Pig UBC promoter and application thereof
By using the porcine endogenous UBC promoter in transgenic pigs, the problems of gene silencing and inconsistent expression caused by exogenous promoters were solved, achieving efficient and stable expression of exogenous genes and improving the safety and stability of transgenic pigs.
Patent Information
- Application Number
- CN202511146612.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-15
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2045-08-15
AI Technical Summary
Existing technologies for preparing transgenic pigs often result in gene silencing and inconsistent expression when using exogenous promoters, leading to low expression efficiency and affecting the safety and stability of transgenic pigs.
Using the porcine endogenous UBC promoter, the expression of exogenous genes, including the human CD47 gene, is driven in porcine cells via a recombinant vector. Site-specific integration is performed using the CRISPR Cas9 system to ensure efficient, stable, and widespread gene expression.
This study achieved efficient, stable, and widespread expression of exogenous genes using the porcine endogenous UBC promoter in porcine tissues and cells, avoiding problems such as gene silencing and inconsistent expression, and improving the safety and stability of transgenic pigs.
Smart Images

Figure CN120989077A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering, specifically to a porcine UBC promoter and its uses. Background Technology
[0002] Pigs share high anatomical and physiological homology with humans, making them a hot research topic for disease models and xenotransplantation. Consequently, the demand for transgenic pigs is increasing. However, the safety and stability of transgenic organisms (GMOs) pose challenges to the industrialization of transgenic pigs. Current technologies for preparing transgenic pigs mostly utilize promoters derived from viruses or other species to drive gene expression, which can easily lead to GMO safety issues during the preparation of transgenic materials. Furthermore, using the same promoter in the same transgenic event may cause gene silencing, affecting gene expression efficiency. Therefore, identifying highly efficient endogenous promoters in pigs is essential for the breeding and industrialization of transgenic pigs.
[0003] Housekeeping genes are a class of genes that are less affected by environmental factors and are consistently and stably expressed in all growth stages or almost all tissues of an individual. Screening for candidate housekeeping genes with high expression in pig tissues based on pig RNA sequencing data and developing promoters for housekeeping gene expression are of great significance for producing stable and safe transgenic pigs. However, current research on the efficient and stable initiation of exogenous gene expression by housekeeping gene promoters is limited, and research on the efficient expression of exogenous genes in pigs driven by the pig UBC promoter is even more lacking. Summary of the Invention
[0004] To address the above problems, the present invention provides a porcine UBC promoter, the nucleotide sequence of which is shown in SEQ ID No. 1.
[0005] The present invention also provides a recombinant vector, which is a plasmid containing a porcine UBC promoter and a target gene with a nucleotide sequence as shown in SEQ ID No. 1.
[0006] Furthermore, the target gene is a porcine exogenous gene; the porcine exogenous gene includes the human CD47 gene.
[0007] Furthermore, the plasmid includes a T plasmid vector.
[0008] The present invention also provides the aforementioned porcine UBC promoter and the use of the aforementioned recombinant vector in the preparation of reagents that promote the specific expression of the target gene in porcine cells.
[0009] Furthermore, the target gene is a porcine exogenous gene; the porcine exogenous gene includes the human CD47 gene.
[0010] Furthermore, the porcine cells include porcine ear fibroblasts.
[0011] The present invention also provides a recombinant cell, which is a porcine cell in which the aforementioned porcine UBC promoter or the aforementioned recombinant vector has been introduced.
[0012] Furthermore, the porcine cells include porcine ear fibroblasts.
[0013] The present invention also provides the use of the aforementioned recombinant cells in the preparation of transgenic animals, wherein the transgenic animal is a transgenic pig.
[0014] The "exogenous pig gene" mentioned in this invention refers to a gene that is not originally present in the pig and is introduced into the pig genome through genetic engineering technology.
[0015] Compared with the prior art, the present invention has the following significant effects:
[0016] This invention isolates and identifies a porcine endogenous UBC promoter. Cellular experiments confirm that it can drive the efficient, stable, and widespread expression of exogenous genes in porcine tissues and cells, avoiding the problems of gene silencing, inconsistent expression, and low expression efficiency that may be encountered with exogenous promoters in the preparation of transgenic pig products. The use of the porcine endogenous UBC promoter in the preparation of transgenic pigs has practical application value.
[0017] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.
[0018] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description
[0019] Figure 1 Maps of EGFP recombinant vectors linked by different promoters;
[0020] Figure 2 Results of EGFP expression detection after transfection of porcine ear fibroblasts with EGFP recombinant vectors linked to different promoters;
[0021] Figure 3 Schematic diagram of targeted knock-in of the PUBC / EF1α-EGFP-polyA sequence at the H11 site in pig ear fibroblasts;
[0022] Figure 4 Mean fluorescence intensity of porcine ear fibroblasts after electroporation of the PUBC / EF1α-EGFP-polyA recombinant vector;
[0023] Figure 5Schematic diagram of site-directed knock-in of PUBC / EF1α-hCD47-polyA sequence into pig ear fibroblasts at the H11 site;
[0024] Figure 6 Flow cytometry was used to detect the expression of hCD47 protein driven by human UBC, EF1α, and porcine UBC promoters. Detailed Implementation
[0025] The raw materials, reagents, and equipment used in the specific embodiments of this invention are all known products and can be purchased commercially. The nucleotide sequence information involved is as follows;
[0026] Pig UBC promoter sequence (SEQ ID No. 1):
[0027]
[0028] CAG promoter sequence (SEQ ID No. 2):
[0029]
[0030] EF1α promoter sequence (SEQ ID No. 3):
[0031]
[0032] EGFP sequence (SEQ ID No. 4):
[0033] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGAATTCTAA
[0034] SV40 polyA sequence (SEQ ID No. 5):
[0035] TAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTT
[0036] Left homologous arm sequence (SEQ ID No. 6):
[0037] AGCTATGGCCGTTTCTTGAGCCTTAATAAAGACCCCAATGGGATAGTTCAGGCTGGGCTGACCCTATAGGTAGGTAGTTGTATGGTTAATACCAGATTGCAGCGCGCAATTTCTAAAATTAAACCCACTTAGTAAACAGTCTGTTTACTGGGTAATCATGTATATGATAGTTTCTCCCAAACAAATACCCACGTTTATTGGGACAAAAGTTGTTAGGGAAAATGGGGCCTCAGAGTTATGATTCAAGTCATAATTCTTTCCATTTATAATTTCACTCGAGACTCTGTTAACTGATTCCTTGTGTGTTGTATCTTACTCCTCAGCTCACAATTACTTTTAGTTATTCACCTTAACTGTATGAATAACAGTGGAGAAAAGGATTCTACCAGAATACTCTAATTATGGTTTTGAGTCCCCTTTCCAGACTGAAGATTTTTCAGTCTTTTTGATCTGAGGTGATTTTTCAGTCTTTTCGATCTGAGGTGACAGTCTCAAGCTCCTCAATTCACCCAGTCTCTTGATACTTGTCCATTTAGGGCCACCAAAGCTACTTTGACTTCATACTAGAGAGTCAATTAATGAGGCCATTCTCTGATGGACAGGTGAAGCAGGCAAGGTGACTATATTTTGACTAAACGGTAGAAAACAGCCTGAGTGTTAACAGTGTAGCCTATAAAACCCAGAGCTGCCCACCCTGATCTAAACTTCCAGGAACATAAGAAAGTAGGTCACATTTCAGTAAAACCTGGCTTTGTGGATTGAGCATGGTCTGTCTCTTCCTGGTACTTCATTAGTCCCCTAAGTGGGATTTGCTGAGCAAGACT
[0038] Right homologous arm sequence (SEQ ID No. 7):
[0039]
[0040] Human CD47 sequence (SEQ ID No. 8):
[0041] ATGTGGCCCCTGGTAGCGGCGCTGTTGCTGGGCTCGGCGTGCTGCGGATCAGCTCAGCTACTATTTAATAAAACAAAATCTGTAGAATTCACGTTTTGTAATGACACTGTCGTCATTCCATGCTTTGTTACTAATATGGAGGCACAAAACACTACTGAAGTATACGTAAAGTGGAAATTTAAAGGAAGAGATATTTACACCTTTGATGGAGCTCTAAACAAGTCCACTGTCCCCACTGACTTTAGTAGTGCAAAAATTGAAGTCTCACAATTACTAAAAGGAGATGCCTCTTTGAAGATGGATAAGAGTGATGCTGTCTCACACACAGGAAACTACACTTGTGAAGTAACAGAATTAACCAGAGAAGGTGAAACGATCATCGAGCTAAAATATCGTGTTGTTTCATGGTTTTCTCCAAATGAAAATATTCTTATTGTTATTTTCCCAATTTTTGCTATACTCCTGTTCTGGGGACAGTTTGGTATTAAAACACTTAAATATAGATCCGGTGGTATGGATGAGAAAACAATTGCTTTACTTGTTGCTGGACTAGTGATCACTGTCATTGTCATTGTTGGAGCCATTCTTTTCGTCCCAGGTGAATATTCATTAAAGAATGCTACTGGCCTTGGTTTAATTGTGACTTCTACAGGGATATTAATATTACTTCACTACTATGTGTTTAGTACAGCGATTGGATTAACCTCCTTCGTCATTGCCATATTGGTTATTCAGGTGATAGCCTATATCCTCGCTGTGGTTGGACTGAGTCTCTGTATTGCGGCGTGTATACCAATGCATGGCCCTCTTCTGATTTCAGGTTTGAGTATCTTAGCTCTAGCACAATTACTTGGACTAGTTTATATGAAATTTGTGGCTTCCAATCAGAAGACTATACAACCTCCTAGGAATAACTGA
[0042] Human UBC promoter sequence (SEQ ID No. 9):
[0043]
[0044] sgRNA sequence (SEQ ID No. 10): TGGAGTATTTCTGTAATTG
[0045] Example 1: Study on the activation of human gene expression by promoter in pig cells
[0046] 1. Effects of different promoters on transient expression of the EGFP gene in porcine cells
[0047] 1.1 Construction of EGFP expression vector
[0048] The porcine UBC, CAG, and EF1α promoter sequences were obtained by PCR amplification. After sequencing verification, the EGFP and SV40polyA sequences were ligated using overlap PCR and then constructed into a T vector to obtain a recombinant EGFP expression vector. (Details follow...) Figure 1 As shown.
[0049] 1.2 Tests of promoter-driven gene expression levels
[0050] The recombinant EGFP expression vector was transfected into porcine ear fibroblasts via electroporation. After 48 hours, the EGFP fluorescence intensity was detected by flow cytometry. Untransfected porcine ear fibroblasts served as a negative control. Results are as follows: Figure 2 As shown.
[0051] Figure 2 The results showed that the expression levels of the porcine UBC promoter were similar to those of the CAG and EF1α promoters, and the EGFP-positive cell population of the UBC promoter was more concentrated with a smaller fluorescence intensity coefficient of variation, indicating that the UBC promoter drove better stability and consistency in gene expression levels.
[0052] 2. Effects of different promoters on stable expression of the EGFP gene in porcine cells
[0053] 2.1 Construction of porcine H11 site-specific integration vector
[0054] The porcine UBC and EF1α promoter sequences were obtained by PCR amplification, and then the left homologous arm, promoter sequence, EGFP sequence, SV40polyA sequence, and right homologous arm were sequentially constructed into a T vector to obtain a porcine H11 site-directed integration vector. Figure 3 As shown.
[0055] 2.2 Testing of gene expression levels driven by different promoters
[0056] The expression levels of driver genes in porcine ear fibroblasts were compared using the CRISPR Cas9 system with those of the porcine UBC promoter and EF1α promoter. Specifically, porcine ear fibroblasts were electroporated with Cas9 protein, sgRNA, and a porcine H11 site-specific integration vector complex (RNP). After 48 hours, the cell suspension was diluted and cultured to allow single cells to proliferate into a single cell population. When a certain number of monoclonal cells were cultured, a portion of the cells were harvested for DNA identification, yielding porcine ear fibroblast monoclonal cells with H11 site-specific integration of EGFP. The EGFP fluorescence intensity was detected by flow cytometry, and the results are as follows: Figure 4 As shown.
[0057] from Figure 4 It is evident that the porcine UBC promoter, compared to the EF1α promoter, is equally effective in driving gene expression intensity, with better consistency in the results. The EF1α promoter is a strong mammalian expression promoter, characterized by its stable ability to drive high expression of downstream genes. The UBC promoter, while driving expression intensity comparable to the EF1α promoter, exhibits better stability, indicating that the UBC promoter has greater practical value in porcine cells.
[0058] 3. Effects of UBC promoters from different sources on stable expression of human CD47 gene in porcine ear fibroblasts
[0059] 3.1 Construction of a vector for site-directed integration of human CD47 at the porcine H11 site
[0060] Human and porcine UBC and EF1α promoter sequences were obtained by PCR amplification. The left homologous arm, promoter sequence, human CD47, SV40polyA sequence, and right homologous arm were then sequentially inserted into a T vector to obtain an expression vector integrating human CD47. Figure 5 As shown.
[0061] 3.2 Tests of promoter-driven gene expression levels
[0062] Using the CRISPR Cas9 system, the expression differences of human UBC promoter, porcine UBC promoter, and EF1α promoter at the porcine ear fibroblast monoclonal cell level were compared. Specifically, porcine ear fibroblasts were electroporated with Cas9 protein, sgRNA, and a porcine H11 site-specific human CD47 vector complex (RNP). After 48 hours, the cell suspension was diluted and cultured to allow single cells to proliferate into a single cell population. When the monoclonal cells reached a certain number, a portion of the cells were harvested for DNA identification, obtaining porcine ear fibroblast monoclonal cells with H11 site-specific human CD47 integration. The monoclonal cells were stained with FITC Mouse Anti-Human CD47, and the fluorescence intensity of hCD47 expression was detected by flow cytometry. The results are as follows: Figure 6 As shown.
[0063] Figure 6 The results showed that the human UBC promoter could not drive the expression of the human CD47 gene in porcine ear fibroblasts. The expression intensity of the EF1α promoter varied significantly, and some monoclonal cells did not express it. The expression results of the porcine UBC promoter showed a high degree of consistency, demonstrating the advantage of using endogenous UBC promoters from the same species.
[0064] In summary, this invention has isolated and identified a porcine endogenous UBC promoter that can drive the efficient, stable, and widespread expression of exogenous genes in porcine tissues and cells, avoiding the problems of gene silencing and inconsistent expression, as well as low expression efficiency, that may be encountered with exogenous promoters in the preparation of transgenic pig products. The use of the porcine endogenous UBC promoter in the preparation of transgenic pigs has practical application value.
Claims
1. A porcine UBC promoter, characterized in that: Its nucleotide sequence is shown in SEQ ID No.
1.
2. A recombinant vector, characterized in that: It is a plasmid containing a porcine UBC promoter and a target gene, with a nucleotide sequence as shown in SEQ ID No.
1.
3. The recombinant vector according to claim 2, characterized in that: The target gene is a porcine exogenous gene; the porcine exogenous gene includes the human CD47 gene.
4. The recombinant vector according to claim 2 or 3, characterized in that: The plasmid includes a T plasmid vector.
5. The use of the porcine UBC promoter of claim 1 and the recombinant vector of any one of claims 2 to 4 in the preparation of a reagent that promotes the specific expression of the target gene in porcine cells.
6. The use according to claim 5, characterized in that: The target gene is a porcine exogenous gene; the porcine exogenous gene includes the human CD47 gene.
7. The use according to claim 5, characterized in that: The porcine cells include porcine ear fibroblasts.
8. A recombinant cell, characterized in that: It is a porcine cell in which the porcine UBC promoter of claim 1 or the recombinant vector of any one of claims 2 to 4 has been introduced.
9. The recombinant cell according to claim 8, characterized in that: The porcine cells include porcine ear fibroblasts.
10. The use of the recombinant cells according to claim 8 or 9 in the preparation of transgenic animals, characterized in that: The genetically modified animal is a genetically modified pig.
Citation Information
Patent Citations
Gene modification for xenotransplantation
CN116322587A
Application of exogenous gene integration site, homologous recombinant vector and construction method of transgenic pig
CN119979551A
Method and apparatus using super-sampling
KR1020240142064A
Dwarfism animal model having IGF-1 genetic mutation and method for producing same
US20210392863A1