction system containing hydroxynaphthol blue dye; (2) The closed system was placed under constant temperature conditions to carry out an isothermal amplification reaction; (3) After the reaction is complete, observe the color with the naked eye. If the color of the system changes from light purple to light blue, it is considered a positive result.

2. The method as described in claim 1, characterized in that: The detection method uses the Rep gene region of Atractylodes lancea mild mottle virus as the target gene and designs specific primers. The nucleotide sequence of the Rep gene of Atractylodes lancea mild mottle virus is shown in SEQ ID NO.

1.

3. The method as described in claim 1, wherein step (1) is characterized by: The specific primers for loop-mediated isothermal amplification include F3, B3, FIP, BIP, LF, and LB: F3: 5'-GCACACTTGTTCAAAACAAAGA-3'; B3: 5'-CTTAAGTTTAGCTTGAAAAGGTT-3'; FIP: 5' - CTGGGAACTTATGAATGTGTTCCAATTAGGTTTAGAAATTGATCAAGGC -3'; BIP: 5'-TAGAAGACAAGAAGCAGTTGCAATAATCTGAGCTAACTTAGGAATG -3'; LF: 5'-TTCTGAGGCTTGTGAG-3'; LB: 5'-AGATTCCTCGGGATCC-3'.

4. The method as described in claim 1, wherein step (1) is characterized by: The 25 μL reaction system for loop-mediated isothermal closed amplification is as follows: 10×Bst DNA polymerse buffer 2.5μL; Bst DNA Polymerase (8 U / μL) 1.2μL; F3 / B3 (10 mM) 0.5 μL; FIP / BIP (20 mM) 1.5 μL; LF / LB (10 mM) 1 μL; MgSO4 (100 mM) 1.5 μL; dNTPs (10 mM) 8 μL; Hydroxynaphthol blue (HNB) aqueous solution (3 mM) 1 μL; ddH2O 3.8μL; 1 μL of plant cDNA sample.

5. The method according to claim 1, wherein in step (1), the characteristic is: in In a pollution-free environment, a template-free reaction system is first prepared, then sealed with 25 μL of paraffin oil before adding the template to avoid false positive results caused by aerosol contamination.

6. The method according to claim 1, wherein step (2) is characterized by: The loop-mediated isothermal amplification was carried out under isothermal reaction conditions of 63℃ for 30 min.

7. The detection system as described in claim 3, characterized in that: The HNB solution should be prepared as a 100× stock solution with a concentration of 12 mM, and should be diluted to a 25× working solution before use.

8. The use of the primer set according to claim 3 in the preparation of a product for rapid detection of Atractylodes lancea mild mottled virus.

9. The application of the Rep gene of Atractylodes lancea mild mottle virus, characterized by the nucleotide sequence shown in SEQ ID NO. 1, as a target gene in the preparation of a rapid detection method for the virus.

10. The application of the method according to any one of claims 1 to 7 in the rapid visual detection of Atractylodes lancea mild mottled virus.

Images