BbNudix1.2 sourced from Blumea balsamifera and application of coding gene of BbNudix1.2 in production of borneol

By introducing the BbNudix1.2 protein and its encoding gene derived from Artemisia annua into host cells, the problems of endogenous phosphatase interference with cell metabolism and low yield were solved, and efficient synthesis of borneol was achieved.

CN121006337APending Publication Date: 2025-11-25INSTITUTE OF CHINESE MATERIA MEDICA CHINA ACADEMY OF CHINESE MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410653767.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-05-24
Publication Date
2025-11-25

AI Technical Summary

Technical Problem

In Escherichia coli and Saccharomyces cerevisiae, endogenous phosphatase-mediated borneol synthesis interferes with normal cellular metabolism, and borneol production is low, with the lack of efficient phosphatases leading to insufficient biosynthetic borneol production.

Method used

The BbNudix1.2 protein and its encoding gene derived from arugula were introduced. By expressing this protein or its fusion protein in host cells, the dephosphorylation efficiency of borneol diphosphate was improved. Gene editing was performed using a recombinant vector and a CRISPR-Cas9 system to optimize the expression and activity of phosphatases.

Benefits of technology

It significantly increased the yield of borneol, promoted the synthesis of borneol, and achieved efficient production of borneol.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004857236090000041
    Figure BDA0004857236090000041
  • Figure HDA0004857236100000011
    Figure HDA0004857236100000011
  • Figure HDA0004857236100000012
    Figure HDA0004857236100000012
Patent Text Reader

Abstract

The invention discloses BbNudix1.2 derived from Blumea balsamifera and application of a coding gene of the BbNudix1.2 in production of borneol. The BbNudix1.2 disclosed by the invention is the following A1), A2) or A3): A1) a protein with an amino acid sequence of SEQ ID No.7; a2) a protein which is derived from blumea balsamifera, has more than 85% of identity with the protein in A1) and is related to borneol synthesis; and A3) a fusion protein obtained by connecting a label to the N end or / and C end of A1) or A2). Experiments prove that the BbNudix1.2 protein disclosed by the invention can be used for remarkably improving the yield of the borneol, so that the BbNudix1.2 protein and the coding gene thereof can be used for promoting the synthesis of the borneol, can be used for producing the borneol and also belong to the protection range of the invention.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering and fermentation engineering, and application of BbNudix1.2 from Blumea balsamifera and its coding gene in production of borneol. BACKGROUND

[0002] In the biosynthesis of borneol, borneol-based diphosphate synthase (BPPS) first cyclizes C10 pentenyl precursor geranyl diphosphate (GPP) to generate borneol-based diphosphate (BPP). Subsequently, borneol-based diphosphate (BPP) is hydrolyzed by some phosphatases to borneol. However, the phosphatases involved in the synthesis of borneol in plants have not been fully analyzed so far. This has limited the biosynthesis of borneol in microbial cell factories (①Lei D, Qiu Z, Wu J, Qiao B, Qiao J, Zhao GR. Combining Metabolic and Monoterpene Synthase Engineering for de Novo Production of Monoterpene Alcohols in Escherichia coli. ACS Synth Biol. 2021, 10(6): 1531-1544.; ②Ma R, Su P, Guo J, Jin B, Ma Q, Zhang H, Chen L, Mao L, Tian M, Lai C, Tang J, Cui G, Huang L. Bornyl Diphosphate Synthase From Cinnamomum burmanni and Its Application for (+)-Borneol Biosynthesis in Yeast. Front Bioeng Biotechnol. 2021, 11; 9: 631863.; ③Ma R, Su P, Ma Q, Guo J, Chen S, Jin B, Zhang H, Tang J, Zhou T, Xiao C, Cui G, Huang L. Identification of (-)-bornyl diphosphate synthase from Blumea balsamifera and its application for (-)-borneol biosynthesis in Saccharomyces cerevisiae. Synth Syst Biotechnol. 2021, 7(1): 490-497.).

[0003] Although in Escherichia coli and Saccharomyces cerevisiae, the endogenous phosphatase in cells can mediate the dephosphorylation of borneol-based diphosphate (BPP) to form borneol, the endogenous phosphatase plays an important role in cell metabolism, and the borneol synthesis mediated by the endogenous phosphatase will interfere with the normal metabolism of cells to some extent. Moreover, in the absence of efficient phosphatase, the yield of biosynthetic borneol is very low.

[0004] Therefore, screening and identifying efficient phosphatase to further promote the dephosphorylation of borneol-based diphosphate (BPP) is of great significance to improve the yield of borneol in biosynthesis. SUMMARY

[0005] The technical problem to be solved by the present application is how to produce and improve the yield of borneol.

[0006] To solve the above technical problems, the present application first provides an application of BbNudix1.2 protein derived from Blumea balsamifera (L.) DC. in the production of borneol; the BbNudix1.2 protein is as follows A1), A2) or A3):

[0007] A1) a protein with an amino acid sequence of SEQ ID No. 7;

[0008] A2) a protein derived from Blumea balsamifera (L.) DC. having more than 85% identity with the protein of A1) and being related to borneol synthesis;

[0009] A3) a fusion protein obtained by connecting a tag to the N terminal or / and C terminal of A1) or A2).

[0010] The protein in the above A2) is a protein having 85% or more identity to the amino acid sequence of the protein shown in SEQ ID No. 7 and having the same function. The identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page of the NCBI home page website. For example, the identity (%) can be obtained by calculating the identity of a pair of amino acid sequences in Advanced BLAST 2.1 by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values), respectively, and performing a search. The 85% or more identity refers to 85% identity, 86% identity, 87% identity, 88% identity, 89% identity, 90% identity, 91% identity, 92% identity, 93% identity, 94% identity, 95% identity, 96% identity, 97% identity, 98% identity, or 99% identity.

[0011] The protein in the above A2) can be artificially synthesized, or a gene encoding the same can be synthesized first and then expressed biologically.

[0012] The gene encoding the protein in the above A2) can be obtained by deleting one or several codons of the amino acid residues in the DNA sequence shown in SEQ ID No. 8 or SEQ ID No. 6, and / or performing one or several base pair missense mutations, and / or connecting a coding sequence of a tag to the 5' end and / or 3' end thereof. The DNA molecules shown in SEQ ID No. 8 and SEQ ID No. 6 both encode the protein shown in SEQ ID No. 7.

[0013] The tag in A3) can be a polypeptide or protein fused and expressed with the target protein by using DNA in vitro recombination technology, so as to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag and / or SUMO tag, etc.

[0014] The present application also provides the use of a biological material related to the BbNudix1.2 protein in the production of borneol, wherein the biological material is any one of the following B1) to B7):

[0015] B1) a nucleic acid molecule encoding the BbNudix1.2 protein;

[0016] B2) an expression cassette containing the nucleic acid molecule of B1);

[0017] B3) a recombinant vector containing the nucleic acid molecule of B1), or containing the expression cassette of B2);

[0018] B4) a recombinant microorganism containing the nucleic acid molecule of B1), or containing the expression cassette of B2), or containing the recombinant vector of B3);

[0019] B5) a transgenic plant cell line containing the nucleic acid molecule of B1), or containing the expression cassette of B2);

[0020] B6) a transgenic plant tissue containing the nucleic acid molecule of B1), or containing the expression cassette of B2);

[0021] B7) a transgenic plant organ containing the nucleic acid molecule of B1), or containing the expression cassette of B2).

[0022] In the above applications, the nucleic acid molecule of B1) can be as follows b11) or b12) or b13) or b14):

[0023] b11) a DNA molecule whose coding sequence is SEQ ID No. 8 or SEQ ID No. 6 in the sequence listing;

[0024] b12) a DNA molecule as shown in SEQ ID No. 8 or SEQ ID No. 6 in the sequence listing;

[0025] b13) a DNA molecule having 65% or more identity with the nucleotide sequence defined in b11) or b12), and encoding the BbNudix1.2 protein;

[0026] b14) a DNA molecule hybridizing under stringent conditions to the nucleotide sequence defined in b11) or b12) or b13), and encoding the BbNudix1.2 protein.

[0027] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA, etc.

[0028] The nucleotide sequence encoding the BbNudix 1.2 protein of the present application can be easily mutated by those of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those nucleotides which are artificially modified to have 65% or more identity with the nucleotide sequence of the BbNudix 1.2 protein isolated from the present application, as long as they encode the BbNudix 1.2 protein and have the function of the BbNudix 1.2 protein, are derived from the nucleotide sequence of the present application and are equivalent to the sequence of the present application.

[0029] The term "identity" as used herein refers to sequence similarity with the natural nucleic acid sequence. The "identity" includes a nucleotide sequence having 65% or more, or 75% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of the protein consisting of the amino acid sequence shown in SEQ ID No. 7 of the present application. The identity can be evaluated by the naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0030] In the above applications, the stringent conditions can be as follows: hybridization at 50°C in a mixture of 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, and 1 mM EDTA, and washing at 50°C in 2xSSC, 0.1% SDS; or as follows: hybridization at 50°C in a mixture of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and washing at 50°C in lxSSC, 0.1% SDS; or as follows: hybridization at 50°C in a mixture of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and washing at 50°C in 0.5xSSC, 0.1% SDS; or as follows: hybridization at 50°C in a mixture of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and washing at 50°C in 0.1xSSC, 0.1% SDS; or as follows: hybridization at 50°C in a mixture of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and washing at 65°C in 0.1xSSC, 0.1% SDS; or as follows: hybridization in a solution of 6xSSC, 0.5% SDS at 65°C, and washing the membrane once each with 2xSSC, 0.1% SDS and lxSSC, 0.1% SDS; or as follows: hybridization in a solution of 2xSSC, 0.1% SDS at 68°C and washing the membrane twice for 5 min each time, and hybridization in a solution of 0.5xSSC, 0.1% SDS at 68°C and washing the membrane twice for 15 min each time; or as follows: hybridization in a solution of 0.1xSSPE (or 0.1xSSC), 0.1% SDS at 65°C and washing the membrane.

[0031] The above-mentioned 65% or more than 65% identity can be 70%, 75%, 80%, 85%, 90% or 95% or more.

[0032] In the above-mentioned application, the expression cassette containing the nucleic acid molecule encoding the BbNudix1.2 protein (BbNudix1.2 gene expression cassette) of B2) refers to a DNA capable of expressing the BbNudix1.2 protein in a host cell, which can include not only a promoter for initiating the transcription of the BbNudix1.2 gene, but also a terminator for terminating the transcription of the BbNudix1.2 gene. Further, the expression cassette can further include an enhancer sequence.

[0033] The recombinant vector containing the BbNudix1.2 gene expression cassette can be constructed using an existing expression vector.

[0034] In the above-mentioned application, the vector can be a plasmid, a cosmid, a bacteriophage or a viral vector. The plasmid can be specifically a PESC-URA plasmid.

[0035] The recombinant vector of B3) can be specifically a PESC-URA-BbNudix1.2. The PESC-URA-BbNudix1.2 is a recombinant vector obtained by inserting the BbNudix1.2 gene shown in SEQ ID No. 8 into the multiple cloning site of the PESC-URA plasmid using the restriction enzyme BamHI.

[0036] In the above-mentioned application, the microorganism can be a yeast, a bacterium, an alga or a fungus. Among them, the yeast can be Saccharomyces cerevisiae, such as Saccharomyces cerevisiae strain ZHY7.

[0037] In the above-mentioned application, the transgenic plant cell line, the transgenic plant tissue and the transgenic plant organ do not include propagation materials.

[0038] The application of the BbNudix1.2 protein or the biological material in the preparation of a borneol product also falls within the protection scope of the present application.

[0039] The present application also provides a method for producing borneol, which comprises:

[0040] 1) expressing the BbNudix1.2 protein in a biological cell containing borneol-based diphosphate synthase or containing a borneol-based diphosphate synthase gene expression cassette, or increasing the content or activity of the BbNudix1.2 protein in the biological cell, to obtain a recombinant biological cell;

[0041] 2) culturing the recombinant biological cell, i.e. realizing the production of borneol.

[0042] The borneol base diphosphate synthase can be AAC26017.1 (11-JUL-1998), or AWW87313.1 (30-JUN-2018), or QTW43990.1 (22-APR-2021), or UIO87236.1 (16-JAN-2022), or the sequences of the above borneol base diphosphate synthases are truncated by signal peptides of different lengths. The borneol base diphosphate synthase includes but is not limited to the borneol base diphosphate synthases shown in the sequences.

[0043] The borneol base diphosphate synthase gene can be AF051900 (11-JUL-1998), or MG763230.1 (30-JUN-2018), or MW196671 (22-APR-2021), or OK137535.1 (16-JAN-2022), or the sequences of the above borneol base diphosphate synthase genes are truncated by signal peptides of different lengths. The borneol base diphosphate synthase gene includes but is not limited to the borneol base diphosphate synthase genes shown in the sequences.

[0044] The expression cassette refers to DNA capable of expressing borneol base diphosphate synthase in the biological cell. The DNA can include not only a promoter for starting the transcription of the borneol base diphosphate synthase gene, but also a terminator for terminating the transcription of the borneol base diphosphate synthase gene. Further, the expression cassette can also include an enhancer sequence.

[0045] In the above method, the recombinant biological cell can be obtained by introducing a recombinant expression vector containing the coding gene of the BbNudix1.2 protein (such as the PESC-URA-BbNudix1.2) into the biological cell.

[0046] In the above method, the biological cell can be any one of the following M1)-M3):

[0047] M1) a microbial cell;

[0048] M2) a yeast cell;

[0049] M3) a Saccharomyces cerevisiae cell.

[0050] In an embodiment of the present application, the Saccharomyces cerevisiae cell is Saccharomyces cerevisiae strain ZHY7.

[0051] The cultivation of the recombinant biological cell in step 2) can be carried out under a culture medium and culture conditions capable of allowing the recombinant biological cell to grow, as long as the recombinant biological cell can grow.

[0052] The BbNudix1.2 protein or the biological material also falls within the protection scope of the present application.

[0053] In the present application, the borneol can be dextro-borneol or levo-borneol.

[0054] Experiments prove that the BbNudix 1.2 protein of the present application can significantly improve the yield of borneol, indicating that the BbNudix 1.2 protein and its encoding gene can promote the synthesis of borneol and can be used for producing borneol.

[0055] The present application is further described in detail below with reference to the specific embodiments, and the examples given are only for illustrating the present application, rather than limiting the scope of the present application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the present application. BRIEF DESCRIPTION OF DRAWINGS

[0056] Figure 1 The yield of dextro-borneol of each engineering strain is detected.

[0057] Figure 2 The effect of different Nudix phosphohydrolases on the synthesis of dextro-borneol. ZHY7ura represents ZHY7 / PESC-URA. The difference significance analysis: *, p<0.05; **, p<0.01; ***, p<0.001. DETAILED DESCRIPTION

[0058] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. In the following examples, the materials, reagents, instruments, etc. used, unless otherwise specified, can be obtained from commercial channels. In the following examples, at least three repeated experiments are set for the quantitative test, and the average value is taken. In the following examples, unless otherwise specified, the 1st nucleotide of each nucleotide sequence in the sequence listing is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last nucleotide is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0059] The donor DNA and sgRNA plasmid information is shown in Table 1.

[0060] Table 1, information related to the constructed donor DNA and sgRNA

[0061]

[0062] Wherein, sgRNA plasmid IX-1: the plasmid backbone was amplified from pYSg4 (Yang et al. Efficient targeted mutation of genomic essential genes in yeast Saccharomyces cerevisiae, Applied Microbiology and Biotechnology, 2020) using primer 6005; the gRNA part containing 20 bp specific sequence was amplified using primer pair P1 / gRNA-1, P2 / gRNA-2 respectively with pYSg4 as template. After gel purification, the three parts were assembled in vitro using ClonExpress Multi S one-step cloning kit (Novozyme), and the obtained sequence correct recombinant vector was sgRNA plasmid IX-1. The sequences of gRNA-1 and gRNA-2 used in the construction of the plasmid are as follows:

[0063] gRNA-1:

[0064] AAACTTCTCCGCAGTGAAAGATAAATGATC GCGGGTTCTCTTAGTAAATG GTTTTAGAGCTAGAAATAG;

[0065] gRNA-2:

[0066] AAACTTCTCCGCAGTGAAAGATAAATGATC CTTACCGACAATGATGTGAG GTTTTAGAGCTAGAAATAG.

[0067] sgRNA plasmid XI-6: the construction method is the same as that of sgRNA plasmid IX-1, and the sequences of gRNA-1 and gRNA-2 used in the construction of the plasmid are as follows:

[0068] gRNA-1:

[0069] AAACTTCTCCGCAGTGAAAGATAAATGATC AAACTTACCGAATTGTAGCG GTTTTAGAGCTAGAAATAG;

[0070] gRNA-2:

[0071] AAACTTCTCCGCAGTGAAAGATAAATGATC TAGTAAATACAACTATTGGA GTTTTAGAGCTAGAAATAG.

[0072] sgRNA plasmid ERG20p: the construction method is the same as that of sgRNA plasmid IX-1, and the sequences of gRNA-1 and gRNA-2 used in the construction of the plasmid are as follows:

[0073] gRNA-1:

[0074] AAACTTCTCCGCAGTGAAAGATAAATGATC CGAAGTCAGCTTCTTCTCGT GTTTTAGAGCTAGAAATAG;

[0075] gRNA-2:

[0076] AAACTTCTCCGCAGTGAAAGATAAATGATC CGAAGTCAGCTTCTTCTCGT GTTTTAGAGCTAGAAATAG.

[0077] sgRNA plasmid X-3: the sequence of gRNA-1 and gRNA-2 used in the construction of the plasmid is as follows:

[0078] gRNA-1:

[0079] AAACTTCTCCGCAGTGAAAGATAAATGATC TGCCTGAAACGATAGCTGTA GTTTTAGAGCTAGAAATAG;

[0080] gRNA-2:

[0081] AAACTTCTCCGCAGTGAAAGATAAATGATC TCCGAGCAAGCAATCATCGG GTTTTAGAGCTAGAAATAG.

[0082] sgRNA plasmid VIII-1: the sequence of gRNA-1 and gRNA-2 used in the construction of the plasmid is as follows:

[0083] gRNA-1:

[0084] AAACTTCTCCGCAGTGAAAGATAAATGATC TAATCGTAATTGTACTACGC GTTTTAGAGCTAGAAATAG;

[0085] gRNA-2:

[0086] AAACTTCTCCGCAGTGAAAGATAAATGATC CGTATTGAATAGTGAACCAT GTTTTAGAGCTAGAAATAG.

[0087] The sequences of primers 6005, P1 and P2 used in the construction of each plasmid are the same, and the specific sequences are as follows:

[0088] 6005: GATCATTTATCTTTCACTGCGGAGAAG;

[0089] P1: GCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATC;

[0090] P2: GATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGC.

[0091] Reagent sources:

[0092] (+)-borneol standard: Shanghai McLean Biotech Co., Ltd.

[0093] Isopropyl myristate: Shanghai McLean Biotech Co., Ltd.

[0094] Main culture medium and configuration:

[0095] (1) YPD solid medium (1L): 10 g yeast extract, 20 g peptone, 20 g glucose and 20 g agar powder, dissolved in deionized water and divided into aliquots, sterilized by high pressure steam at 121°C for 20 minutes.

[0096] (2) SD solid medium (1L): 6.7 g amino acid-free yeast nitrogen source, 20 g glucose and 20 g agar powder, dissolved in deionized water and divided into aliquots, sterilized by high pressure steam at 121°C for 20 minutes.

[0097] (3) SD+HIS screening plate, i.e. SD solid medium containing histidine, 1L formula: 6.7 g amino acid-free yeast nitrogen source, 20 g glucose, 20 g agar powder, 40 mg histidine, dissolved in deionized water and divided into aliquots, sterilized by high pressure steam at 121°C for 20 minutes.

[0098] (4) Plate containing 5-fluoroorotic acid, i.e. SD solid medium containing 5-fluoroorotic acid: weigh 100 mg of 5-fluoroorotic acid (5-FOA), add 1 mL of dimethyl sulfoxide immediately after shaking to dissolve, filter the dissolved solution to sterilize; add the filtered solution to 100 mL of liquid sterile SD solid medium, add 0.1 mL of sterilized 20 g / L histidine aqueous solution (final concentration 20 mg / L) and 0.1 mL of sterilized 20 g / L uracil aqueous solution (final concentration 20 mg / L), mix well and pour the plate.

[0099] (5) Delft + HIS + URA liquid medium, i.e. Delft medium containing histidine and uracil, the formula of 1 L is as follows: 5 g (NH4)2SO4, 14.4 g KH2PO4, 0.5 g MgSO4·7H2O, 40 mg histidine, 60 mg uracil are added into 800 mL deionized water respectively, after adjusting pH to 5.6 with 2M potassium hydroxide solution, constant volume to 950 ml, high pressure steam sterilization at 121°C for 20 minutes. After sterilization, 1 mL of vitamin mother liquor, 2 mL of Trace metal solution and 50 ml of 400 g / L glucose aqueous solution are added into the medium after cooling.

[0100] (6) Delft + HIS liquid medium, i.e. Delft medium containing histidine, the formula of 1 L is as follows: 5 g (NH4)2SO4, 14.4 g KH2PO4, 0.5 g MgSO4·7H2O, 40 mg histidine are added into 800 mL deionized water respectively, after adjusting pH to 5.6 with 2M potassium hydroxide solution, constant volume to 950 ml, high pressure steam sterilization at 121°C for 20 minutes. After sterilization, 1 mL of vitamin mother liquor, 2 mL of Trace metal solution and 50 ml of 400 g / L glucose aqueous solution are added into the medium after cooling.

[0101] (7) Vitamin mother liquor: solvent is water, solute and its concentration are respectively d-Biotin 50 mg / L, D-Pantothenic acid hemicalcium salt 1.0 g / L, Thiamin-HCl 1.0 g / L, Pyridoxin-HCl 1.0 g / L, Nicotinic acid 1.0 g / L, 4-aminobenzoic acid 0.2 g / L, m-Inositol 25 g / L.

[0102] (8) Trace metal solution: solvent is water, solute and its concentration are respectively FeSO4·7H2O 3.0 g / L, ZnSO4·7H2O 4.5 g / L, CaCl2·2H2O 4.5 g / L, MnCl2·4H2O 1 g / L, CoCl2·6H2O 300 mg / L, CuSO4·5H2O 300 mg / L, Na2MoO4·2H2O 400 mg / L, H3BO3 1 g / L, KI 100 mg / L, Na2EDTA·2H2O 19 g / L.

[0103] Example 1, construction of strain ZHY7

[0104] Strain ZHY7 was obtained by integrating gene expression cassettes into the yeast chromosome one by one using the CRISPR-Cas9 system. The donor DNA fragment construction process is referred to Zhou, Y. J. et al. Modular pathway engineering of diterpenoid synthases and the mevalonic acid pathway for miltiradiene production. J Am Chem Soc 134, 3234-3241 (2012). The site of gene integration is referred to Kong, S., Yu, W., Gao, N., Zhai, X. & Zhou, Y. J. Expanding the neutral sites for integrated gene expression in Saccharomyces cerevisiae. FEMS Microbiol Lett 369 (2022).

[0105] 1. Strain construction

[0106] The initial strain is XC01, from Saccharomyces cerevisiae (MATa; MAL2-8c; SUC2; his3D1; ura3-52; gal80D; XI-5::PTEF1-Cas9-TCYC1), which is described in the literature “Cao X, Yu W, Chen Y, Yang S, Zhao ZK, Nielsen J, Luan H, Zhou YJ. Engineering yeast for high-level production of diterpenoid sclareol. Metab Eng. 2023.”.

[0107] 1.1 Construction of strain ZHY1

[0108] Donor DNA (Donor 2) containing HMG2 K6R and ERG20 ww expression cassettes, including 500bp homologous arms upstream and downstream of the XI-6 site of Saccharomyces cerevisiae, the promoter P GAP1 / P GAL10 , the terminator T PRM9 / T PYK1 and the structural gene HMG2 K6R / ERG20 ww , the sequence of which is SEQ ID No. 2 in the sequence listing, which can be obtained by PCR amplification of the genomic DNA of the strain containing the target fragment, or by direct synthesis.

[0109] The donor DNA fragment Donor 2(XI-6::(P) was extracted using the CRISPR-Cas9 method. GAL1 -HMG2 K6R -T PYK1 )+(P GAL10 -ERG20 ww -T PRM9 After transforming HMG2 and sgRNA plasmid XI-6 into the starting Saccharomyces cerevisiae strain XC01 using lithium acetate conversion, the mixture was plated onto SD+HIS selection plates and incubated statically at 30°C for 3–4 days. Strains with correct sequences were screened by colony PCR, and then plated onto plates containing 5-fluoroorotic acid for sgRNA plasmid loss to obtain strain ZHY1. Strain ZHY1 is derived from HMG2... K6R Expression Box (P) GAL1 -HMG2 K6R -T PYK1 ) and ERG20 ww Expression Box (P) GAL10 -ERG20 ww -T PRM9 The engineered strain was obtained by inserting the XI-6 site of the Saccharomyces cerevisiae strain XC01.

[0110] 1.2 Construction of strain ZHY2

[0111] Donor DNA containing the ERG20 expression cassette (Donor 3), including the 500bp upstream homologous arm of the ERG20 promoter, the ERG7 promoter, and the ERG20 structural gene, is sequenced as SEQ ID No. 3 in the sequence listing. This donor DNA can be obtained by PCR amplification of genomic DNA from a strain containing the target fragment, or by direct synthesis.

[0112] The donor DNA fragment Donor 3(P) was extracted using the CRISPR-Cas9 method. ERG7 The ERG20 promoter and sgRNA plasmid ERG20p were transformed into the starting strain ZHY1 using lithium acetate conversion. The resulting culture was then plated onto SD+HIS selection plates and incubated at 30°C for 3–4 days. Strains with the correct sequences were screened by colony PCR. These strains were then plated onto plates containing 5-fluoroorotic acid for sgRNA plasmid loss to obtain strain ZHY2. Strain ZHY2 was obtained by replacing the ERG20 promoter in strain ZHY1 with the ERG7 promoter (P...). ERG7 The engineered bacteria obtained.

[0113] 1.3 Construction of strain ZHY3-tSo

[0114] Donor 1 containing tSoBPPS expression cassette, including 500bp homologous arms upstream and downstream of IX-1 site of S. cerevisiae, promoter P GAP2 , terminator T PYK1 and tSoBPPS gene codon-optimized and signal peptide-truncated, the sequence of which is SEQ ID No. 1 in the sequence listing, which can be obtained by PCR amplification of genomic DNA of the strain containing the target fragment, or by direct synthesis.

[0115] Donor 1 (IX-1::P GAL2 -tSoBPPS-T PYK1 ) and sgRNA plasmid IX-1 were transformed into the starting strain ZHY2 by lithium acetate transformation method, and then coated on SD+HIS selection plates and incubated at 30°C for 3-4 days. The strains with correct sequences were screened by colony PCR, and then coated on plates containing 5-fluoroorotic acid for sgRNA plasmid loss to obtain strain ZHY3-tSo. Strain ZHY3-tSo is an engineered strain obtained by inserting tSoBPPS expression cassette (P GAL2 -tSoBPPS-T PYK1 ) into IX-1 site of strain ZHY2.

[0116] 1.4 Construction of strain ZHY5

[0117] Donor 4 containing ERG12 expression cassette, including 500bp homologous arms upstream and downstream of X-3 site of S. cerevisiae, promoter P GAL2 , terminator T ENO2 and ERG12 gene, the sequence of which is SEQ ID No. 4 in the sequence listing, which can be obtained by PCR amplification of genomic DNA of the strain containing the target fragment, or by direct synthesis.

[0118] Donor 4 (X-3::P GAL2 -ERG12-T ENO2 ) and sgRNA plasmid X-3 were transformed into the starting strain ZHY3-tSo by lithium acetate transformation method, and then coated on SD+HIS selection plates and incubated at 30°C for 3-4 days. The strains with correct sequences were screened by colony PCR, and then coated on plates containing 5-fluoroorotic acid for sgRNA plasmid loss to obtain strain ZHY5. Strain ZHY5 is an engineered strain obtained by inserting ERG12 expression cassette (P GAL2 -ERG12-T ENO2The engineering bacteria obtained by inserting the EfmvaS expression cassette (P

[0119] 1.5 Construction of strain ZHY7

[0120] The donor DNA (Donor 5) containing the EfmvaS and EfmvaE expression cassettes includes 500bp homologous arms upstream and downstream of the VIII-1 site of Saccharomyces cerevisiae, a promoter P GAL1 / P GAL10 , a terminator T IDP1 / T PRM9 , and the genes EfmvaS / EfmvaE, the sequence of which is SEQ ID No. 5 in the sequence listing. The donor DNA can be obtained by PCR amplification of the genomic DNA of a strain containing the target fragment, or can be obtained by direct synthesis.

[0121] The donor DNA fragment Donor 5 (VIII-1::(P GAL10 -EfmvaS-T PRM9 )+(P GAL1 -EfmvaE-T IDP1 )) and the sgRNA plasmid VIII-1 were transformed into the starting strain ZHY5 by lithium acetate transformation, and then coated on an SD+HIS selection plate and incubated at 30°C for 3-4 days. The strain with the correct sequence was selected by colony PCR, and then coated on a plate containing 5-fluoroorotic acid for sgRNA plasmid loss to obtain strain ZHY7. Strain ZHY7 is an engineering bacteria obtained by inserting the EfmvaS expression cassette (P GAL10 -EfmvaS-T PRM9 ) and the EfmvaE expression cassette (P GAL1 -EfmvaE-T IDP1 ) into the VIII-1 site of strain ZHY5.

[0122] 2. Fermentation

[0123] The obtained engineering bacteria ZHY2, ZHY3-tSo, ZHY5, and ZHY7 were fermented. The fermentation conditions were as follows: the strain stored at -80°C in glycerol was streaked on YPD solid medium to activate the strain for 3-4 days; on the first day at 15-17 points, a single colony was picked into a 15ml centrifuge tube containing 3mL Delft+HIS+URA liquid medium, and incubated overnight to the logarithmic growth phase; the next morning, the seed liquid OD 600Then inoculate into fermentation medium, initial OD = 0.1, fermentation medium is 20ml Delft + HIS + URA liquid medium. After inoculation, add 10% (volume percent) isopropyl myristate as extraction solvent; then ferment at 30°C, 220 rpm shaker for 72h.

[0124] 3. Fermentation product processing and detection

[0125] Step 2: Take the upper isopropyl myristate after 72h fermentation, centrifuge, take 10ul supernatant and dilute to 100ul, detect (+)-borneol by GC-MS and calculate its yield; take 50ul lower culture solution, dilute to 2ml (dilute 40 times), measure OD 600 Detect the final growth condition of the cells.

[0126] The GC-MS detection parameters are: TG-5MS column (0.25mm, 0.25um), ISQ LT single quadrupole mass spectrometer, thermoTRACE 1300 series GC. The GC-MS injection port temperature is 250°C, the detector temperature is 300°C, 1mL / min helium flow rate, split mode (split ratio 50:1) injection of 1ul aliquot. The GC-MS temperature program is: initial temperature 80°C for 2min, 30°C / min to 138°C (hold for 5min), 5°C / min to 150°C (hold for 2min), 50°C / min to 300°C (hold for 15min). (+)-borneol (CAS No. 507-70-0) is used as a standard to make a standard curve, and the content of (+)-borneol in the sample is determined.

[0127] 4. Analysis of fermentation results

[0128] The results show that compared with ZHY2, the yield of (+)-borneol of ZHY3-tSo, ZHY5 and ZHY7 is greatly improved, and the yield of ZHY7 is the highest, which is 2.8±0.03mg / L (OD600=1.0). Figure 1 ).

[0129] Example 2: Screening of Nudix phosphohydrolase for biosynthesis of (+)-borneol by using strain ZHY7

[0130] By analyzing the transcriptome data, it was found that there were multiple Nudix hydrolases in Blumea balsamifera (L.) DC. plants. In order to screen and identify the phosphohydrolase that can promote the efficient synthesis of borneol, the coding gene of the codon-optimized candidate phosphohydrolase was inserted into the BamHI site of the PESC-URA plasmid, and then introduced into the strain ZHY7 obtained in Example 1 to detect the effect of the gene on the yield of borneol. Among them, the two genes from Blumea balsamifera are BbNudix1.1 and BbNudix1.2.

[0131] In Blumea balsamifera, the sequence of the BbNudix1.2 gene is shown in SEQ ID No. 6, which encodes the BbNudix1.2 protein shown in SEQ ID No. 7, and the sequence of the codon-optimized BbNudix1.2 gene is shown in SEQ ID No. 8; the sequence of the codon-optimized BbNudix1.1 gene is shown in SEQ ID No. 9.

[0132] 1. Strain construction

[0133] The BbNudix1.2 gene shown in SEQ ID No. 8 was inserted into the multiple cloning site of the PESC-URA plasmid using restriction enzyme BamHI to obtain a recombinant vector PESC-URA-BbNudix1.2, which can express the BbNudix1.2 protein shown in SEQ ID No. 7.

[0134] The BbNudix1.1 gene shown in SEQ ID No. 9 was inserted into the multiple cloning site of the PESC-URA plasmid using restriction enzyme BamHI to obtain a recombinant vector PESC-URA-BbNudix1.1, which can express the BbNudix1.1 protein.

[0135] PESC-URA-BbNudix1.2, PESC-URA-BbNudix1.1, and PESC-URA plasmids were introduced into strain ZHY7, respectively, and cultured on SD+HIS selection plates for 3-4 days to obtain recombinant bacteria ZHY7 / PESC-URA-BbNudix1.2, ZHY7 / PESC-URA-BbNudix1.1, and ZHY7 / PESC-URA.

[0136] 2. Fermentation

[0137] The recombinant strains obtained in step 1 were respectively fermented, and ZHY7 carrying empty vector PESC-URA was used as a control. The fermentation was carried out as follows: on the first day in the morning, single colonies of the recombinant strains grown on the SD+HIS screening plate were inoculated into 15 ml centrifuge tubes containing 3 ml Delft+HIS liquid medium, and incubated overnight to the logarithmic growth phase; on the second day in the morning, the seed liquid was measured for OD 600 Then, the seed liquid was inoculated into fermentation medium, and the initial OD was 0.1. The fermentation medium was 20 ml of Delft+HIS liquid medium. After inoculation, 10% isopropyl myristate was added as an extraction solvent; the fermentation was carried out at 30°C and 220 rpm for 72 h.

[0138] 3. Fermentation product processing and detection

[0139] After the fermentation in step 2 was completed, the upper isopropyl myristate was centrifuged, and 10 μl of the supernatant was diluted to 100 μl. The dilution was detected for (+)-borneol according to the GC-MS detection method in step 3 of Example 1, and the yield was calculated; 50 μl of the lower culture solution was diluted to 2 ml (40 times dilution), and OD 600 The final growth condition of the cells was detected.

[0140] 4. Analysis of fermentation results

[0141] The results show that among the Nudix phosphohydrolases from Ainsliaea sinensis, the BbNudix 1.2 hydrolase can promote the synthesis of (+)-borneol and can significantly increase the yield of (+)-borneol, while the BbNudix 1.1 cannot promote the synthesis of (+)-borneol and can even reduce the yield of the target product Figure 2 ).

[0142] The above results show that BbNudix 1.2 can be used to promote the biosynthesis of borneol.

[0143] The present application has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wide range of equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In general, according to the principle of the present application, this application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application.

Claims

1. Application of BbNudix1.2 protein in the production of borneol; wherein the BbNudix1.2 protein is as follows: A1), A2), or A3): A1) The amino acid sequence of this protein is SEQ ID No. 7; A2) A protein derived from Artemisia annua that has more than 85% identity with the protein described in A1) and is related to borneol synthesis; A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

2. The use of biomaterials related to the BbNudix1.2 protein of claim 1 in the production of borneol, wherein the biomaterial is any one of B1) to B7) below: B1) A nucleic acid molecule encoding the BbNudix1.2 protein as described in claim 1; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) Transgenic plant organs containing the nucleic acid molecules described in B1) or transgenic plant organs containing the expression cassette described in B2).

3. The application according to claim 2, characterized in that: B1) The nucleic acid molecule described is as follows: (b11) or (b12) or (b13) or (b14) b11) The coding sequence is the DNA molecule of SEQ ID No. 8 or SEQ ID No. 6 in the sequence listing; b12) The DNA molecule shown in SEQ ID No. 8 or SEQ ID No. 6 in the sequence listing; b13) has 65% or more identity with the nucleotide sequence defined by b11) or b12) and is a DNA molecule encoding the BbNudix1.2 protein as described in claim 1; b14) hybridizes under stringent conditions with the nucleotide sequence defined by b11) or b12) or b13) and encodes a DNA molecule that encodes the BbNudix1.2 protein as described in claim 1.

4. The use of the BbNudix1.2 protein as described in claim 1 or the biomaterial as described in claim 2 or 3 in the preparation and production of borneol products.

5. The application according to any one of claims 1-4, characterized in that: The borneol is either dextrorotatory or levorotatory.

6. Methods for producing borneol include: 1) To express the BbNudix1.2 protein of claim 1 in biological cells containing borneol diphosphate synthase or containing a borneol diphosphate synthase gene expression cassette, or to increase the content or activity of the BbNudix1.2 protein of claim 1 in the biological cells, thereby obtaining recombinant biological cells; 2) Cultivate the recombinant biological cells to achieve the production of borneol.

7. The method according to claim 6, characterized in that: The recombinant biological cell is obtained by introducing a recombinant expression vector containing the gene encoding the BbNudix1.2 protein as described in claim 1 into the biological cell.

8. The method according to claim 6 or 7, characterized in that: The biological cell is any one of the following M1)-M3): M1) Microbial cells; M2) Yeast cells; M3) Saccharomyces cerevisiae cells.

9. The BbNudix1.2 protein as described in claim 1 or the biomaterial as described in claim 2 or 3.