Recombinant nano antibody for resisting H1N1 subtype A swine influenza virus as well as preparation method and application of recombinant nano antibody

Abstract

The invention discloses a recombinant nano antibody for resisting H1N1 subtype A swine influenza virus as well as a preparation method and application thereof, and belongs to the field of biological medicines. The preparation method comprises the following steps: screening a VHH sequence for resisting an A H1N1 subtype swine influenza virus from a nano antibody bacterial library of an immune alpaca, directionally cloning the VHH sequence into a pPIC9K vector to construct a recombinant eukaryotic expression plasmid, transforming the recombinant eukaryotic expression plasmid into a pichia pastoris expression system to screen and express an engineering strain, and carrying out induced culture on the engineering strain to obtain the recombinant nano antibody. In-vitro and in-vivo experiments prove that the recombinant nano antibody developed by the invention can neutralize CA / 04 and shows a remarkable treatment effect. Therefore, the neutralizing nano antibody provided by the invention has great potential in the aspect of treatment of CA / 04. The discovery provides test data for research and development of anti-H1 subtype swine influenza virus nano antibody preparations, and provides a new strategy for prevention and control of swine influenza.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a recombinant nanobody against swine influenza A (H1N1) subtype virus, its preparation method, and its application. Background Technology

[0002] Swine influenza is an acute, contagious respiratory infectious disease of pigs caused by swine influenza virus. Clinically, it manifests as high fever, difficulty breathing, cough, and loss of appetite. It is characterized by high morbidity and easy co-infection, leading to a decline in pig productivity and affecting the development of the pig industry. Swine influenza virus is a segmented RNA virus of the Orthomyxoviridae family. It has an envelope and its genome consists of eight single-stranded negative-sense RNA segments, which encode the structural proteins HA, NA, NP, M1, M2, PB1, PB2, and PA, and the non-structural proteins NS1 and NS2, respectively (Song DS, Lee CS, Jung K, et al. Isolation and phylogenetic analysis of H1N1 swine influenza virus isolated in Korea[J]. Virus research,2007, 125(1): 98-103.). H1N1, H3N2, and H1N2 subtype influenza viruses are currently the main circulating strains in pig populations worldwide. Among them, the H1N1 subtype influenza virus has the highest hazard / isolation rate. More importantly, the H1N1 subtype of influenza virus can infect humans, posing a long-term threat to the economy and public health. Simultaneously, the H1N1 subtype of influenza virus can also provide gene fragments for the generation of recombinant viruses. Although commercially available vaccines for swine influenza play an important role in prevention and control, low vaccine availability and co-infection with immunosuppressive pathogens (PRRSV, PCV, PRV) pose challenges to vaccine-based control strategies. Therefore, developing a safe and effective biological agent is essential for the prevention and control of swine influenza.

[0003] Nanobodies are variable heavy chain domains (VHHs) derived from heavy chain antibodies of camelids and cartilaginous fishes. With molecular weights ranging from 12 to 15 kDa, they are the smallest known antibody fragments capable of binding to antigens. Nanobodies have shown promising applications in the detection and diagnosis of diseases (tumors, autoimmune diseases, and infectious diseases) due to their high specificity, high affinity, and good stability. Several research teams have reported nanobodies targeting influenza A viruses H1N1, H7N9, H3N2, H5N1, and H9N2, which can effectively inhibit viral replication and block viral transmission. The nanobodies screened by Jaehyun Hwang's team exhibited specific neutralizing activity against CA / 04 virus and significantly reduced viral load in the lungs of mice (Hwang J, JangI Y, Bae E, et al. H1N1 nanobody development and therapeutic efficacy verification in H1N1-challenged mice[J]. Biomedicine & Pharmacotherapy, 2024,176: 116781.). The nanobody screened by Zhao-Shan Chen's team has an IC50 value of approximately 12.5 µg / mL and exhibits broad cross-neutralization capabilities, capable of neutralizing multiple influenza virus subtypes, including H1N1 and H3N2. This gives it a significant advantage in the prevention and treatment of influenza (Chen ZS, Huang HC, Wang X, et al. Influenza A Virus H7 nanobody recognizes a conserved immunodominant epitopeon hemagglutinin head and confers heterosubtypic protection[J]. Nature Communications, 2025, 16(1): 432.). The nanobody screened by Junwei Gai's team had a half-neutralizing dose (ND50) of 0.55 µg / mL, indicating that it could effectively neutralize the virus at a low concentration and showed strong neutralizing activity (Gai J, Ma L, Li G, et al. A potent neutralizing nanobody against SARS‐CoV‐2 with inhaled delivery potential[J]. MedComm, 2021, 2(1): 101-113.).

[0004] The H1N1 subtype of swine influenza virus can remain dormant in pigs for a long time and undergo continuous genetic recombination. Under suitable conditions, it may cause a new wave of "influenza pandemic." Therefore, it is urgent to develop a nanobody-based biological therapy to block or inhibit the replication of the H1N1 subtype of swine influenza virus. Summary of the Invention

[0005] The purpose of this invention is to provide a recombinant nanobody against swine influenza A (H1N1) subtype virus, its preparation method, and its application.

[0006] The technical solution adopted by this invention to solve the technical problem is as follows:

[0007] The present invention provides a recombinant nanobody against swine influenza A (H1N1) subtype virus, the nucleotide sequence of which is SEQ ID NO:1 and the encoded amino acid sequence is SEQ ID NO:2.

[0008] The present invention provides a method for preparing nanobodies against swine influenza A (H1N1) subtype virus, comprising the following steps:

[0009] A VHH sequence against swine influenza A subtype H1N1 was screened from a bacterial library of nanobodies immunized alpacas. The VHH sequence was directionally cloned into the pPIC9K vector to construct a recombinant eukaryotic expression plasmid, which was then transformed into a Pichia pastoris expression system to screen for expression engineered strains. After induction culture, recombinant nanobodies were obtained.

[0010] In a preferred embodiment, during the immunization of alpacas, the VHH fragment was amplified using two rounds of nested PCR. In the first round, a 700 bp band was recovered after amplification using primers CALL001-P1 and CALL002-P1. In the second round, a 450 bp band was recovered after amplification using primers VHH-SacI-P2 and VHH-SpeI-P2. The primer sequences are as follows:

[0011] CALL001-P1:GTCCTGGCTGCTCTTCTACAAGG;

[0012] CALL002-P1:GGTACGTGCTGTTGAACTGTTCC;

[0013] VHH-SacI-P2: GAGCTCATGGATGTGCAGCTGGTGGA;

[0014] VHH-SpeI-P2:ACTAGTTGAGGAGACGGTGACCT.

[0015] In a preferred embodiment, the nucleotide sequence of the expressed engineered strain is SEQ ID NO:3.

[0016] In a preferred embodiment, the positivity rate of the immunized alpaca nanobody bacterial library is 100%, and the library capacity is 10. 8 cfu / mL.

[0017] The present invention provides the application of a nanobody against H1N1 subtype swine influenza virus in the preparation of a biotherapeutic agent for blocking or inhibiting the replication of H1N1 subtype swine influenza virus.

[0018] The present invention provides an engineered strain for expressing a recombinant nanobody against the H1N1 subtype of swine influenza virus.

[0019] Furthermore, the nucleotide sequence of this engineered strain is SEQ ID NO:3.

[0020] The beneficial effects of this invention are:

[0021] This invention established a VHH library targeting the H1N1 subtype of swine influenza virus, derived from PBMCs immunized with alpacas. Using phage display technology based on M13K07, VHHs associated with the H1N1 subtype of swine influenza virus were screened. These sequences were inserted into Pichia pastoris cells to prepare and purify recombinant nanobodies. The cytotoxicity and viral blocking effects of these recombinant nanobodies in MDCK cells and SPF chicken embryos were analyzed. The inhibitory effect of the recombinant nanobodies on H1N1 virus-infected chicken embryos was also evaluated. In vitro and in vivo experiments demonstrated that the recombinant nanobodies developed in this invention can neutralize CA / O4 and exhibit significant therapeutic effects. Therefore, the neutralizing nanobodies provided by this invention have considerable potential in treating the H1N1 subtype of swine influenza virus. These findings will provide a new strategy for swine influenza prevention and control. Attached Figure Description

[0022] Figure 1 A schematic diagram of the construction of a peripheral blood RNA phage library for H1N1-immunized alpacas.

[0023] Figure 2 Insertion rate analysis of peripheral blood RNA phage library for H1N1 immunized alpacas.

[0024] Figure 3 Diversity analysis of peripheral blood RNA phage libraries from H1N1-immunized alpacas.

[0025] Figure 4 The results of the nanobody screening are shown (P / N>2).

[0026] Figure 5The effect of nanobodies on inhibiting viral replication in SPF chicken embryos (survival rate of SPF chicken embryos after nanobody administration).

[0027] Figure 6 The effect of nanobodies on inhibiting viral replication in SPF chicken embryos (nanobody coagulation titer).

[0028] Figure 7 Map of recombinant eukaryotic expression plasmids. Detailed Implementation

[0029] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0030] 1. Strain information;

[0031] The California isolate of influenza A virus (A / California / 04 / 2009(H1N1)) was multiplied in the allantoic cavity of 9-day-old SPF chicken embryos. After 3-5 days, the allantoic fluid from the infected chicken embryos was collected, and after measuring the hemagglutination titer, it was stored at -80°C.

[0032] The California isolate of influenza A virus (A / California / 04 / 2009(H1N1)) was cultured in passaged MDCK cells. After 24–48 h, the virus solution was collected, aliquoted, and stored at -80°C.

[0033] 2. Antigen preparation and emulsification;

[0034] Nine-day-old SPF chicken embryos were selected. After determining the location of the air cells, 100 μL of virus dilution (1:1000) was injected into the allantoic cavity. The cavity was sealed and the growth of the chicken embryos was observed daily. Chicken embryos with completely detached blood vessels were removed, and the allantoic fluid was collected. Then, formaldehyde solution with a final concentration of 0.1% was added to the allantoic fluid, and the virus was inactivated at 37℃ and 220 r / min for 48 h. Then, Freund's adjuvant / Freund's incomplete adjuvant was added to emulsify to a water-in-oil state.

[0035] 3. Construction of an alpaca immune and nanobody library;

[0036] Strategies for constructing alpaca immune and nanobody libraries, such as Figure 1As shown, alpacas were immunized by injecting emulsified antigen. Subcutaneous injection was administered via the skin of the neck, with immunizations every two weeks for a total of five immunizations. The first immunization used Freund's complete adjuvant, while the second to fifth immunizations used Freund's incomplete adjuvant. Each injection consisted of 2 mL of antigen to induce antibody production. Venous blood was collected before each immunization and on day 14 after the final immunization. Serum was separated, stored at -80°C, and serum antibody titers were determined using the checkerboard method.

[0037] Blood was collected from the jugular vein of alpacas. Lymphocytes were isolated using a peripheral blood lymphocyte separation kit, and total RNA was extracted using a total RNA extraction kit. The RNA was reverse transcribed into cDNA, and then the VHH fragment was amplified using two rounds of nested PCR. In the first round, a 700 bp band was recovered after amplification using primers CALL001-P1 (GTCCTGGCTGCTCTTCTACAAGG) and CALL002-P1 (GGTACGTGCTGTTGAACTGTTCC). In the second round, a 450 bp band was recovered after amplification using primers VHH-SacI-P2 (GAGCTCATGGATGTGCAGCTGGTGGA) and VHH-SpeI-P2 (ACTAGTTGAGGAGACGGTGACCT). The target gene and the pComb3XSS vector were digested with restriction endonucleases Sac I and Spe I, and then ligated using Ligation Mix ligase after gel extraction. After desalting, the ligation product was electroporated into TG1 competent cells. The electroporated bacteria were then plated on ampicillin-resistant LB agar plates and incubated overnight at 37°C. The next day, single colonies were picked for PCR, and the correctly identified PCR products were sent to General Biotechnology Co., Ltd. for sequencing.

[0038] PCR reaction system: 25 μL enzyme, 21 μL ddH2O, 1 μL primer, 2 μL template.

[0039] The specific reaction conditions for using a two-round nested PCR are as follows:

[0040] One-round PCR reaction conditions: 94 o C pre-denaturation for 5 min; 94 o C denaturation for 30 seconds, 57 o Annealing at C for 30 seconds, 72°C o C extends the reaction for 45 seconds, performing 35 cycles; 72 o Extend C for 10 minutes.

[0041] Second-round PCR reaction conditions: 94 o C pre-denaturation for 5 min; 94 o C denaturation for 30 seconds, 55 oAnnealing at C for 30 seconds, 72°C o C extends the reaction for 45 seconds, performing 35 cycles; 72 o Extend C for 10 minutes.

[0042] The results showed that after five immunizations, the alpaca serum antibody titer reached 1:64000. Subsequently, fresh blood was collected, RNA was extracted, and a 450 bp target band was amplified (e.g., Figure 2 As shown in the image, a 450 bp fragment was double-digested with the plasmid, ligated using ligase, and transformed into 10 competent cells. The cells were then plated on ampicillin-resistant solid medium. The bacterial library size was calculated to be 10 cells the following day. 8 CFU / mL, 48 single colonies were randomly selected and analyzed by 1% agarose gel electrophoresis. The insertion rate of the ligation products was 100% (48 / 48). 30 colonies were randomly selected for sequencing. The sequencing results showed that the nanobody library was highly diverse and contained no repetitive sequences, such as... Figure 3 As shown, the insertion rate of the VHH segment reaches 100%.

[0043] 4. Screening of nanobodies;

[0044] Take one vial of the nanobody bacterial library culture, melt it, and add it to 200 mL of 2YT-GX medium. Incubate at 37°C with shaking until OD reaches 100%. 600nm After adding helper phage M13K07 to the culture medium (=0.5), the culture was incubated at 37°C for 30 min, followed by shaking incubation for 2 h. Finally, the culture medium was centrifuged, and the precipitate was resuspended in 2×YT medium containing kanamycin and incubated at 37°C with shaking for 24 h. The medium was centrifuged twice, and the supernatant was collected. PEG / NaCl was added to precipitate the phage, and the medium was incubated at 4°C for at least 4 h. Afterward, the medium was centrifuged again, the precipitate was resuspended in PBS, and PEG / NaCl was added. The medium was incubated on ice for 1 h, and then centrifuged to collect the precipitate. Finally, the precipitate was resuspended in PBS, and the titer was determined.

[0045] Antigen was coated onto ELISA plates (4 replicates each for experimental and control groups), incubated at 37°C for 1 h, and then at 4°C overnight; after washing with PBST, the antigen was blocked, and TG1 bacterial culture was simultaneously amplified to OD. 600nm =0.4. Subsequently, the phage library and helper phage were added to the corresponding wells, and after binding at 37°C for 2 h, the cells were washed with different concentrations of PBST and PBS. The elution buffer was neutralized and co-incubated with pre-cultured TG1 bacterial solution. The solution was then serially diluted and plated onto 2-YT-GX plates and incubated overnight at 37°C.

[0046] Selected single colonies were placed in 96-well plates containing 2YT-GX medium and incubated at 37°C for 3 h. The bacterial culture from the 96-well plates was then inoculated into the corresponding deep-well plates and cultured until OD reached. 600nmWhen the concentration of ELISA signal is 0.5, helper phages are added, and the mixture is incubated at 37°C for 30 min followed by shaking for 2 h. The supernatant is then discarded by centrifugation, and the pellet is resuspended in 2YT-KXY medium and incubated at 37°C with shaking for 24 h. The supernatant is then used as the primary antibody, and HRP-anti-M13 as the secondary antibody for ELISA. The ELISA plate is coated with whole virus and incubated at 37°C for 2 h, followed by overnight incubation at 4°C. Blocking is performed at 37°C for 2 h with blocking buffer containing 3% skim milk powder, followed by washing with PBST. 100 μL of primary and secondary antibody solutions are added to each well, along with 75 μL of chromogenic buffer and 25 μL of stop solution. The results are then read using an ELISA reader at 450 nm. For clones in the negative control group with ELISA signal values ​​>2-fold, the corresponding bacterial culture in the 96-well plate is identified, and 100 μL is sent to a sequencing company for sequencing.

[0047] See results Figure 4 The results showed that a total of 8 positive clones were screened, and all 8 were sent for sequencing (two selections were made with a P / N value of 2.0 or higher). Sequence alignment analysis yielded 8 VHH sequences (nucleotide sequences SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:1, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16; corresponding amino acid sequences SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:2, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17), including 6 new sequences and 2 repetitive sequences.

[0048] 5. Expression and purification of nanobodies;

[0049] The VHH sequence and pPIC9K vector were digested with restriction endonucleases EcoR I and Not I, and the fragments were recovered by 1% agarose gel electrophoresis. The target fragment was ligated with T4 ligase and transformed into E. coli DH5α competent cells. The cells were plated and cultured overnight. Single colonies were picked the next day and sequenced to identify the correct recombinant eukaryotic expression plasmid. Figure 7 Store at -20℃ for later use.

[0050] The recombinant eukaryotic expression plasmid was linearized using the restriction endonuclease Sal I, then added to Pichia pastoris X-33 competent cells, gently mixed, and transferred to a pre-chilled electroporation cuvette. After electroporation, 1 mL of pre-chilled 1M sorbitol was immediately added, and the mixture was pipetted twice before being transferred to a 1.5 mL centrifuge tube. The cells were incubated statically at 30°C for 1 h, followed by centrifugation at 4000 rpm for 4 min at room temperature. The cells were collected and resuspended in 100 µL of YPG medium, then spread onto YPG solid medium containing 100 µg / mL bleomycin. The cells were incubated at 37°C for 3 days. Single colonies were picked for PCR identification; positive colonies were considered correct. After successful identification, the engineered expression strain (nucleotide sequence SEQ ID NO:3) for expressing the recombinant nanobody was obtained.

[0051] After successful identification, the engineered strain used for expressing recombinant nanobodies was transferred to 50 mL of BMGY medium and cultured until OD500. 600nm After reaching 2.0, centrifuge to collect the precipitate, and resuspend the precipitate in BMMY medium until OD200 is reached. 600nm =1, and induced culture was carried out at 29℃ and 200 r / min. 1 mL samples were taken at 0 h, 12 h, 24 h, 48 h, 72 h, and 96 h, and then flash-frozen and stored at -80℃. Methanol was added to the samples after each sampling to a final concentration of 0.5%. The samples were then centrifuged, and a small amount of the supernatant was analyzed by SDS-PAGE to determine the location of the expressed product.

[0052] Add NaCl powder to the supernatant after expression to a final concentration of 0.85%, dissolve thoroughly, then add ammonium sulfate powder (60% of total volume), dissolve thoroughly, and incubate overnight at 4°C. Centrifuge at 8000 r / min for 15 min, resuspend the precipitate in 5 mL Lysis Buffer, filter through a 0.22 μm filter, and purify using a nickel column. Analyze the purified product using SDS-PAGE.

[0053] The results showed that after expressing the eight selected nanobody sequences using the Pichia pastoris system, the supernatant was analyzed by SDS-PAGE. Four nanobody sequences (nucleotide sequences SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:1; corresponding amino acid sequences SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:2) were clearly visible and approximately 15 kDa in size. The purified bands showed no significant change in size. These four nanobody sequences were named: QJ140 (nucleotide sequence SEQ ID NO:4, corresponding amino acid sequence SEQ ID NO:5), QJ141 (nucleotide sequence SEQ ID NO:6, corresponding amino acid sequence SEQ ID NO:7), QJ145 (nucleotide sequence SEQ ID NO:8, corresponding amino acid sequence SEQ ID NO:9), and QJ179 (nucleotide sequence SEQ ID NO:1, corresponding amino acid sequence SEQ ID NO:2).

[0054] Nanobodies can be prepared using four conventional expression systems. The Pichia pastoris system was chosen for nanobodies preparation due to its advantages, including low cost for large-scale culture, ability to perform specific post-translational modifications, high cell culture density, and direct secretion of expressed proteins into the culture medium.

[0055] 6. In vitro activity test;

[0056] Nine-day-old chicken embryos were selected, and the air cell location was identified. 100 μL of a mixture of nano-antibody (antibody stock solution 1.2 mg / mL, diluted 1:1000) and virus (H1N1 subtype swine influenza virus) was injected into the allantoic cavity of the chicken embryo. The cavity was sealed with paraffin. The growth of the chicken embryo was observed daily. Chicken embryos with completely detached blood vessels were removed from the incubator, and the allantoic fluid was collected.

[0057] like Figure 5 and Figure 6 As shown in the chicken embryo experiment, the survival rate of the administered nanobody QJ179 was 100% compared with the positive control group; the survival rate of QJ140 / QJ145 was 20%; and the average hemagglutination titers of QJ179 / QJ141 were lower than those of the positive control group. Comprehensive analysis showed that the nanobody QJ179 had the best effect on inhibiting the replication of H1N1 subtype swine influenza virus in chicken embryos.

[0058] This invention uses MDCK cells and chicken embryos as evaluation indicators to comprehensively assess the antiviral effects of nanobodies at both in vitro and in vivo levels. MDCK cell experiments can provide data on the direct inhibitory effect of nanobodies against viruses and their cellular protective effects; chicken embryo experiments can provide data on the antiviral effects of nanobodies in the in vivo environment and drug screening. This multi-dimensional data support makes the research results more comprehensive and reliable, providing a strong basis for further research and development of nanobodies.

[0059] In summary, this invention immunized alpacas with inactivated CA / 04 (2009 influenza virus strain) virus to construct a TG1 bacterial library; three screenings using phage-based ELISA successfully obtained eight different nanobody sequences; one VHH sequence protein was successfully expressed and purified using the Pichia pastoris system; and CA / 04-specific nanobodies were successfully generated. In vitro and in vivo experiments demonstrated that the nanobodies developed in this invention can neutralize CA / 04 and exhibit significant therapeutic effects. Therefore, the neutralizing nanobodies provided by this invention have considerable potential in treating CA / 04. These findings will provide experimental data for the development of nanobody formulations against the H1N1 subtype of swine influenza virus and offer a new strategy for swine influenza prevention and control.

[0060] This invention discloses a recombinant nanobody against swine influenza A (H1N1) subtype virus, its preparation method, and its applications. Those skilled in the art can refer to the content of this invention and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The product of this invention has been described through preferred embodiments, and those skilled in the art can clearly modify or appropriately change and combine the product described in this invention without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

Claims

1. A recombinant nanobody against swine influenza A (H1N1) subtype virus, characterized in that, Its nucleotide sequence is SEQ ID NO:1, and the encoded amino acid sequence is SEQ ID NO:

2.

2. The method for preparing a nanobody against swine influenza A (H1N1 subtype) virus as described in claim 1, characterized in that, Includes the following steps: A VHH sequence against swine influenza A subtype H1N1 was screened from a bacterial library of nanobodies immunized alpacas. The VHH sequence was directionally cloned into the pPIC9K vector to construct a recombinant eukaryotic expression plasmid, which was then transformed into a Pichia pastoris expression system to screen for expression engineered strains. After induction culture, recombinant nanobodies were obtained.

3. The method for preparing a nanobody against swine influenza A (H1N1 subtype) virus according to claim 2, characterized in that, During the immunization of alpacas, the VHH fragment was amplified using two rounds of nested PCR. In the first round, a 700 bp band was recovered after amplification using primers CALL001-P1 and CALL002-P1. In the second round, a 450 bp band was recovered after amplification using primers VHH-SacI-P2 and VHH-SpeI-P2. The primer sequences are as follows: CALL001-P1:GTCCTGGCTGCTCTTCTACAAGG; CALL002-P1:GGTACGTGCTGTTGAACTGTTCC; VHH-SacI-P2: GAGCTCATGGATGTGCAGCTGGTGGA; VHH-SpeI-P2:ACTAGTTGAGGAGACGGTGACCT.

4. The method for preparing a nanobody against swine influenza A (H1N1 subtype) virus according to claim 2, characterized in that, The nucleotide sequence of the expressed engineered strain is SEQ ID NO:

3.

5. The method for preparing a nanobody against swine influenza A (H1N1 subtype) virus according to claim 2, characterized in that, The positive rate of the bacterial nanobody library for immunizing alpacas was 100%, and the library size was 10. 8 cfu / mL.

6. The use of the nanobody against H1N1 subtype swine influenza virus as described in claim 1 in the preparation of a biotherapeutic agent for blocking or inhibiting the replication of H1N1 subtype swine influenza virus.

7. An engineered strain for expressing the recombinant nanobody against the H1N1 subtype swine influenza virus as described in claim 1.

8. The expression engineered strain according to claim 7, characterized in that, The nucleotide sequence of this engineered strain is SEQ ID NO:3.

Images