Salmonella bacteriophage combination and application thereof

Abstract

The invention discloses a salmonella bacteriophage combination and application thereof, and relates to the technical field of microorganisms. The salmonella bacteriophage combination is prepared from a bacteriophage BPLT2, a bacteriophage BP13076 and a bacteriophage BPSCBS, the bacteriophage BPLT2, the bacteriophage BP13076 and the bacteriophage BPSCBS are preserved in the China Center for Type Culture Collection on June 24, 2025, the preservation address is Wuhan University, Wuhan, China, and the preservation numbers are CCTCC NO: M 20251473, CCTCC NO: M20251472 and CCTCC NO: M 202514721 respectively. The bacteriophage combination can effectively split multiple different serotypes of salmonella and is not easy to induce the generation of bacteriophage resistance in the repeated use process.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a Salmonella bacteriophage ensemble and its application. Background Technology

[0002] Salmonella is an important zoonotic pathogen with a broad host spectrum, capable of infecting humans and various animal hosts, and is one of the most threatening foodborne pathogens. Epidemiological data shows that Salmonella infection is the third leading cause of diarrhea-related mortality. Poultry is an important host for Salmonella infection. Poultry infected with most Salmonella serotypes often exhibit an asymptomatic carrier state, a characteristic that leads to its frequent overlooking during prevention and control. However, these carrier strains in poultry can enter the food chain through contaminated poultry meat and egg products, posing a potential threat to food safety and public health. Therefore, eradicating Salmonella infecting or colonizing the intestines of poultry is of great significance. The overuse of antibiotics has led to increasingly serious multidrug resistance in avian Salmonella, challenging traditional prevention and control methods.

[0003] Bacteriophages offer unique advantages as novel antibacterial agents, but clinically infectious Salmonella infections involve diverse serotypes, and the bactericidal spectrum of a single phage cannot effectively cover multiple serotypes. Furthermore, the action of a single phage on bacteria easily leads to phage resistance, resulting in decreased or even ineffective phage efficacy. Therefore, there is an urgent need to develop phage combinations with broad-spectrum antibacterial capabilities that are less prone to inducing phage resistance. Summary of the Invention

[0004] The purpose of this invention is to provide a Salmonella phage ensemble and its application to solve the problems existing in the prior art. This phage ensemble can effectively lyse various serotypes of Salmonella and is not prone to inducing phage resistance during repeated use. Therefore, it provides a green, safe, and efficient biological control method for controlling Salmonella infection in poultry farming, and also shows good application prospects for controlling Salmonella contamination in poultry production environments.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] This invention provides a Salmonella sp. phage combination, including phage BPLT2, phage BP13076 and phage BPSCBS;

[0007] The bacteriophage BPLT2 was deposited at the China Center for Type Culture Collection (CCTCC) on June 24, 2025, at Wuhan University, Wuhan, China, with accession number CCTCC NO: M 20251473.

[0008] The bacteriophage BP13076 was deposited at the China Center for Type Culture Collection on June 24, 2025, at Wuhan University, Wuhan, China, with accession number CCTCC NO: M 20251472.

[0009] The bacteriophage BPSCBS was deposited on June 24, 2025, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M 20251471.

[0010] Furthermore, the ratio of the number of bacteriophage BPLT2, the number of bacteriophage BP13076 and the number of bacteriophage BPSCBS is 1:1:1.

[0011] The present invention also provides the use of the above-described Salmonella phage combination in the preparation of medicaments for the prevention and / or treatment of Salmonella infection.

[0012] The present invention also provides the application of the above-mentioned Salmonella phage combination in the preparation of Salmonella bactericides.

[0013] The present invention also provides the use of the above-described Salmonella phage combination in the preparation of feed additives for the prevention and / or treatment of Salmonella infection.

[0014] The present invention also provides a medicament for the prevention and / or treatment of Salmonella infection, the active ingredient of which includes the above-described Salmonella phage combination.

[0015] Furthermore, the drug also includes pharmaceutically acceptable excipients.

[0016] Furthermore, the dosage form of the drug is an injection, powder, gel, granule, or lyophilized preparation.

[0017] Furthermore, the drug also includes other active ingredients that have antibacterial effects against Salmonella.

[0018] The present invention also provides a feed additive for the prevention and / or treatment of Salmonella infection, wherein the active ingredients include the above-described Salmonella bacteriophage combination.

[0019] The present invention also provides a Salmonella bactericide, the active ingredient of which includes the above-mentioned Salmonella bacteriophage combination.

[0020] Furthermore, the Salmonella bactericide is available in the form of a spray, powder, gel, granule, or lyophilized agent.

[0021] The present invention discloses the following technical effects:

[0022] This invention provides a Salmonella phage ensemble and its application, which consists of three phages with highly efficient lytic activity: BPLT2, BP13076, and BPSCBS. BPLT2 and BP13076 belong to the family Short-tailed Phages, while BPSCBS belongs to the family Long-tailed Phages; the three phages exhibit good complementarity in their lytic characteristics. This phage ensemble maintains stable activity under a wide range of environmental conditions, tolerates temperatures below 70°C, has a pH tolerance range of 4-10, and exhibits an optimal multiple of infection (MOI) of 0.01, demonstrating strong adaptability and ease of operation.

[0023] The phage ensemble provided by this invention can effectively lyse 39 different serotypes of Salmonella, especially the prevalent serotypes in poultry farming, such as *S. enteritidis*, *S. typhimurium*, *S. Indiana*, and *S. pullorum*, achieving a 100% lysis rate. Furthermore, this ensemble is less prone to inducing phage resistance with repeated use, thus significantly improving its long-term effectiveness and stability in practical applications. Therefore, this phage ensemble provides a green, safe, and efficient biological control method for Salmonella infection control in poultry farming, and also shows promising application prospects for controlling Salmonella contamination in poultry production environments. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 Transmission electron microscope images of bacteriophages BPLT2, BP13076, and BPSCBS;

[0026] Figure 2 Figure 1 shows the results of thermal stability tests on bacteriophages BPLT2, BP13076, and BPSCBS.

[0027] Figure 3 The figure shows the pH stability test results of bacteriophages BPLT2, BP13076 and BPSCBS;

[0028] Figure 4 The image shows the detection results of the one-step growth curves of bacteriophages BPLT2, BP13076, and BPSCBS.

[0029] Figure 5 This is a lysis spectrum of phage assemblies against major clinically prevalent serotypes of Salmonella;

[0030] Figure 6 The graph shows the detection results of the in vitro bactericidal experiment for each experimental group;

[0031] Figure 7 The graph shows the results of the resistance development in each experimental group;

[0032] Figure 8 The image shows the results of an experiment on colonization of Salmonella in the chicken intestine and bacteriophage treatment. Detailed Implementation

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0035] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0036] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0037] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0038] Example 1: Isolation, identification, and preservation of Salmonella bacteriophages

[0039] 1. Phage isolation

[0040] This invention isolated three Salmonella phages from sewage samples collected from Jiangsu Province, and named them BPLT2, BP13076 and BPSCBS, respectively.

[0041] 2. Phage identification

[0042] 2.1 Phage Morphological Characteristics

[0043] Observe bacteriophage particles under a transmission electron microscope, such as Figure 1 As shown, BPLT2 is a myotail phage with a polyhedral head, approximately 72 nm in diameter, and a tail approximately 121 nm in length; BPSCBS is a long-tail phage with a thin, long, and curved tail, approximately 172 nm in length; BP13076 is a myotail phage with an icosahedral head and a straight, thick tail, approximately 119 nm in length.

[0044] 2.2 Molecular biological identification

[0045] Using SEQ ID NO.1 and SEQ ID NO.2 as a primer pair, PCR amplification of bacteriophage BPLT2 was performed, and the resulting PCR product was 307 bp, with the nucleotide sequence shown in SEQ ID NO.7;

[0046] Using SEQ ID NO.3 and SEQ ID NO.4 as a primer pair, phage BP13076 was amplified by PCR. The resulting PCR product was 185 bp, and the nucleotide sequence is shown in SEQ ID NO.8.

[0047] Using SEQ ID NO.5 and SEQ ID NO.6 as a primer pair, PCR amplification of phage BPSCBS was performed, and the resulting PCR product was 473 bp, with the nucleotide sequence shown in SEQ ID NO.9.

[0048] SEQ ID NO.1: 5'-TCGTCTGGTGCTGCATTCAA-3';

[0049] SEQ ID NO.2: 5'-TCGTGCCAGAGGCTTCATTT-3';

[0050] SEQ ID NO.3: 5'-CAAGCGGGTTCACATGTTCC-3';

[0051] SEQ ID NO.4: 5'-CCAGAATGGGGCAAGACCAA-3';

[0052] SEQ ID NO.5: 5'-CGTACTCCGTGCAACTCCAT-3';

[0053] SEQ ID NO.6:5’-GTCCCATAGCTGCGGTTTCT-3’。

[0054] SEQ ID NO.7:5’-TCGTCTGGTGCTGCATTCAACAAGACTGTAAAAATCACTGGTCA AGTCCAACCTTCAGATTGGGATAACATTGACTCTAGATATATTCCGGCAGCAACATTAAGTACGATTGCAAGAACTAATGCACAAAATACTTTTAAATCTGGGCAGACAATTGTAGCAGATGGTCAAGCACTATTGTTAAGAAGTGCAACTGATAGTCCCTCTCTCTATGTTAGAGGCCAAAACCAATCTGGAACTAATAAATGGTATGTTGGATTTAGTACTTCAAATGTTCTTGGATTATCAAATGAAGCCTCTGGCACGA-3’。

[0055] SEQ ID NO.8:5’-CAAGCGGGTTCACATGTTCCTGTGAGGAGATTTGTGATTGTATG CCAAGCATGTATCTGACAATGGACGGTATGACAGGTTATGGTGCTGCTCATTGGACTTAC ACAGATGAGACATGCCCCAAAGGTGTGGATAGCTGGGGAAAAGCATACTGGTGCTCTTT TCTTGGTCTTGCCCCATTCTGG-3’。

[0056] SEQ ID NO.9: 5'-CGTACTCCGTGCAACTCCATGGGAACAGTTTGCTTGCTAACGCTG ATGCTGCACTAAGAAAGGTTCAACAGGCTGCTGCTAAGTATTTAGGGCCGGTAATTGATTCTATTAACGCAGTATTCTATACTTCTCAAGCATCTATCTCGGCTTCTGCTGCTAGAGCACAAGAAGAAACTAACCGTCAGATTGACCCAACTAACGTTGGTGCTGTAGCTTTAAGTCTTTCCGCTTCCGAGGAAGGATATAATAAAAGCTCTTGATA TGTATAAAGAGTCTCTGGATAAGCGTAATAAACTAAAGACTGAGTTTGATAAACGTATGTCCCAAGCAGATGCTAGTACTGCTGCCGCTATTAGATTAGTGGGTGAGGGAATGCCTGTTGGATTAGCTGCTGGGGGATTTGAAGTAGGGGGAGTGCGCATAGGTTCTTCCGAAGCTAACAAAAAGTTTGTAGAAGAAACCGCAGCTATGGGAC-3'.

[0057] 2.3 Phage Preservation

[0058] Salmonella sp. phage BPLT2 was deposited at the China Center for Type Culture Collection (CCTCC) on June 24, 2025, at Wuhan University, Wuhan, China, with accession number CCTCC NO: M20251473.

[0059] Salmonella sp. phage BP13076 was deposited at the China Center for Type Culture Collection (CCTCC) on June 24, 2025, at Wuhan University, Wuhan, China, with accession number CCTCC NO: M 20251472.

[0060] Salmonella sp. phage BPSCBS was deposited on June 24, 2025, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M 20251471.

[0061] Example 2

[0062] The following performance tests were performed on bacteriophages BPLT2, BP13076, and BPSCBS:

[0063] 1. Determination of the thermal stability of bacteriophages

[0064] Take 100 μL of phage fluid from each centrifuge tube and place them into six 1.5 mL sterile EP tubes. Incubate the tubes at 30℃-80℃ (each 10℃ interval) for 1 h, then add 900 μL of SM buffer to each tube. Determine the titer using the bilayer plate method, repeating three times.

[0065] The results of the phage thermal stability test are shown in [the table below]. Figure 2 The results showed that bacteriophage BPLT2 had a 100% survival rate at temperatures below 60°C, but was largely inactivated at temperatures above 60°C, and completely inactivated at 80°C. Bacteriophage BPSCBS began to show slight inactivation with increasing temperature; after 1 hour of treatment at 50°C, the survival rate was greater than 85%, but it decreased to less than 80% at 60°C and less than 1% at 70°C. Bacteriophage BP13076 showed slight inactivation with increasing temperature before reaching 60°C, maintaining a survival rate greater than 95% at 60°C, but was completely inactivated at 70°C.

[0066] In summary, all three bacteriophage strains can tolerate temperatures below 70°C.

[0067] 2. Determination of pH stability of bacteriophages

[0068] Take 100 μL of phage fluid into each of 11 sterile 1.5 mL EP tubes, add 900 μL of SM buffer (pH 2-12) sequentially, and incubate at room temperature for 1 h. Then, serially dilute 10-fold with SM buffer of the same pH, and determine the titer using the bilayer plate method, repeating 3 times.

[0069] The results of the phage pH stability test are as follows: Figure 3 As shown in the figure. The results showed that the titers of the three bacteriophages were relatively stable between pH 4 and 10. When the pH was less than 4, the bacteriophages were rapidly inactivated. When the pH dropped to 3, the survival rate of bacteriophages BPLT2 and BP13076 was less than 1%. When the pH was 2, the three bacteriophages were completely inactivated. When the pH was greater than 10, the titers of the three bacteriophages decreased rapidly, and when the pH was 12, the bacteriophage survival rate was 0.

[0070] In summary, the pH tolerance range of the three bacteriophage strains is 4-10.

[0071] 3. Optimal Multiple of Infection (MOI) Measurement

[0072] Phages were mixed with an equal volume of host bacteria at different MOIs (MOI = 10, 1, 0.1, 0.01, 0.001). The mixtures were incubated at 37°C for 10 min, centrifuged at 10,000 rpm for 10 min to remove unadsorbed phage particles, resuspended the precipitate in 5 mL of LB medium, and then incubated at 37°C on a shaker at 180 rpm for 4 h. The titer was determined using the double-layer plate method, repeated 3 times, to determine the optimal MOI for the phages.

[0073] The results of the optimal multiplicity of infection (MOI) for bacteriophages are shown in Table 1. The results show that at MOIs of 10, 1, 0.1, 0.01, and 0.001, the titer of the bacteriophages first increases and then decreases as the MOI decreases. When MOI = 0.01, the titers of bacteriophages BPLT2, BPSCBS, and BP13076 reach their highest values, at 3.57 × 10⁻⁶. 10 PFU / mL, 6.6×10 10 PFU / mL and 3.67×10 11 PFU / mL indicates that the optimal MOI is 0.01.

[0074] Table 1 Results of optimal MOI determination for bacteriophages

[0075]

[0076] 4. One-step growth curve determination

[0077] The host bacteria were cultured to the logarithmic phase and adjusted to OD using a spectrophotometer. 600 =0.5, after adding phage at the optimal MOI of 0.01, the mixture was incubated at 37°C for 10 min, centrifuged at 10000 rpm for 10 min to remove unadsorbed phage particles, resuspended the precipitate in 5 mL of LB medium, and incubated at 37°C on a shaker at 180 rpm for 2 h. Every 10 min, 100 μL of the supernatant was mixed with 100 μL of host bacteria, and the titer was determined using the double-layer plate method, repeated 3 times. The lysis rate (PFU / cell) = final phage titer / initial bacterial titer.

[0078] The results of the one-step growth curve detection are shown below. Figure 4 The results showed that phage BPLT2 entered the latent phase within 0-10 min, with no significant change in titer. After 10 min, the phage titer increased significantly, indicating the start of the lysis phase, with a maximum titer of 5.01 × 10⁻⁶. 10The lysis rate reached a stationary phase after 100 min, with a lysis yield of approximately 62.63 PFU / cell. For phages BPSCBS and BP13076, there was no latent period, and no obvious stationary phase was observed even after 120 min; the lysis period was relatively long, with a titer reaching 6.6 × 10⁻⁶. 10 PFU / mL and 3.67×10 11 The PFU / mL lysis rates were 82.5 PFU / cell and 458.75 PFU / cell, respectively.

[0079] Example 3: In vitro bactericidal effect of bacteriophage combination

[0080] 1. Lysis of major clinically prevalent Salmonella serotypes by a phage ensemble (BPLT2, BP13076, and BPSCBS in a 1:1:1 ratio).

[0081] The lysis of 165 mainstream Salmonella serotypes (Salmonella enteritidis, Salmonella typhimurium, Salmonella Indiana, and Salmonella pullorum) isolated clinically by single bacteriophages and bacteriophage combinations was determined. The results are as follows: Figure 5 As shown in the figure, the results indicated that BPLT2 could lyse 156 Salmonella strains with a lysis rate of 94.55%, while the lysis rates of BPSCBS and BP13076 were 84.85% (140 / 165) and 89.09% (147 / 165), respectively. When the two phages BPLT2 and BPSCBS were combined, the lysis rate reached 95.76% (158 / 165). When the three phages were combined, the lysis rate reached 100% (165 / 165).

[0082] 2. Lysis of various Salmonella serotypes by phage assemblies

[0083] The lysis of 39 different serotypes by single bacteriophages and bacteriophage combinations (BPLT2, BP13076, and BPSCBS in a 1:1:1 ratio) was determined, and the results are shown in Table 2. The bacteriophage combinations could induce lysis in all 39 typical serotypes, with a lysis rate of 100%. However, a single bacteriophage could not completely lyse all 39 different serotypes.

[0084] Table 2. Lysis results of phage combinations on 39 different serotypes of Salmonella.

[0085]

[0086]

[0087] Note: "+" indicates that it can be split, and "-" indicates that it cannot be split.

[0088] 3. Bactericidal efficacy of bacteriophage assemblies

[0089] The inhibitory effects of three bacteriophage strains on Salmonella were tested within 8 hours, both individually and in combination (BPLT2, BP13076, and BPSCBS in a 1:1:1 ratio). Salmonella Typhimurium LT2 was selected as the host bacterium. The host bacterium was cultured to the logarithmic growth phase and divided into four tubes, corresponding to BPLT2, BPSCBS, BP13076, and the bacteriophage combination, respectively. The OD of each tube was adjusted using a spectrophotometer. 600 =0.2. Valence 10 5 1 mL of PFU / mL phage was added to each EP tube. All EP tubes were placed in a 37°C shaker at 180 rpm and incubated for 8 hours. Starting from 0 h, 100 μL of culture medium was taken every 1 hour, diluted to the appropriate concentration with LB medium, and spread onto LB agar plates using a spreader. The plates were incubated upside down at 37°C for 8 hours. The Salmonella content was calculated based on the colony count. The results are shown in the table below. Figure 6 .

[0090] Bacteriophage BPLT2 showed significant bactericidal effect within 6 hours, reducing the Salmonella content from the initial 1.99 × 10⁻⁶. 7 CFU / mL decreased to 1.51×10 3 CFU / mL, bacterial count began to increase at 7 hours, and the Salmonella count was approximately 3.16 × 10⁻⁶ at the end of 8 hours. 4 CFU / mL. Phages BPSCBS and BP13076 showed moderate bactericidal effects, with bacterial counts exceeding the initial bacterial counts at 8 hours. The Salmonella count in the phage combination group continued to decline, decreasing by approximately 6 log10 orders of magnitude at 8 hours.

[0091] 4. Development of phage resistance

[0092] Add 100 μL of Salmonella Typhimurium and 100 μL of bacteriophage to 900 μL of LB medium. Subculture for 24 consecutive days, one generation per day. After determining the bacterial concentration of each generation mixture, dilute to 10⁻¹⁰ with SM buffer. 5 PFU / mL, take 100 μL of the dilution and spread it evenly on an LB agar plate using a sterile spreader. Invert the plate and incubate at 37°C for 8 hours. Randomly select colonies (100 colonies per generation) to determine if they are resistant strains and calculate the resistance rate.

[0093] Results of the test for the proportion of resistant bacteria are as follows Figure 7As shown, when a single bacteriophage was co-cultured with Salmonella Typhimurium, resistant bacteria were screened on the first day. The percentage of resistant bacteria screened increased with each passing day, reaching over 80% by day 4. A mixture of two bacteriophages, BPLT2+BPSCBS, and Salmonella only showed resistant bacteria on the fifth day, after which the screening rate for resistant bacteria increased significantly. A three-phage combination, BPLT2+BPSCBS+BP13076 (BPLT2, BP13076, and BPSCBS in a 1:1:1 ratio), was passaged with Salmonella for 21 consecutive days, but no resistant bacteria were developed.

[0094] Example 4: Colonization of Salmonella in Chicken Intestinal Entrance and Bacteriophage Treatment Experiment

[0095] The experimental chickens were divided into a healthy group, a Salmonella infection group, and a phage treatment group (BPLT2 treatment group, BPSCBS treatment group, BP13076 treatment group, and phage combination treatment group, wherein the ratio of BPLT2, BP13076, and BPSCBS in the phage combination treatment group was 1:1:1). On the second day, all chickens except the healthy group were given Salmonella LT2 via gavage, with each chicken receiving 500 μL of 10 μL of Salmonella LT2. 9 CFU / mL, once daily, 500 μL each time, for 7 consecutive days. On day 11, start feeding phage, 500 μL per animal. 10 PFU / mL, once a day, for 3 consecutive days. Weigh the chickens every 7 days to calculate their weight gain and count Salmonella.

[0096] Salmonella count results are as follows Figure 8 As shown in the figure. The results showed that the Salmonella content in the chick feces at the end of the eighth day of force-feeding was 1.5 × 10⁻⁶. 9 CFU / g. When phage feeding began on day 11, the Salmonella content started to decrease, with a decrease of approximately 2 log₁₀ in the single-strain phage treatment group and approximately 3 log₁₀ in the phage combination treatment group. At the end of phage feeding on day 14, the Salmonella content in the single-strain phage treatment group dropped to 10 CFU / g. 4 The levels were around CFU / g, with the phage combination treatment group having only about 200 CFU / g. As time progressed, the Salmonella content in the feces began to slowly decrease, and by day 21, Salmonella was undetectable in the phage combination treatment group. On day 35, the Salmonella content in the phage BPLT2 and phage BP13076 treatment groups was also 0, while the phage BPSCBS treatment group had 5 CFU / g, and the infected colonization group still contained 10 CFU / g. 4 Salmonella at around CFU / g.

[0097] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A Salmonella sp. phage assemblage, characterized in that, Including bacteriophage BPLT2, bacteriophage BP13076 and bacteriophage BPSCBS; The bacteriophage BPLT2 was deposited at the China Center for Type Culture Collection (CCTCC) on June 24, 2025, at Wuhan University, Wuhan, China, with accession number CCTCC NO: M 20251473. The bacteriophage BP13076 was deposited at the China Center for Type Culture Collection on June 24, 2025, at Wuhan University, Wuhan, China, with accession number CCTCC NO: M 20251472. The bacteriophage BPSCBS was deposited on June 24, 2025, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M 20251471.

2. The Salmonella phage assemblage according to claim 1, characterized in that, The ratio of the number of bacteriophages BPLT2, BP13076, and BPSCBS is 1:1:

1.

3. The use of a Salmonella phage assembly as described in claim 1 or 2 in the preparation of a medicament for the prevention and / or treatment of Salmonella infection.

4. The use of a Salmonella phage ensemble as described in claim 1 or 2 in the preparation of a Salmonella bactericide.

5. The use of a Salmonella phage combination as described in claim 1 or 2 in the preparation of a feed additive for the prevention and / or treatment of Salmonella infection.

6. A drug for the prevention and / or treatment of Salmonella infection, characterized in that, The active ingredient comprises the Salmonella phage assemblage as described in claim 1 or 2.

7. The drug according to claim 5, characterized in that, The drug also includes pharmaceutically acceptable excipients.

8. The drug according to claim 6, characterized in that, The dosage form of the drug is injection, powder, gel, granule or lyophilized.

9. A feed additive for the prevention and / or treatment of Salmonella infection, characterized in that, The active ingredient comprises the Salmonella phage assemblage as described in claim 1 or 2.

10. A Salmonella bactericide, characterized in that, The active ingredient comprises the Salmonella phage assemblage as described in claim 1 or 2.

Images