A ssr molecular marker linked to a chinese cabbage clubroot resistance gene and a method for obtaining the same

Abstract

This invention discloses an SSR molecular marker linked to a clubroot resistance gene in Chinese cabbage and its acquisition method. The method involves hybridizing the clubroot-resistant variety ECD04 and the susceptible variety ECD05 to obtain the F1 generation. 1 Substitute, then self-fertilize to obtain F 2 According to the grading criteria for clubroot disease, F... 2 It is divided into disease-resistant and disease-susceptible pools; SSR markers were developed based on the ECD04 reference genome, and primers for 110 candidate markers were selected on 10 chromosomes. 2 PCR amplification was performed in extreme pools of clubroot disease resistant and susceptible individuals, followed by polyacrylamide gel electrophoresis detection. The amplification was then performed on chromosome A08. BraSSR36411_E4 The primers exhibited significant polymorphism in the resistant and susceptible pools, with a single-plant validation accuracy of 80.7%. This marker can be used for marker-assisted selection breeding of clubroot disease in Chinese cabbage, which is of great significance for the innovation of clubroot-resistant germplasm and the theoretical research on disease resistance in Brassica crops.

Description

An SSR molecular marker linked to a clubroot resistance gene in Chinese cabbage and its acquisition method Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to an SSR molecular marker linked to the clubroot resistance gene of Chinese cabbage (Brassica rapa L.) and a method for obtaining it. Background Technology

[0002] Chinese cabbage is one of the important vegetables in the Brassicaceae family, genus Brassica. It is widely distributed around the world. Through domestication and artificial selection, Chinese cabbage has given rise to many subspecies and varieties, including heading Chinese cabbage (var. pekinensis (Rupr.) J. Caoet Sh. Cao), non-heading Chinese cabbage (var. communis Tsen et Lee, Pak Choi), choy sum (var. parachinensis (Bailey) Tsen et Lee), turnip (B. campestris ssp. rapifera Sinsk), and tatsoi (var. rosularis Tsen et Lee), etc., which have high economic value.

[0003] Clubroot disease, caused by Plasmodiophora brassicae Woronin, is a significant threat to Chinese cabbage production. Plasmodiophora brassicae Woronin is an obligate, intracellular parasitic protist, belonging to the kingdom Protistae, phylum Plasmodiophora, class Plasmodiophora, order Plasmodiophorales, and genus Plasmodiophora. Its dormant spores have an extremely strong survival capacity in soil; studies have shown that their half-life in soil is 3-6 years, and severely affected soils can take more than 17 years to recover. Under suitable conditions, dormant spores of *Cladosporium* germinate, releasing infectious primary zoospores. These zoospores cause primary infection in the root hairs or epidermal cells of the host plant. The resulting mononuclear protoplasmic masses undergo mitosis to develop into multinucleated primary protoplasmic masses, which then develop into zoosporangia. These secondary zoospores enter the host cortex, causing secondary infection, leading to root swelling and wilting of the above-ground parts. According to reports, clubroot disease has occurred in several countries, causing approximately 10%–15% yield loss in cruciferous crops worldwide.

[0004] Currently, the main methods for controlling clubroot disease in cruciferous crops include physical control, chemical control, biological control, agricultural control, and breeding of disease-resistant varieties. Due to the rapid variation of physiological races of clubroot fungus and its tendency to develop drug resistance, as well as the increasing emphasis on human health and environmental safety, the main method for achieving long-lasting resistance to clubroot fungus is to cultivate broad-spectrum resistant materials.

[0005] Analyzing DNA sequence polymorphisms is fundamental and crucial for genetic research on the Chinese cabbage genome. Currently, various molecular markers are applied to genetic breeding research in cruciferous vegetables, including random amplified polymorphic DNA (RAPD), restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), sequence-related amplified polymorphism (SRAP), sequence-characterized amplified regions (SCAR), and single nucleotide polymorphisms (SNPs). Nucleotide polymorphisms (SNPs), and SSR markers, due to their high polymorphism, multiple allelicity, codominance, ease of PCR detection, high reproducibility, high universality, abundance, and good genome coverage, are increasingly widely used in research on genetic diversity, quantitative trait loci, genetic mapping, gene localization, variety identification, plant classification and evolution, and comparative genomics. Therefore, identifying SSR markers closely linked to clubroot disease is of great significance for the identification of clubroot resistance genes and the breeding of resistant varieties. Summary of the Invention

[0006] The purpose of this invention is to address the shortcomings of existing technologies by providing an SSR molecular marker linked to the clubroot resistance gene in Chinese cabbage and a method for obtaining it.

[0007] The objective of this invention is achieved through the following technical solution: This invention provides an SSR molecular marker linked to the clubroot resistance gene of Chinese cabbage. The nucleotide sequence of this molecular marker in the disease-resistant population is shown in SEQ ID No. 1, and the nucleotide sequence of this molecular marker in the disease-susceptible population is shown in SEQ ID No. 2.

[0008] Furthermore, the upstream primer of the molecular marker for clubroot resistance in Chinese cabbage is BraSSR36411_E4, the nucleotide sequence of which is shown in SEQ ID No. 3; the downstream primer of the molecular marker for clubroot resistance in Chinese cabbage is BraSSR36411_E4, the nucleotide sequence of which is shown in SEQ ID No. 4.

[0009] This invention provides a method for obtaining an SSR molecular marker linked to the clubroot resistance gene in Chinese cabbage, as described above, comprising the following steps:

[0010] (1) Population construction: The parental materials of the clubroot resistant variety ECD04 (turnip) and the susceptible variety ECD05 (Chinese cabbage) were used to cross and obtain the F1 generation. After self-pollination of the F1 generation, the F2 generation segregating population was obtained.

[0011] (2) Establish an extreme disease-resistant pool (R-Pool) and an extreme disease-susceptible pool (S-Pool) in the F2 generation population, and extract DNA;

[0012] (3) Use the Krait identification tool and refer to the ECD04 genome to develop SSR markers;

[0013] (4) Based on the developed SSR markers, 110 SSR markers were selected from 10 chromosomes. The nucleotide sequences of some of their primers are shown in SEQ ID No. 5-24. Then, individuals in the extreme resistance and susceptibility pools were subjected to PCR amplification. The polymorphism of each SSR marker in the extreme resistance pool and the extreme susceptibility pool was detected by polyacrylamide gel electrophoresis to screen out the SSR marker BraSSR36411_E4 that is linked to the target trait. The target trait is clubroot resistance. Finally, the screening of SSR markers linked to clubroot resistance was completed.

[0014] (5) Validation of chain markers.

[0015] The beneficial effects of this invention are as follows: This invention obtains an F2 population by hybridizing clubroot-resistant and susceptible materials, establishes extreme-resistant and extreme-susceptible mixed pools, and develops SSR markers based on the ECD04 genome using the Krait recognition tool. Through screening, a pair of SSR marker primers linked to the clubroot resistance gene are obtained, which can be used for the localization and identification of the ECD04 resistance gene and for molecular marker-assisted breeding of clubroot resistance. This lays the foundation for further research on its disease resistance mechanism and biological function. Therefore, this invention is of great significance in the practice of cabbage breeding and the theoretical research of clubroot resistance. Attached Figure Description

[0016] Figure 1 shows an extreme pool of plants resistant to clubroot disease;

[0017] Figure 2 shows an extreme pool of patients infected with clubroot disease;

[0018] Figure 3 shows the amplification results of the BraSSR36411_E4 primer pair for the clubroot resistance and susceptibility gene pool; in Figure 3, (a) is an electrophoresis image of a single plant amplified from the F2 generation extreme resistance pool and extreme susceptibility pool; Figure 3, (b) is an electrophoresis image of a single plant amplified from the F2 generation extreme resistance pool and extreme susceptibility pool; and Figure 3, (c) is an electrophoresis image of another single plant amplified from the F2 generation extreme resistance pool and extreme susceptibility pool.

[0019] Figure 4 shows the sequence alignment of the amplification products of BraSSR36411_E4 primers in clubroot resistant, susceptible and parental populations.

[0020] Figure 5 shows the BLAST plot of the sequencing results of the amplification products (upper band) of BraSSR36411_E4 primers in the clubroot resistant population in the Chinese Cabbage Database (BRAD).

[0021] Figure 6 shows the BLAST plot of the sequencing results of the amplification products (lower bands) of the BraSSR36411_E4 primers in the clubroot disease population in the Chinese Cabbage Database (BRAD). Detailed Implementation

[0022] Exemplary embodiments will now be described in detail, examples of which are illustrated in the accompanying drawings. When the following description relates to the drawings, unless otherwise indicated, the same numbers in different drawings represent the same or similar elements. The embodiments described in the following exemplary embodiments do not represent all embodiments consistent with this application. Rather, they are merely examples of apparatuses and methods consistent with some aspects of this application as detailed in the appended claims. It should be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not intended to limit this application.

[0023] The terminology used in this application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. The singular forms “a,” “the,” and “the” used in this application and the appended claims are also intended to include the plural forms unless the context clearly indicates otherwise. It should also be understood that the term “and / or” as used herein refers to and includes any or all possible combinations of one or more of the associated listed items.

[0024] It should be understood that although the terms first, second, third, etc., may be used in this application to describe various information, such information should not be limited to these terms. These terms are only used to distinguish information of the same type from one another. For example, without departing from the scope of this application, first information may also be referred to as second information, and similarly, second information may also be referred to as first information. Depending on the context, the word "if" as used herein may be interpreted as "when," "in response to determination," or "includes." Moreover, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process or method that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process or method. Without further limitations, an element defined by the phrase "comprising a..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.

[0025] The present invention will now be described in detail with reference to the accompanying drawings. Unless otherwise specified, the features of the following embodiments and implementations can be combined with each other.

[0026] Example 1: Obtaining molecular markers linked to the clubroot resistance gene in Chinese cabbage

[0027] (1) Two parental materials, “ECD04” and “ECD05”, were sown in the experimental field of the West District of Zijingang Campus of Zhejiang University. The two parents were crossed to obtain the F1 generation, and the F2 generation was obtained by single-plant self-pollination of the F1.

[0028] (2) Experiments on the infection and disease development of *Plasmodiophora brassicae* in the F2 generation population and observation of its phenotype:

[0029] (2.1) Preparation of a suspension of spores of *Plasmodiophora* species:

[0030] (2.1.1) Take out the diseased root stored in the -20℃ refrigerator and thaw it.

[0031] (2.1.2) Disinfect by soaking in 70% ethanol solution for 1 min.

[0032] (2.1.3) Treat with 10% NaClO for 20 min, cover with tin foil to block light, and rinse 3 times with sterile water.

[0033] The root tubers were juiced into a homogenate using a juicer and filtered twice through sterilized gauze. The filtrate was centrifuged at 500 rpm for 5 min, and the black precipitate was discarded, leaving the supernatant and gray precipitate. A new, clean 50 mL centrifuge tube was used, and sterile water was added to bring the volume to 45 mL. The tube was centrifuged at 4000 rpm for 15 min, and the supernatant was discarded. The precipitate was dissolved in sterile water and centrifuged at 4000 rpm for 10 min. This process was repeated once. The precipitate was dissolved in 50% sucrose and centrifuged at 3100 rpm for 10 min, and the supernatant was discarded. Sterile water was added to bring the volume to 45 mL, and the tube was centrifuged at 4000 rpm for 10 min. The supernatant was discarded, and this process was repeated 2-3 times. The precipitate was then dissolved in 1 mL of sterile water to obtain a high-concentration spore suspension.

[0034] (2.2) Microscopic examination of dormant spores of *Plasmodiophora stylosa*:

[0035] Use a pipette to draw up the spore suspension and transfer it to a hemocytometer (model 1 / 400 mm). 2 Add the suspension to the groove at the edge of the coverslip until the coverslip is filled with the *Plasmodiophora* spore suspension. Count the spores under a microscope, placing them in the grid below the top and left edges. The spore concentration (spores / ml) is calculated as: (number of dormant spores in the top left + bottom left + center + top right + bottom right total of 5 large grids) / 80 × 400 × 10⁻⁶. 4 × dilution factor, then adjust the spore suspension concentration to 1×10⁻⁶. 7 (each vial / ml), store at 4°C for later use.

[0036] (2.3) Observation of infection, pathogenesis, and phenotype:

[0037] When the true leaves emerge after the F2 population seeds are sown, the spore suspension prepared in step (2.2) is injected into each plant at a concentration of 1×10⁻⁶ ml. 7 A suspension of *Cladosporium* spores (number of spores / ml) was prepared and grown under normal conditions for 42 days. The plants were carefully removed, and the roots were thoroughly cleaned with water. The disease status of the roots was then statistically analyzed and photographed. In this application, the disease status was divided into four levels: 0 to 3. Level 0: no root swelling, normal development; Level 1: no taproot swelling, normal development, small lumps on lateral roots; Level 2: swelling of more than 1 / 3 of the taproot and lateral roots; Level 3: significant swelling of taproot and lateral roots, even cracking and rotting. Plants with a disease level of 0 in the F2 population were designated as disease-resistant (Figure 1), and plants with a disease level of 3 were designated as susceptible (Figure 2).

[0038] (3) DNA extraction from individual plants in the resistant and susceptible pools:

[0039] DNA was extracted using a modified SDS method: 200 µl of DNA extraction buffer and magnetic beads were added to centrifuge tubes containing leaf samples. The tissue was then homogenized using a homogenizer (65 Hz, 120 s) to obtain a homogenized tissue fluid. All the homogenized tissue fluid was transferred to 1.5 ml centrifuge tubes and centrifuged at 13000 rpm for 8 min to obtain the supernatant. New 1.5 ml centrifuge tubes were prepared, and 100 µl of isopropanol was added to each tube. 100 µl of the supernatant was transferred to a centrifuge tube containing an equal volume of isopropanol, gently shaken approximately 50 times, and incubated at 25°C for 5 min. The mixture was then centrifuged at 13000 rpm for 6 min, and the supernatant was discarded. The precipitate was washed twice with 1 ml of 70 vol% ethanol, specifically by shaking up and down 20 times, centrifuging at 13000 rpm for 3 min, discarding the supernatant, and repeating once. The mixture was then centrifuged empty for 1 min. After washing, the liquid was aspirated, the precipitate was air-dried for 5 min, and 25-50 µl of ddH2O was added. The precipitate was then stored at -20°C.

[0040] (4) Develop SSR markers based on the ECD04 genome:

[0041] Using the genome of the disease-resistant variety ECD04 as a reference genome, the Krait identification tool was used to search for the presence of SSR motifs in the genome sequence. The parameters were set as follows: minimum repeat unit number of 12 mononucleotides, 7 dinucleotides, 5 trinucleotides, 4 tetranucleotides, 4 pentanucleotides, and 4 hexanucleotides. Simultaneously, incomplete repeat SSRs with a few base breaks (intervals less than or equal to 10 bp) were also screened, and primers corresponding to the SSR sites were further generated.

[0042] (5) Screening for SSR markers linked to clubroot resistance:

[0043] (5.1) The SSR marker primers developed in step (4) above (about 10 primers per chromosome, for a total of 110 SSR markers) were used to amplify the DNA of single plants in the disease-resistant and disease-susceptible pools constructed in step (2.3). The upstream and downstream SSR primers were synthesized by Hangzhou Youkang Biotechnology Co., Ltd. It should be noted that in subsequent steps, the 110 primer pairs mentioned above were used to perform PCR amplification in the clubroot disease-resistant and disease-susceptible populations, as shown in Table 1 (partial). The PCR products were detected by polyacrylamide gel electrophoresis to detect their differences.

[0044] Table 1: Primer sequences (partial) for PCR amplification in clubroot resistant and susceptible populations.

[0045]

[0046] (5.2) The PCR system consisted of 12.5 µL of 2×T5 Super PCR Mix (PAGE) (TSINGKE), 9.5 µL of deionized water, 10 µM of upstream primer, 10 µM of downstream primer, and 1 µg of DNA template. The PCR amplification program was as follows: 98℃ pre-denaturation for 2 min, followed by 32 cycles, each cycle consisting of: 98℃ denaturation for 10 s, 57℃ annealing for 10 s, and 72℃ extension for 5 s; followed by a final extension at 72℃ for 2 min. The PCR reaction was performed on a BIO-RAD S1000™ Thermal Cycler instrument, and the samples were stored at 4℃.

[0047] (5.3) The reagents and instruments required for PAGE electrophoresis specifically include:

[0048] (5.3.1) Prepare a 30% collagen solution by mass: Add 29g of acrylamide and 1g of N,N'-methylbisacrylamide to a centrifuge tube, then add deionized water to 100mL, stir to dissolve at 25℃, and store at 4℃ protected from light.

[0049] (5.3.2) Prepare a 10% ammonium persulfate (APS) solution: Dissolve 1 g of ammonium persulfate in 10 mL of deionized water and then store at 4 °C.

[0050] (5.3.3) Prepare a 5×TBE (Tris-boric acid-EDTA) buffer solution with pH 8.3: Add 27g of Tris base, 13.75g of boric acid and 1.86g of Na2EDTA·H2O to deionized water, bring the volume up to 500 mL, and then store at 4℃.

[0051] (5.3.4) Prepare tetramethylethylenediamine (TEMED).

[0052] (5.3.5) Sealing adhesive: 1% agarose solution, 100ml of 1×TAE + 1g agar powder mixed and heated to dissolve.

[0053] (5.3.6) Staining solution: Dissolve 50 mL of anhydrous ethanol and 0.5 g of silver nitrate in deionized water, make up to 500 mL, store in a brown bottle, and keep away from light at 25 °C.

[0054] (5.3.7) Colorimetric solution: Dissolve 10g of sodium hydroxide in deionized water, bring the volume to 500mL, and store at 25℃. When needed during PAGE electrophoresis, add 1mL of 37% formaldehyde per 250mL of colorimetric solution, and prepare fresh before use.

[0055] (5.3.8) Instruments: including DYY-6C constant voltage and constant current electrophoresis apparatus, DYCZ-30C double clamp vertical electrophoresis tank, Tanon 2500 fully automatic digital gel image analysis system, etc.

[0056] Furthermore, PAGE electrophoresis specifically includes the following steps:

[0057] (a1) Preliminary preparation: The glass plate, comb, rubber sleeve, electrophoresis tank, etc. used for glue preparation are all washed with detergent, rinsed with tap water, dried, and wiped with alcohol.

[0058] (a2) Install the electrophoresis tank: Insert the two matching glass plates into the rubber sleeve, place them into the electrophoresis tank, make the lower glass plate face the negative electrode, keep the electrophoresis tank horizontal, and tighten the screws on the electrophoresis tank to make the glass plates and rubber sleeves secure and sealed.

[0059] (a3) Sealing: Dissolve 1% agarose gel by boiling in a microwave oven, use a dropper to draw up the gel, and seal the bottom of the glass plate and rubber sleeve on both sides.

[0060] (a4) Gel preparation: Mix the following reagents in a fume hood: 19.65 mL ddH2O, 20 mL 30% collagen solution, 10 mL 5×TBE, 35 mL TEMED, and 350 mL APS.

[0061] (a5) Gel pouring: Place the assembled electrophoresis tank into the fume hood, expel the air with the needle of a 100mL syringe pointing upwards, draw up the gel solution, insert the needle into the gap between the two glass plates, and slowly inject the gel solution along the plate wall until it is full.

[0062] (a6) Insert the comb: Immediately and gently insert the appropriate comb into the gel solution, without leaving any air bubbles, so that the comb's clip is flat on the top of the glass plate.

[0063] (a7) Polymerization: The electrophoresis tank is placed in a fume hood for about 30 minutes for polymerization. If the gel shrinks, it should be replenished in time. When fully polymerized, two obvious refractive lines can be seen under the comb teeth.

[0064] (a8) Remove the comb: Soak the top of the gel with 1×TBE solution for 2-4 minutes, carefully remove the comb, and immediately rinse the sample well with 1×TBE to prevent the small amount of polyacrylamide solution left on the comb from polymerizing in the sample well and causing an uneven surface.

[0065] (a9) Spotting: Pour an appropriate amount of 1×TBE solution into the electrophoresis tank. The water level in the middle should be higher than the lower glass plate, and the water level on both sides should be appropriate. Use a dropper to remove air bubbles from the spotting wells. Add 0.8µL of sample to each spotting well and add markers on both sides.

[0066] (a10) Electrophoresis: Set the voltage to 120V, the current to 90mA, and the time to 3.5h, and start electrophoresis.

[0067] (a11) Staining: After electrophoresis, remove the glass plate, transfer the gel to the staining solution, and shake on a shaker at 40-60 rpm for 8-10 minutes at 25°C.

[0068] (a12) Washing: Discard the staining solution and wash the gel twice with ddH2O.

[0069] (a13) Color development: Add an appropriate amount of color development solution (200mL + 650 mL formaldehyde), shake at 40~60rpm until a clear band appears, pour out the color development solution, and rinse 2-3 times with ddH2O.

[0070] (a14) Photograph: Place the gel on a white substrate and take a picture under white light using a Tanon 2500 fully automated digital gel image analyzer.

[0071] It should be noted that in subsequent steps, 110 primer pairs were used for PCR amplification in clubroot resistant and susceptible populations. The PCR products were then detected by polyacrylamide gel electrophoresis to identify their differences, thereby ultimately screening out the SSR molecular marker BraSSR36411_E4, which is linked to the target trait and located on chromosome A08. The single-plant verification accuracy rate was 80.7%.

[0072] For example, the amplification results of the clubroot resistance / susceptibility gene pools using the BraSSR36411_E4 primer pair are shown in Figure 3. In Figure 3(a) and Figure 3(b), lanes 1-11 represent the clubroot resistance gene pool, lanes 12-22 represent the clubroot susceptibility gene pool, and M is a 100 bp plus DNA marker (Thermo Fisher). In Figure 3(c), lanes 1-11 represent the clubroot resistance gene pool, lanes 12-15 represent the susceptibility gene pool, and M is a 100 bp plus DNA marker (Thermo).

[0073] Example 2: Recovery and sequencing of the PCR amplification product of the screened SSR molecular marker BraSSR36411_E4.

[0074] Figure 4 shows the comparison of PCR amplification products of the obtained SSR molecular marker BraSSR36411_E4 in clubroot resistant and susceptible populations and in the parental lines ECD04 and ECD05. In the clubroot resistant population, the PCR amplification product of the SSR molecular marker BraSSR36411_E4 mostly showed only the upper band, with a size of 143 bp. The BLAT results in the Chinese cabbage database RBAD are shown in Figure 5. Its nucleotide sequence is as shown in SEQ ID No. 1, specifically 5'- GAAGAGATGCTGAAGCTGCCATTAATGGAGACTCTCCATTACCTTCCTTGTCTGATCCAAAACTAGGTAACTCTTTTTTTTTTTTTTTTTTTTGAACAACAGGTAACTCTTTCTACATAACTCCCGGAAATCTAGGGTTTCTTTC- 3'; In clubroot-infected populations, the PCR amplification products of the SSR molecular marker BraSSR36411_E4 mostly contained the lower band, which was 109 bp in size. The BLAT results in the Chinese cabbage database RBAD are shown in Figure 6. Its nucleotide sequence is shown in SEQ ID No. 2, specifically 5'- GAAGAGATGCTGAAGCTGCCATTGATGGAGACTCTCCATTACCTTCCTTGTCTGATACAAAACTAGGTAACTCTTTCTACATAACTCCCGGAAATCTAGGGTTTCTTTC- 3'.

[0075] The above description represents preferred embodiments of the present invention. These embodiments are provided to better explain the principles and practical applications of the present invention, enabling those skilled in the art to understand and utilize it effectively. However, these embodiments do not describe all details in detail, and improvements or modifications can be made based on them, which will be obvious to anyone skilled in the art. Therefore, all such modifications and improvements made based on the present invention fall within the scope of protection claimed by the present invention.

Claims

1. An SSR molecular marker linked to a clubroot resistance gene in Chinese cabbage, characterized in that, The nucleotide sequence of this molecular marker in the disease-resistant population is shown in SEQ ID No. 1, and the nucleotide sequence of this molecular marker in the disease-susceptible population is shown in SEQ ID No.

2.

2. The SSR molecular marker linked to the clubroot resistance gene in Chinese cabbage according to claim 1, characterized in that, The upstream primer of the molecular marker for clubroot resistance in Chinese cabbage is BraSSR36411_E4, and its nucleotide sequence is shown in SEQ ID No. 3; the downstream primer of the molecular marker for clubroot resistance in Chinese cabbage is BraSSR36411_E4, and its nucleotide sequence is shown in SEQ ID No.

4.

3. A method for obtaining an SSR molecular marker linked to the clubroot resistance gene of Chinese cabbage as described in any one of claims 1-2, characterized in that, Includes the following steps: (1) Population construction: Using parental materials of clubroot-resistant and susceptible varieties, hybridization combinations were prepared to construct F2 segregating populations and establish extreme disease-resistant and extreme disease-susceptible pools; among them, the clubroot-resistant variety was turnip ECD04 and the susceptible variety was Chinese cabbage ECD05; (2) Based on the genome of the disease-resistant turnip ECD04, SSR markers were developed; (3) DNA was extracted from individuals in the extreme disease-resistant and extreme disease-susceptible pools of the F2 population, respectively. According to the developed SSR markers, 110 SSR markers were selected from 10 chromosomes. The nucleotide sequences of some primers are shown in SEQ ID No. 5-24. Then, individuals in the extreme disease-resistant and extreme disease-susceptible pools were amplified by PCR. The polymorphism of each SSR marker in the extreme disease-resistant and extreme disease-susceptible pools was detected by polyacrylamide gel electrophoresis to screen out the SSR marker BraSSR36411_E4 which is linked to the target trait; wherein, the target trait is clubroot resistance.

Images