Reagent and method for simultaneously detecting three genotypes of human parvovirus B19

Abstract

The invention relates to a reagent and a method for simultaneously detecting three genotypes of human parvovirus B19. The reagent comprises (1) a primer group taking an NS1 gene and a VP1 gene as target genes; and (2) a fluorescent probe which is matched with the primer group and is used for Q-PCR (Quantitative Polymerase Chain Reaction) detection. The three genotypes of the human parvovirus B19 are a human parvovirus B19 I type, a human parvovirus B19 II type and a human parvovirus B19 III type.

Description

Technical Field

[0001] This invention belongs to the field of biopharmaceutical technology, specifically relating to a reagent and method for simultaneously detecting three genotypes of human parvovirus. Background Technology

[0002] Human parvovirus B19 is a parvovirus that causes disease in humans. B19 is a single-stranded, non-enveloped DNA virus, approximately 5.5 kb in length, with three genotypes. It can be transmitted through respiratory droplets, the placenta, and blood. It is widespread in the population, with pregnant women and children being particularly susceptible to infection. It can cause miscarriage in pregnant women, hydrops and birth defects in the fetus, even stillbirth, as well as facial rashes, erythema infectivity, anemia, and aplastic crisis in patients with chronic hemolysis.

[0003] The B19 virus is tiny (18–26 nm), a non-lipoembedded virus, insensitive to heat, and exhibits good physicochemical resistance, tolerating most viral inactivation / removal methods. The FDA, the International Society for Plasma Protein Therapy, the European Pharmacopoeia, the European Medicines Agency, and the WHO have clearly stated that the B19 viral nucleic acid load in mixed plasma should not exceed 10-1. 4 IU / mL, B19 is listed as a blood-borne virus and is included in the routine testing of raw plasma. The main detection methods are antigen detection and nucleic acid detection. On May 25, 2022, the Center for Drug Evaluation of the National Medical Products Administration issued the "Technical Guidelines for Pharmaceutical Research and Evaluation of Specific Human Immunoglobulins," requiring that the B19 viral nucleic acid load in the plasma used for the production of anti-D immunoglobulins should not exceed 10 IU / mL. 4 IU / mL. The 2020 and 2025 editions of the Pharmacopoeia of the People's Republic of China do not include relevant detection methods and standard limits for human parvovirus B19. Therefore, my country needs to conduct necessary research and quickly align with international standards to carry out relevant work on human parvovirus B19 detection.

[0004] Based on this, the present invention is proposed. Summary of the Invention

[0005] This invention first relates to a nucleic acid detection reagent for simultaneously detecting three genotypes of human parvovirus B19 in plasma and / or blood products, the reagent comprising:

[0006] (1) Primer set with NS1 and VP1 genes as target genes;

[0007] (2) A fluorescent probe for Q-PCR detection that matches the primer set described above.

[0008] The primer set targeting the NS1 gene is as follows:

[0009] NS1-F, whose nucleotide sequence is shown in SEQ ID NO.1;

[0010] SEQ ID NO.1: GGCCTCTAGTACGCCCATC

[0011] NS1-R, whose nucleotide sequence is shown in SEQ ID NO.2;

[0012] SEQ ID NO.2:GAAACTGGGCTTCCGACAAA

[0013] The fluorescent probe is NS1-TaqManProbe, whose nucleotide sequence is shown in SEQ ID NO.3, with FAM and TAMRA groups at the 5' and 3' ends, respectively.

[0014] SEQ ID NO.3: CCCGGGACCAGTTCAGGAGAATCA

[0015] The primer set targeting the VP1 gene is as follows:

[0016] VP1-F, whose nucleotide sequence is shown in SEQ ID NO.4;

[0017] SEQ ID NO.4: GTGAAGACTTACACAAGCCTGGG

[0018] VP1-R, whose nucleotide sequence is shown in SEQ ID NO.5;

[0019] SEQ ID NO.5: GCCCAGCTTGTAGCTCATTGC

[0020] The fluorescent probe is VP1-TaqManProbe, whose nucleotide sequence is shown in SEQ ID NO.6, with FAM and TAMRA groups at the 5' and 3' ends, respectively.

[0021] SEQ ID NO.6:ACCCGGTACTAACTATGTTGGGCCTG

[0022] The three genotypes of human parvovirus B19 are: human parvovirus B19 type I, human parvovirus B19 type II, and human parvovirus B19 type III.

[0023] Preferred,

[0024] The fluorescent probe is a FAM fluorescent reporter group labeled on the 5' end of the primer.

[0025] The fluorescence quenching group is a TAMRA fluorescence quenching group labeled on the 3' end of the primer;

[0026] Furthermore, the reagent also includes:

[0027] (3) Control primers for detecting the P53 gene and matching fluorescent probes for Q-PCR detection.

[0028] The control primers used to detect the P53 gene are as follows:

[0029] P53-F, whose nucleotide sequence is shown in SEQ ID NO.7;

[0030] SEQ ID NO.7: CATCAGCATGAGGGAAGTGC

[0031] P53-R, whose nucleotide sequence is shown in SEQ ID NO.8;

[0032] SEQ ID NO.8:GAATGTGTCACGCAGGTTCA

[0033] The fluorescent probe is P53-TaqManProbe, whose nucleotide sequence is shown in SEQ ID NO.9, with FAM and TAMRA groups at the 5' and 3' ends, respectively.

[0034] SEQ ID NO.9:ACCCAGGTGCCCGCTTCCTGG.

[0035] Furthermore, in the aforementioned detection reagent:

[0036] The detection sensitivity for the NS1 gene is: viral titer not less than 5.78E+01 IU / mL, detection rate ≥95%;

[0037] The detection sensitivity for the VP1 gene is: viral titer not less than 5.78E+00 IU / mL, detection rate ≥95%; the sensitivity is superior to existing commercially available products.

[0038] The repeatability precision of the aforementioned test reagents (multiple tests using the same sample and batch of reagents) is ≤5%.

[0039] The repeatability accuracy of the test reagent (multiple tests with the same sample and reagent) is ≤0.5 for both the measured concentration and the theoretical concentration log difference.

[0040] The test reagent can detect blood samples stored at -20 to -25°C for no more than 24 hours, and the coefficient of variation of the test results for samples stored at different temperatures is less than 5%.

[0041] The test results of the aforementioned test reagents are not affected by other pathogens such as hepatitis A virus, hepatitis B virus, hepatitis C virus, human immunodeficiency virus, human cytomegalovirus, hepatitis E virus, and Treponema pallidum.

[0042] The coefficient of variation for repeated detection of B19 parvovirus genotypes I, II, and III using the aforementioned detection reagent is less than 5%.

[0043] This invention also relates to a nucleic acid detection kit for simultaneously detecting three genotypes of human parvovirus B19 in plasma and / or blood products, the kit comprising:

[0044] (1) Detect an effective amount of the detection reagent;

[0045] (2) Necessary nucleic acid extraction reagents, PCR amplification reagents, and buffer solutions;

[0046] The detection kit mentioned is a Q-PCR detection kit.

[0047] Furthermore, the aforementioned test kit

[0048] (1) The detection sensitivity of NS1 gene is: viral titer not less than 5.78E+01IU / mL, and the detection sensitivity of VP1 gene is: viral titer not less than 5.78E+00IU / mL. The detection rate is ≥95%. The sensitivity of VP1 gene detection is better than that of commercially available test reagents (only 10IU / ml). At the same time, the dual targets of parvovirus can be detected, which can effectively avoid false negatives.

[0049] (2) The precision of repeated testing (multiple tests using the same sample and the same batch of reagents) is ≤5%;

[0050] (3) Accuracy of repeated testing (multiple tests with the same sample and reagent): The log difference between the measured concentration and the theoretical concentration is ≤0.5;

[0051] (4) It can detect blood samples stored at -20-25℃ for no more than 24 hours, and the coefficient of variation of the test results of samples stored at different temperatures is less than 5%;

[0052] (5) The test results are not affected by other pathogens such as hepatitis A virus, hepatitis B virus, hepatitis C virus, human immunodeficiency virus, human cytomegalovirus, hepatitis E virus, and Treponema pallidum.

[0053] (6) The coefficients of variation for repeated detection of human parvovirus B19 of genotypes I, II and III were all less than 5%, and the log difference between the measured concentration and the theoretical concentration was ≤0.5.

[0054] The present invention also relates to the application of the aforementioned detection reagent in the preparation of a kit for simultaneously detecting three genotypes of human parvovirus B19.

[0055] The beneficial effects of this invention are as follows:

[0056] This invention establishes a method for qualitative and quantitative detection of nucleic acid from three genotypes of human parvovirus B19. The method exhibits good repeatability, high precision, high specificity, high accuracy, strong anti-interference ability, good stability, and high sensitivity. A method for qualitative and quantitative detection of human parvovirus B19 nucleic acid has been established and validated, covering all three genotypes of human parvovirus B19. The dual-target primer-probe set effectively avoids low viral load and viral sequence gene mutations. Risk of missed detection Specifically:

[0057] (1) When using NS1 primer probes for detection, the results of repeatability, precision and accuracy are more ideal than when using VP1 primer probes for detection;

[0058] (2) Sensitivity verification data shows that the effect is better when using VP1 primer probes, and is significantly better than existing commercially available detection reagents.

[0059] This invention establishes a method for qualitative and quantitative detection of nucleic acid of three genotypes of human parvovirus B19, which can be used for the detection of human parvovirus B19 nucleic acid in human plasma and blood products used in production.

[0060] This method was used to detect human parvovirus B19 nucleic acid in raw plasma and different types of blood products, and a system was established that the B19 nucleic acid load in combined plasma (especially combined plasma used for the production of coagulation factor products) should be less than 10. 4 The quality standard of IU / mL is used to more accurately monitor the B19 nucleic acid load in the blood product manufacturing process. Attached Figure Description

[0061] Figure 1 NS1 initial template standard curve.

[0062] Figure 2 VP1 initial template standard curve.

[0063] Figure 3 P53 Initial template standard curve.

[0064] Figure 4 NS1 linearity verification standard curve.

[0065] Figure 5 NS1 linearity verification standard curves (L1-L8).

[0066] Figure 6 VP1 linearity verification standard curve.

[0067] Figure 7 VP1 linearity verification standard curve (L1-L8).

[0068] Figure 8 NS1 gene specificity validation standard curve (PC1-PC4).

[0069] Figure 9 NS1 gene specificity validation standard curve (PC1-PC8).

[0070] Figure 10 VP1 gene specificity validation standard curve (PC1-PC4).

[0071] Figure 11 VP1 gene specificity validation standard curve (PC1-PC8). Detailed Implementation

[0072] Example 1: Design and Construction of the Detection Method

[0073] 1. Primer and probe design

[0074] Based on the main representative viral strain sequences registered in GenBank, three genotypes were identified in relatively conserved regions of the NS1 and VP1 genes. Primers and probes were designed with the 5' end labeled with the FAM fluorescent reporter group and the 3' end labeled with the TAMRA fluorescent quencher group. P53 was selected as the internal standard. The specific sequences are shown in Table 1.

[0075] Table 1 Primers and probes for NS1 and VP1 genes

[0076]

[0077]

[0078] Representative virus strain type I: Au, GenBank No. M13178;

[0079] Representative virus strain type II: LaLi, GenBank No. AY044266;

[0080] Representative virus strain type III: V9, GenBank No. NC-004295.

[0081] The sequence was compared with the genome sequences of hepatitis A virus, hepatitis B virus, hepatitis C virus, human immunodeficiency virus, human cytomegalovirus, hepatitis E virus, and Treponema pallidum (all of which are viral strains that may exist in plasma) to determine that there was no sequence similarity and to avoid subsequent interference.

[0082] 2. Constructing a reorganization vehicle

[0083] The NS1, VP1, and p53 genes of human parvovirus B19 were ligated into the pUC57 cloning vector to construct a recombinant vector.

[0084] The target gene sequence was amplified, and electrophoresis was performed on a 1% agarose gel at 5V / cm for 20 min. The target sequence was then recovered using a gel extraction kit (purchased from Axygen). The pUC57 vector was digested with KpnI and XbaI enzymes and purified using a vector PCR purification kit. The target gene and pUC57 vector were then subjected to a recombination reaction. 5-10 μL of the ligation product was transformed into competent E. coli cells and cultured at 37℃ for 12 h. The transformed cells were plated on Amp+ antibiotic plates, and 10 plaques were picked and simultaneously inoculated into 1.5 mL EP tubes for PCR identification. The bacterial solutions corresponding to the positive bands were sent for sequencing. Gene sequencing confirmed the successful construction of the recombinant vector.

[0085] 3. Construct a standard curve

[0086] The three plasmids pUC57-NS1, pUC57-VP1, and pUC57-p53 were used as standards. Their concentrations were measured using a micro spectrophotometer and then converted into gene copy numbers.

[0087] The formula for calculating copy number concentration is: (6.02 × 10^23 copies / mol) × (standard concentration g / ml) / (MW g / mol) = copies / mL.

[0088] Standard quality particles were serially diluted 10-fold and used as templates. Nucleic acid was extracted using a nucleic acid extraction kit (purchased from Adley Biotechnology Co., Ltd.) and used as a template. Test samples were processed in the same manner. Real-time quantitative PCR was performed using designed primers and probes, with sterile water used as a negative control.

[0089] The real-time quantitative PCR system includes:

[0090] Hieff qPCR TaqMan Probe Master Mix 5μL,

[0091] Upstream primer (10 μM) 0.2 μL,

[0092] Upstream primer (10 μM) 0.2 μL,

[0093] Add 1 μL of template to 10 μL of RNase-free water.

[0094] The reaction conditions were: 95℃ for 30s; then 95℃ for 5s, 60℃ for 30s, for 40 cycles for amplification, while fluorescence signals were collected simultaneously.

[0095] Fluorescence signal detection was performed at the end of each cycle's extension. A scatter plot was created with the logarithm of copy number on the x-axis and Ct value on the y-axis, and a standard curve was plotted. This yielded the lg copy number - Ct value standard curve, which is the RT-PCR standard curve. Standard curves for NS1, VP1, and p53 plasmids are shown below. Figure 1 , Figure 2 and Figure 3 Coefficient of determination R 2 The values ​​are 0.993, 0.9945, and 0.9955 respectively, proving that the standard curve was successfully constructed.

[0096] By substituting the sample detection Ct value into the standard curve, the sample amplification copy number can be obtained.

[0097] Table 2. NS1 plasmid amplification results

[0098] Sample Name lg (copy count) Copy number (copies / ml) Ct: Mean Concentration (ng / uL) 0 14.55702035 3.61E+14 10.938 797 -1 13.55702035 3.61E+13 14.394 79.7 -2 12.55702035 3.61E+12 17.522 7.97 -3 11.55702035 3.61E+11 22.269 0.797 -4 10.55702035 3.61E+10 27.428 0.0797 -5 9.557020349 3.61E+09 31.266 0.00797

[0099] Table 3. VP1 plasmid amplification results

[0100] Sample Name lg (copy count) Copy number (copies / ml) Ct: Mean Concentration (ng / uL) 0 14.47053814 2.95E+14 9.824 760 -1 13.47053814 2.95E+13 13.239 76 -2 12.47053814 2.95E+12 16.940 7.6 -3 11.47053814 2.95E+11 21.208 0.76 -4 10.47053814 2.95E+10 26.564 0.076 -5 9.47053814 2.95E+09 30.734 0.00797

[0101] Table 4. Results of P53 plasmid amplification

[0102] Sample Name lg (copy count) Copy number (copies / ml) Ct: Mean Concentration (ng / uL) 0 14.71079808 5.14E+14 8.670 1090 -1 13.71079808 5.14E+13 12.123 109 -2 12.71079808 5.14E+12 16.560 10.9 -3 11.71079808 5.14E+11 22.568 1.09 -4 10.71079808 5.14E+10 26.952 0.109 -5 9.710798084 5.14E+09 31.774 0.0109

[0103] Example 2: Verification of various aspects of the test product

[0104] 1. Linearity verification

[0105] The national standard for human parvovirus B19 at known concentrations was diluted to prepare standard solutions of different concentration gradients, L1-L8 series, for example, 10. 9 10 8 10 7 10 6 10 5 10 4 10 3 and 10 2 For concentrations of IU / ml, qPCR was performed using NS1 primers and probes, with sterile water as a negative control. The results are shown in Table 5. Each concentration level was tested three times, and the average of the three test results is shown in the table.

[0106] A standard curve was plotted using the lg value of copy number and its corresponding amplification Ct value. R 2 The coefficient of determination should be ≥0.9800. The linear equation of the standard curve is obtained as y = -4.1578x + 70.771, with a coefficient of determination R0. 2 =1, indicating a good linear relationship. Figure 4 and Figure 5 ).

[0107] Table 5. NS1 linearity validation results

[0108]

[0109] qPCR was performed using VP1 primers and probes, with sterile water as a negative control. The results are shown in Table 6. Each concentration level was tested three times, and the table shows the average of the three tests. A standard curve was plotted using the lg value of copy number and its corresponding amplification Ct value. The linear equation of the standard curve was y = -4.3605x + 72.018, and the coefficient of determination R0 was [value missing]. 2 =0.9958, indicating a good linear relationship. Figure 6 and Figure 7 ).

[0110] Table 6 VP1 Linearity Validation Results

[0111]

[0112]

[0113] 2. Specificity verification

[0114] Human virus B19 positive standard material (5.78E+06 IU / ml) was obtained using a commercial kit and serially diluted 10-fold (PC1-PC8). Each concentration was tested three times (the mean values ​​are shown in Tables 7 and 8). Sterile water was used as a negative control. A scatter plot was plotted with the logarithm of the copy number on the x-axis and the logarithm of the viral titer from the original kit on the y-axis.

[0115] Quantitative real-time PCR was performed using NS1 primers and probes. When the dilution gradient was between PC1 and PC4, the logarithm of the gene copy number showed a good linear relationship with the logarithm of the viral titer of the original kit, y = 0.4838x + 0.7812, R0. 2 =0.9899( Figure 8 and Figure 9 ).

[0116] Quantitative real-time PCR was performed using VP1 primers and probes. When the dilution gradient was between PC1 and PC4, the logarithm of the gene copy number showed a good linear relationship with the logarithm of the viral titer of the original kit, y = 0.595x - 1.3882, R0. 2 =0.9902( Figure 10 and Figure 11 ).

[0117] This is consistent with the 4-point quality control range of the standard curve of the commercial reagent kit from Beijing Wantai (batch number: B19Q20230902) (10 6 105 10 4 10 3 (IU / ml). The Ct value of the negative plasma detected simultaneously was 38.822, which is far outside the linear range, indicating that the system has good specificity for B19 virus amplification.

[0118] Table 7 NS1 specificity verification results

[0119]

[0120] Table 8 VP1 Specificity Validation Results

[0121]

[0122] Ct value and SI unit conversion: In the previous study, Example 1, step 3, constructing a standard curve yielded the Ct value - lg copy number standard curve: Y1 = ax + b. Now, the copy number - national standard unit titer conversion standard curve is obtained: Y2 = cx + d. Finally, the conversion of Ct value - national standard unit IU / ml is achieved: IU / ml = 10^(log 10 (10^((Ct-b) / a))*c+d).

[0123] The concentrations of PC7 and PC8 were 10-fold and 100-fold lower than those of PC6, respectively, but the Ct values ​​of PC7 and PC8 did not change significantly compared to PC6. This indicates that the detection limit of the method had been reached, and even if the sample concentration continued to decrease, the Ct value would not change. Testing party The detection limit of this method is 5.78E+01 IU / ml for the concentration of PC6. .

[0124] 3 Precision Verification

[0125] Human parvovirus B19 positive standard material positive sample 1PC3 and positive sample 2PC4 were tested three times for each concentration level. The data shown in Tables 9 and 10 are the average of the three test results.

[0126] PC3 and PC4 were repeatedly detected using NS1 gene primers and probes. The maximum intra-assay coefficient of variation (Ct) for amplification Ct values ​​was 2.597%, and the maximum intra-assay coefficients of variation were 3.221% and 3.586%, respectively, both ≤5%, and the precision met the requirements (Table 9).

[0127] PC3 and PC4 were repeatedly detected using VP1 gene primers and probes. The maximum intra-assay coefficient of variation was 0.725%, and the maximum intra-assay coefficients of variation were 2.704% and 3.917%, respectively, both ≤5%, indicating that the precision met the requirements (Table 10). This demonstrates that the detection method has good repeatability and high precision.

[0128] Table 9 NS1 Precision Validation Data

[0129]

[0130] Table 10 VP1 Precision Validation Data

[0131]

[0132]

[0133] 4. Accuracy Verification

[0134] Human parvovirus B19 positive sample 1PC3 and positive sample 2PC4 were tested three times for each concentration level. The data shown in Tables 9 and 10 are the average of the three test results.

[0135] PC3 and PC4 were repeatedly detected using NS1 gene primers and probes, with at least 5 repeated detections. The maximum log difference between the measured concentration and the theoretical concentration was 0.374448968, all of which were ≤0.5, meeting the requirements (Table 11).

[0136] For PC3 and PC4, the VP1 gene primers and probes were used for repeated detection, with at least 5 repeated detections. The maximum value of the log difference between the measured concentration and the theoretical concentration (retaining one significant decimal place) was ≤0.5, which meets the requirements (Table 12).

[0137] Table 11 NS1 Accuracy Validation Data

[0138]

[0139] Table 12 VP1 Precision Validation Data

[0140]

[0141] 5. Stability Verification

[0142] After extracting the genomes from two different concentrations of positive human parvovirus B19 samples, the samples were placed at different temperatures (-20℃, 4℃, and 25℃) for 24 hours, and then the NS1 and VP1 genes were detected. As shown in the table above, after treatment at the three temperatures, the coefficients of variation among the -20℃, 4℃, and 25℃ groups were all less than 5% (Tables 13 and 14), indicating that the detection system has good stability.

[0143] Table 13 NS1 Stability Verification Data

[0144]

[0145] Table 14 VP1 Stability Verification Data

[0146]

[0147] 6. Anti-interference capability verification

[0148] Non-B19 virus group: The genomes of known nucleic acid-positive plasmas of hepatitis A virus, hepatitis B virus, hepatitis C virus, human immunodeficiency virus, human cytomegalovirus, hepatitis E virus, and Treponema pallidum are extracted and used as the non-B19 virus group.

[0149] Experimental Group 1: Hepatitis A virus, hepatitis B virus, hepatitis C virus, human immunodeficiency virus, human cytomegalovirus, hepatitis E virus, and Treponema pallidum were mixed and added to human parvovirus B19 positive sample PC3, and the genome was extracted to form Experimental Group 1.

[0150] Experimental Group 2: Three interfering substances that interfere with common plasma: Prepare hemoglobin concentration of 431 mg / dL, triglyceride (turbidity 1269), and unconjugated bilirubin concentration of 20 mg / dL. Mix the above three interfering substances and add them to the same amount of human parvovirus B19 positive sample PC3 as Experimental Group 1 to form Experimental Group 2.

[0151] Control group: Negative plasma was added to the same amount of human parvovirus B19 positive sample PC3 as experimental group 1 and experimental group 2 instead of interfering agent, and the test was repeated 3 times as the control group;

[0152] The test results show:

[0153] (1) The Ct value of the non-B19 virus group was 38.030, which was basically consistent with that of negative plasma, and was judged to be negative.

[0154] (2) Using NS1 primers and probes, the log differences between experimental group 1 and experimental group 2 and the control group were 0.004 and 0.113, respectively, both ≤0.5. The coefficient of variation of the above three groups was 2.197%, ≤5%, which met the requirements (Table 15).

[0155] (3) Using VP1 primers and probes, the log differences between experimental group 1 and experimental group 2 and the control group were 0.044 and 0.029, respectively, both ≤0.5. The coefficient of variation of the above three groups was 1.344%, ≤5%, which met the requirements (Table 16).

[0156] This indicates that the method has good specificity, can specifically detect B19 virus, and is not affected by non-B19 virus or common plasma interference factors.

[0157] Table 15 NS1 Anti-interference capability verification

[0158]

[0159] Table 16 VP1 Anti-interference capability verification

[0160]

[0161] 7 Genotyping Validation

[0162] Human parvovirus B19 genotype I, II, and III positive plasma samples (samples 1, 2, and 3) were diluted to a fixed concentration within the method's detection range, such as 1.00E+04 IU / mL, and each sample was tested three times. The detection results for genotype I, II, and III positive plasma samples were all reactive. Using NS1 primers and probes, the coefficients of variation (Ct) of the repeated detections for the three genotypes were 1.926%, 2.232%, and 1.820%, respectively, all ≤5% (Table 17). Using VP1 primers and probes, the coefficients of variation (Ct) of the repeated detections for the three genotypes were 0.816%, 0.504%, and 0.871%, respectively, all ≤5% (Table 18). This indicates that this detection method can quantitatively detect the three genotypes of human parvovirus B19.

[0163] Table 17 NS1 Genotyping Validation

[0164]

[0165] Table 18 VP1 Genotyping Validation

[0166]

[0167] 8. Sensitivity Verification

[0168] The plasmid amplification curve, Ct value, and negative sample water of the lowest copy number are similar, so the plasmid copy number of the sample at this time can be considered as the lowest copy number. Then, by converting it into the viral titer (IU / ml), we can know the lowest titer that this method can detect.

[0169] Human parvovirus B19 positive standard material was serially diluted (PC1-PC8), and each concentration level was tested three times. The data shown in the table is the average of the three test results. At the same time, the amount of template in the PCR reaction system was gradually increased (from the original 1 μL to 1.5 μL, 2 μL, 2.5 μL) to explore the upper limit of the positive control. Water was used as a blank control and B19 negative plasma was used as a negative control.

[0170] Dilute the template in the PCR system until the detected signal is close to that of negative plasma (i.e., samples 10, 11, and 12). When using NS1 primers and probes for detection, the upper limit Ct value for the positive control is 4.90, corresponding to a viral titer of approximately 2.29E+08 IU / mL, and the lower limit Ct value for the negative control is approximately 30.369. The Ct value for PC6 is 29.183, which is close to that of the negative control. Corresponding viral titer 5.78E+ 0.1 IU / mL is the detection sensitivity (Table 19)When the sample detection value is less than the lower limit of the negative control, the sample can be determined as a negative sample. This concentration level sample was tested 20 times, and positive amplification reaction was detected 19 times and not detected once, with a sample detection rate of 95.24% and a sample detection rate ≥95%. The results are shown in Table 20.

[0171] When using VP1 primers and probes for detection, the upper limit Ct value for the positive control was 5.69, corresponding to a viral titer of approximately 2.29E+08 IU / mL, while the lower limit Ct value for the negative control was approximately 38.626. The Ct value for PC7, 37.723, was close to that of the negative control. Corresponding virus The titer of 5.78E+00 IU / mL represents the detection sensitivity (Table 21). When the sample detection value is less than the lower limit of the negative control, the sample can be determined as a negative sample. This concentration level sample was tested 20 times; positive amplification reaction was detected in 19 of them, and not detected in 1. The sample detection rate was 95.24%, ≥95%. The results are shown in Table 22.

[0172] The VP1 gene detection sensitivity of 5.78E+00 IU / mL is superior to the detection limit of 10 IU / mL of commercially available test kits. At the same time, this reagent uses a dual-target primer and probe set for amplification, which can effectively avoid false negatives.

[0173] Table 19 NS1 Sensitivity Verification

[0174] Sample grouping Ct value of target gene Target gene copy number (copies / mL) lg (target gene copy number) Virus titer countdown Viral titer (IU / mL) 1 2.5μL Undetermined #VALUE! #VALUE! #VALUE! #VALUE! 2 2μL 4.906300227 3.35E+15 15.5251547 8.359035246 2.29E+08 3 1.5μL 8.289313316 2.65E+14 14.42283698 7.822867906 6.65E+07 4 1.2μL 12.15496985 1.46E+13 13.16325518 7.21020732 1.62E+07 5 PC1 16.3245786 6.38E+11 11.80463389 6.761927838 5.78E+06 6 PC2 18.99084791 8.63E+10 10.93585927 5.761927838 5.78E+05 7PC3 20.23366928 3.40E+10 10.53089955 4.761927838 5.78E+04 8 PC4 21.73639679 1.10E+10 10.04125227 3.761927838 5.78E+03 9 PC5 23.8767643 2.21E+09 9.343836984 2.761927838 5.78E+02 10 PC6 29.18366877 4.12E+07 7.614640348 1.761927838 5.78E+01 11 PC7 30.63072395 1.39E+07 7.143133283 0.761927838 5.78E+00 12 PC8 28.99268405 4.75E+07 7.676870627 -0.238072162 5.78E-01 Water 1 Undetermined #VALUE! #VALUE! #VALUE! #VALUE! Water 2 Undetermined #VALUE! #VALUE! #VALUE! #VALUE! Negative plasma 1 30.36972046 Negative plasma 2 29.27585793

[0175] Table 20 NS1 Sensitivity Verification

[0176] frequency 1 2 3 4 5 6 7 Test results + + + + + + + frequency 8 9 10 11 12 13 14 Test results + + + + + + + frequency 15 16 17 18 19 20 Test results + + + + + —

[0177] Note: "+" indicates that a positive amplification reaction can be detected, and "-" indicates that a positive amplification reaction cannot be detected.

[0178] Table 21 VP1 Sensitivity Verification

[0179]

[0180]

[0181] Table 22 VP1 Sensitivity Verification

[0182] frequency 1 2 3 4 5 6 7 Test results + + + + + + + frequency 8 9 10 11 12 13 14 Test results + + + + + + + frequency 15 16 17 18 19 20 Test results + + + + + —

[0183] Note: "+" indicates that a positive amplification reaction can be detected, and "-" indicates that a positive amplification reaction is not detected.

[0184] Finally, it should be noted that the above embodiments are only used to help those skilled in the art understand the essence of the present invention, and are not intended to limit the scope of protection of the present invention.

Claims

1. A nucleic acid detection reagent for simultaneously detecting three genotypes of human parvovirus B19 in plasma and / or blood products, the reagent comprising: (1) Primer sets with NS1 gene and primer sets with VP1 gene as target gene; (2) A fluorescent probe for Q-PCR detection that matches the primer set described above. The primer set targeting the NS1 gene is as follows: NS1-F, whose nucleotide sequence is shown in SEQ ID NO.1; NS1-R, whose nucleotide sequence is shown in SEQ ID NO.2; The fluorescent probe is NS1-TaqManProbe, whose nucleotide sequence is shown in SEQ ID NO.3, with FAM and TAMRA groups at the 5' and 3' ends, respectively. The primer set targeting the VP1 gene is as follows: VP1-F, whose nucleotide sequence is shown in SEQ ID NO.4; VP1-R, whose nucleotide sequence is shown in SEQ ID NO.5; The fluorescent probe is VP1-TaqManProbe, whose nucleotide sequence is shown in SEQ ID NO.6, with FAM and TAMRA groups at the 5' and 3' ends, respectively.

2. The detection reagent according to claim 1, characterized in that, The three genotypes of human parvovirus B19 are: human parvovirus B19 type I, human parvovirus B19 type II, and human parvovirus B19 type III.

3. The detection reagent according to claim 1 or 2, characterized in that, The reagents also include: (3) Control primers for detecting the P53 gene and matching fluorescent probes for Q-PCR detection. The control primers used to detect the P53 gene are as follows: P53-F, whose nucleotide sequence is shown in SEQ ID NO.7; P53-R, whose nucleotide sequence is shown in SEQ ID NO.8; The fluorescent probe is P53-TaqManProbe, whose nucleotide sequence is shown in SEQ ID NO.9, with FAM and TAMRA groups at the 5' and 3' ends, respectively.

4. The detection reagent according to any one of claims 1-3, characterized in that, The detection sensitivity of the aforementioned test reagent for the NS1 gene is: viral titer not less than 5.78E+01 IU / mL, detection rate ≥95%; The detection sensitivity of the aforementioned test reagent for the VP1 gene is: viral titer not less than 5.78E+00 IU / mL, detection rate ≥95%.

5. The detection reagent according to any one of claims 1-3, characterized in that, (1) The repeatability precision of the test reagents (multiple tests using the same sample and batch of reagents) is ≤5%; and (2) The repeatability accuracy of the test reagent (multiple tests with the same sample and reagent) is such that the log difference between the measured concentration and the theoretical concentration is ≤0.5; and (3) The test reagent described herein can detect blood samples stored at -20 to -25°C for no more than 24 hours, and the coefficient of variation of the test results is less than 5%; and (4) The detection results of the aforementioned test reagent are not interfered with by other pathogens such as hepatitis A virus, hepatitis B virus, hepatitis C virus, human immunodeficiency virus, human cytomegalovirus, hepatitis E virus, and Treponema pallidum; and (5) The coefficient of variation for repeated detection of B19 parvovirus of genotypes I, II and III by the test reagent is less than 5%.

6. A nucleic acid detection kit for simultaneously detecting three genotypes of human parvovirus B19 in plasma and / or blood products, the kit comprising: (1) The detection reagent according to any one of claims 1-3 for detecting an effective amount; (2) Necessary nucleic acid extraction reagents, PCR amplification reagents and buffer solutions.

7. The detection kit according to claim 6, characterized in that, The detection kit mentioned is a Q-PCR detection kit.

8. The detection kit according to claim 6 or 7, characterized in that, The detection sensitivity of the aforementioned test kit for the NS1 gene is: a viral titer of not less than 5.78E+01 IU / mL, and the detection sensitivity for the VP1 gene is: a viral titer of not less than 5.78E+00 IU / mL.

9. The detection kit according to claim 6 or 7, characterized in that, The test kit (1) The precision of repeated testing (multiple tests using the same sample and batch of reagents) is ≤5%; and (2) Accuracy of repeated testing (multiple tests with the same sample and reagent): The log difference between the measured concentration and the theoretical concentration is ≤0.5; (3) It can detect blood samples stored at -20 to -25℃ for no more than 24 hours, and the coefficient of variation of the test results for samples stored at different temperatures is less than 5%; and (4) The test results are not affected by other pathogens such as hepatitis A virus, hepatitis B virus, hepatitis C virus, human immunodeficiency virus, human cytomegalovirus, hepatitis E virus, and Treponema pallidum; and (5) The coefficients of variation for repeated detection of human parvovirus B19 of genotypes I, II and III were all less than 5%, and the log difference between the measured concentration and the theoretical concentration was ≤0.

5.

10. The use of the detection reagent according to any one of claims 1-3 in the preparation of a kit for simultaneously detecting three genotypes of human parvovirus B19.

Images