Primer probe group and method for monitoring distribution of spotted seal based on environmental DNA (Deoxyribose Nucleic Acid)

Abstract

The invention discloses a primer probe group and a method for monitoring distribution of spotted seal based on environmental DNA (Deoxyribonucleic Acid), and belongs to the technical field of molecular biology and environmental monitoring. The invention relates to a primer probe group for distribution monitoring of spotted seal based on environmental DNA (deoxyribonucleic acid). The primer probe group comprises a primer P-lar-ND2-F with a sequence as shown in SEQ ID No. 1, a primer P-lar-ND2-R with a sequence as shown in SEQ ID No. 2, and a probe P-lar-ND2-P with a sequence as shown in SEQ ID No. 3. The primer probe group comprises a primer P-lar-ND2-F, a primer P-lar-ND2-R, a primer P-lar-ND2-R, a primer P-lar-ND2-R and a probe P-lar-ND2-P, the method is applied to the aspect of distribution monitoring of the spotted seal, and has the characteristics of high specificity and high sensitivity.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology and environmental monitoring, and particularly relates to a primer probe set and method for distribution monitoring of Phoca largha based on environmental DNA. BACKGROUND

[0002] In the traditional monitoring method of marine mammals, the distribution and quantity of Phoca largha are confirmed by means of ship cruising visual observation, acoustic monitoring or marking and recapturing. These methods not only consume a large amount of manpower, ships and equipment, but also have strong interference to the activities and ecological environment of Phoca largha, and it is especially difficult to cover the monitoring area at night or in low visibility. Moreover, due to the small appearance difference between individual Phoca largha, false judgment or omission often occurs only by morphological identification and acoustic data.

[0003] Environmental DNA (eDNA) refers to genetic material fragments such as skin flakes, secretions, feces and body cells shed by organisms in the natural environment. Researchers can quickly determine the existence and relative abundance of target species or community by extracting, purifying and fluorescent quantitative PCR or second-generation sequencing analysis of residual DNA in environmental samples such as water, soil, sediment and air.

[0004] The application of eDNA detection in water environment provides a new idea for non-interference monitoring of Phoca largha, which has the following characteristics: non-invasive sampling: only a small amount of seawater needs to be collected, without the need to face-to-face contact or capture animals; high sensitivity: even if Phoca largha only briefly appears at the sampling point or the quantity is small, the population information can also be detected through the cell fragments shed by it; specific detection can be realized: by designing species-specific primers for the mitochondrial ND2 gene segment, Phoca largha can be distinguished from other seal populations in the same area.

[0005] However, the existing marine eDNA method still has the following problems in specific identification of a single species: insufficient primer specificity: general fish or marine mammal universal primers are often used, which is difficult to exclude non-specific amplification of closely related species; sensitivity and quantitative accuracy: complex environmental matrix (salinity, humus, etc.) can inhibit PCR, affecting the detection and accurate quantification of low-abundance target DNA; time and space attribution is unclear: the migration of DNA fragments caused by ocean currents and water mass exchange brings uncertainty to the distribution positioning.

[0006] In addition, the existing environmental DNA universal primers are difficult to distinguish Phoca largha from closely related seal species, which may cause false positives or false negatives. At the same time, the existing filter membrane filtration and extraction method has a low recovery efficiency for trace DNA, which is difficult to meet the detection needs of transient presence or sparse individuals. SUMMARY

[0007] In view of the deficiencies of the prior art, the present application solves at least one of the above technical problems existing in the prior art environmental DNA when used for leopard seal population distribution and quantity monitoring, and proposes a primer probe set and method for leopard seal distribution monitoring based on environmental DNA with high specificity and high sensitivity.

[0008] To solve the technical problem, the technical solution adopted by the present application is: The present application provides a primer probe set for leopard seal distribution monitoring based on environmental DNA, comprising a primer P-lar-ND2-F with a sequence as shown in SEQ ID No. 1, a primer P-lar-ND2-R with a sequence as shown in SEQ ID No. 2, and a probe P-lar-ND2-P with a sequence as shown in SEQ ID No. 3.

[0009] Preferably, the 5' end of the probe P-lar-ND2-P is modified with FAM, and the 3' end is modified with MGB.

[0010] The present application provides a kit comprising the primer probe set described in the above technical solution.

[0011] The present application provides the use of the primer probe set described in the above technical solution for leopard seal distribution monitoring based on environmental DNA.

[0012] The present application also provides the use of the primer probe set described in the above technical solution in the preparation of a kit for leopard seal distribution monitoring based on environmental DNA.

[0013] The present application also provides a method for leopard seal distribution monitoring based on environmental DNA, comprising: A standard curve construction step, using a series of gradient dilutions of plasmids with known copy numbers as templates, performing fluorescent quantitative PCR amplification using the primer probe set of claim 1 or 2, recording the Ct values of each gradient standard, and performing linear regression with the logarithmic copy number as the abscissa and the Ct value as the ordinate to obtain the regression equation of the standard curve: Ct=m×log 10 C+b Wherein, Ct is the cycle threshold value obtained by fluorescent quantitative PCR detection, which refers to the cycle number when the fluorescence signal exceeds the set threshold in the PCR reaction; C is the copy number of the target gene in the reaction system; m is the slope of the standard curve, which represents the rate of change of Ct value with the logarithmic change of target gene copy number, and determines the PCR amplification efficiency; b is the intercept of the standard curve, which represents the Ct value corresponding to the logarithmic copy number of the target gene being zero; The environmental DNA sample is quantitatively calculated, the environmental DNA to be detected is used as a template, a primer probe set according to claim 1 or 2 is used for fluorescence quantitative PCR detection, and the Ct value of each sample is recorded; the average Ct value of the environmental DNA sample is substituted into the established standard curve regression equation to calculate the copy number of the ND2 gene of the spotted seal in the sample: log 10 C = (Ct sample b) / m The actual spotted seal environmental DNA concentration of the environmental sample is converted according to the total volume of each environmental DNA extraction, the filter membrane sampling volume and the template volume.

[0014] Preferably, the actual spotted seal environmental DNA concentration of the environmental sample is (sample copy number x elution total volume) / (volume of template for fluorescence quantitative PCR x filter membrane sampling volume).

[0015] Preferably, the method further comprises a detection limit determination step: using a no-template control for more than 6 technical repeats, calculating the standard deviation σ of the obtained Ct value, and calculating the minimum detection limit based on 3 times the standard deviation: LOD 拷贝数 / 反应 = 3 x σ / |m|.

[0016] Preferably, the environmental DNA sample is obtained by the following method: The instruments used for environmental DNA sample extraction are sterilized separately, the filter membrane fragments are placed in a tube, Buffer GA is added, and DNA is completely released by oscillation at 50 Hz; impurities are removed and washed using an adsorption column; 30 μL of sterile enzyme-free water is added to the adsorption membrane for elution to obtain the environmental DNA sample.

[0017] Preferably, the environmental DNA sample is obtained by the following method: The filter membrane sample and the blank control are taken out of the 80℃ refrigerator and placed in a sterile culture dish; Sterile operation, each sample uses a set of instruments to cut the filter membrane separately to avoid cross contamination; The filter membrane fragments are placed in a 2 mL tube, and 600 μL of Buffer GA is added for complete lysis at 50 Hz oscillation for 2 min; 60 μL of Proteinase K is added, vortexed, lysed at 56℃ for 2 h, and inverted and mixed every 30 min; 15 μL of RNase A is added, and RNA impurities are removed by incubation at room temperature for 10 min; 600 μL of Buffer GB is added, vortexed, and incubated at 56℃ for 10 min; Centrifuge at 12000 rpm for 30 s, transfer the supernatant to a new tube, add 600 μL of anhydrous ethanol and mix well; The supernatant was added to the adsorption column in portions, centrifuged at 12,000 rpm for 1 min, and the waste liquid was discarded. The adsorption column was washed sequentially with 500 μL Buffer WB1 and 600 μL Buffer WB2, and centrifuged at 12000 rpm for 1 min each time. Wash again with 600 μL Buffer WB2; After centrifugation at 12000 rpm for 2 min, allow to stand at room temperature for 5 min to evaporate the residual liquid; Add 30 μL of sterile, enzyme-free water to the adsorption membrane, let it stand at room temperature for 5 min, and centrifuge at 12000 rpm for 2 min. The elution buffer was used to elute once more, and the mixture was centrifuged at 12,000 rpm for 2 min to obtain a high-concentration DNA solution.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a primer and probe set for monitoring the distribution of spotted seals based on environmental DNA, overcoming the limitations of existing universal primers in effectively distinguishing spotted seals. Phoca largha This approach addresses the issue of close relative seal species, avoiding nonspecific amplification and significantly reducing the incidence of false positives or false negatives. It ensures the accuracy and reliability of the results and improves species specificity. This invention provides a method for monitoring the distribution of spotted seals based on environmental DNA. By optimizing the environmental DNA extraction process, especially in the membrane filtration and DNA recovery stages, the recovery rate of ultra-trace DNA is significantly improved. This optimized scheme can effectively capture the environmental DNA of short-lived or sparse individuals, ensuring the detection sensitivity of low-abundance species and broadening the application scope. Combined with efficient primer design and optimized extraction methods, this invention can achieve highly sensitive and low-interference detection of spotted seal environmental DNA in complex marine environments, greatly improving monitoring efficiency and accuracy, and meeting the needs for precise monitoring of endangered species and low-density populations. Attached Figure Description

[0019] Figure 1 The image shows the mitochondrial map of the spotted seal (including annotation information) and the relative positions of the primers and probes in the ND2 region (including COI control primer information) provided in the embodiments of the present invention. Figure 2 The agarose gel electrophoresis results of the spotted seal PCR product provided in this embodiment of the invention are shown. The marker and product loading amounts are both 10 μL. Figure 3The TA cloning result of the self-designed P.lar-ND2-F+R primer provided by the embodiment of the present application has an amplified fragment length of 148 bp; Figure 4 The real-time fluorescence quantitative PCR amplification curve diagram of the environmental DNA detection of the Phoca largha ND2 gene provided by the embodiment of the present application; Figure 5 The fluorescence quantitative PCR standard curve of the Phoca largha ND2 gene provided by the embodiment of the present application; Figure 6 The fluorescence quantitative PCR detection result statistical chart of the Phoca largha ND2 gene in the environmental sample provided by the embodiment of the present application. DETAILED DESCRIPTION

[0020] The technical solutions in the specific embodiments of the present application will be described in detail below. Obviously, the described embodiments are only part of the specific embodiments of the general technical solution of the present application, rather than all the embodiments. Based on the general concept of the present application, all other embodiments obtained by those skilled in the art fall within the scope of protection of the present application.

[0021] The present application provides a primer probe set for monitoring the distribution of Phoca largha based on environmental DNA, comprising a primer P-lar-ND2-F with a sequence shown in SEQ ID No. 1, a primer P-lar-ND2-R with a sequence shown in SEQ ID No. 2, and a probe P-lar-ND2-P with a sequence shown in SEQ ID No. 3. The sequences are shown in Table 1.

[0022] Table 1 Primer and probe sequences

[0023] The above primer probe set for monitoring the distribution and quantity of Phoca largha population based on environmental DNA overcomes the problem that the existing universal primer cannot effectively distinguish Phoca largha from closely related seal species, Phoca largha and avoids the phenomenon of non-specific amplification, thereby significantly reducing the incidence of false positives or false negatives, ensuring the accuracy and reliability of the results, and improving the species specificity.

[0024] The above primer probe set can perform high-specificity and high-sensitivity detection on the mitochondrial NADH dehydrogenase subunit 2 (ND2) gene segment of Phoca largha, and realize accurate monitoring of the distribution and quantity of Phoca largha population in a complex marine environment.

[0025] In a preferred embodiment, the 5' end of the probe P-lar-ND2-P is modified with FAM, and the 3' end is modified with MGB. This technical solution limits the 5' end of P-lar-ND2-P to be modified with FAM fluorescent group, and the 3' end to be modified with MGB (Minor Groove Binder), thereby significantly improving the detection sensitivity and specificity of the probe. FAM as the 5' end fluorescent group can provide strong and stable fluorescence signal, facilitating real-time fluorescence quantitative detection; and the introduction of MGB can enhance the binding capacity of the probe to the target sequence, so that the probe still has a high melting temperature under a shorter length, which helps to improve the hybridization specificity and the recognition ability to single base mutation. Therefore, this structural design ensures the high sensitivity and high specificity of the fluorescence quantitative PCR detection, and improves the reliability and accuracy of the detection.

[0026] The present application provides a kit comprising the primer probe set of the above technical solution.

[0027] In another aspect, the present application provides the use of the primer probe set of the above technical solution for the distribution monitoring of leopard seals based on environmental DNA.

[0028] The present application also provides the use of the primer probe set of the above technical solution in the preparation of a kit for the distribution monitoring of leopard seals based on environmental DNA.

[0029] The present application also provides a method for the distribution monitoring of leopard seals based on environmental DNA, comprising: A standard curve construction step, using a series of gradient dilutions of plasmids with known copy numbers as templates, performing fluorescence quantitative PCR amplification using the primer probe set of claim 1 or 2, recording the Ct values of each gradient standard, and performing linear regression with the logarithmic copy number as the abscissa and the Ct value as the ordinate to obtain the regression equation of the standard curve: Ct = m x log 10 C + b Wherein, Ct is the cycle threshold value obtained by fluorescence quantitative PCR detection, which refers to the cycle number corresponding to the fluorescence signal exceeding the set threshold value in the PCR reaction; C is the copy number of the target gene in the reaction system; m is the slope of the standard curve, which represents the rate of change of Ct value with the logarithmic change of target gene copy number, and determines the PCR amplification efficiency; b is the intercept of the standard curve, which represents the Ct value corresponding to the logarithmic value of zero of the target gene copy number; An environmental DNA sample quantitative calculation step, using the environmental DNA to be tested as the template, performing fluorescence quantitative PCR detection using the primer probe set of claim 1 or 2, and recording the Ct value of each sample, and substituting the average Ct value of the environmental DNA sample into the established standard curve regression equation to calculate the copy number of the leopard seal ND2 gene in the sample: log 10C = (Ct sample b) / m The actual environmental DNA concentration of the environmental sample is converted according to the total volume of each environmental DNA extraction, the filter membrane sampling volume and the template volume.

[0030] In the technical solution, the standard curve clearly presents the linear relationship between the Ct value and the log copy number; the environmental sample Ct value is clearly indicated, and the DNA concentration of each sample is calculated; and the NTCs are all without amplification, which confirms that there is no pollution.

[0031] In a preferred embodiment, the actual environmental DNA concentration of the environmental sample is (sample copy number x elution total volume) / (volume of template for fluorescent quantitative PCR x filter membrane sampling volume). The unit of the actual environmental DNA concentration of the environmental sample is copies / L, the units of the elution total volume and the volume of template for fluorescent quantitative PCR are μL, and the unit of the filter membrane sampling volume is L.

[0032] In a preferred embodiment, the method further comprises a detection limit determination step: using a no-template control for more than 6 technical repeats, calculating the standard deviation σ of the Ct value, and calculating the minimum detection limit based on 3 times the standard deviation: LOD 拷贝数 / 反应 = 3 x σ / |m|.

[0033] In a preferred embodiment, the environmental DNA sample is obtained by the following method: sterilizing the instruments used for environmental DNA sample extraction separately, placing the filter membrane fragments in a tube, adding Buffer GA, oscillating at 50 Hz to completely lyse and release DNA, removing impurities and washing with an adsorption column, adding 30 μL of sterile and enzyme-free water to the adsorption membrane for elution, and obtaining the environmental DNA sample. The environmental DNA sample is obtained by the following method: Take the filter membrane sample and the blank control out of the 80°C refrigerator and place them in a sterile culture dish; Sterile operation, cut the filter membrane into pieces separately for each sample using a set of instruments to avoid cross contamination; Place the filter membrane fragments in a 2 mL tube, add 600 μL of Buffer GA, and oscillate at 50 Hz for 2 min to completely lyse; Add 60 μL of Proteinase K, vortex to mix, and lyse at 56°C for 2 h, and mix every 30 min; Add 15 μL of RNase A, incubate at room temperature for 10 min to remove RNA impurities; Vortex to mix, and lyse at 56°C for 10 min; Centrifuge at 12000 rpm for 30 s, transfer the supernatant to a new tube, and mix with 600 μL of anhydrous ethanol; The supernatant is added to the adsorption column in batches, centrifuged at 12000 rpm for 1 min, and the waste liquid is discarded; The adsorption column is sequentially washed with 500 μL Buffer WB1 and 600 μL Buffer WB2, and centrifuged at 12000 rpm for 1 min each time; The adsorption column is sequentially washed with 500 μL Buffer WB1 and 600 μL Buffer WB2, and centrifuged at 12000 rpm for 1 min each time; After centrifugation at 12000 rpm for 2 min, the residual liquid is volatilized at room temperature for 5 min; 30 μL of sterile enzyme-free water is added to the adsorption membrane, and the mixture is left to stand at room temperature for 5 min, and then centrifuged at 12000 rpm for 2 min; The eluate is repeatedly eluted once, centrifuged at 12000 rpm for 2 min, and a high-concentration DNA solution is obtained.

[0034] The above technical solution defines the method for obtaining environmental DNA samples, which controls the sterile background (sterilizes the equipment separately to avoid cross contamination and ensure that the eDNA signal is real and reliable), mechanically-chemically synergistically lyses (50 Hz high-frequency oscillation combined with Buffer GA to efficiently release DNA), efficiently elutes in a small volume (30 μL of enzyme-free water is used instead of TE liquid elution to avoid the inhibition of EDTA on downstream PCR and improve the DNA recovery concentration), optimizes the environmental DNA extraction process, especially in the filter membrane filtration and DNA recovery link, significantly improves the recovery rate of ultratrace DNA, and the optimized scheme can effectively capture environmental DNA of transient or sparse individuals, ensures the detection sensitivity of low-abundance species, and widens the application range; combined with efficient primer design and optimized extraction method, the present application can realize high-sensitivity and low-interference detection of environmental DNA of spotted seals in a complex marine environment, greatly improves the monitoring efficiency and precision, and meets the precise monitoring needs of endangered species and low-density populations.

[0035] In order to more clearly and specifically introduce the primer probe set and method for monitoring the distribution of spotted seals based on environmental DNA provided by the embodiments of the present application, the following will be described in combination with specific embodiments.

[0036] Embodiment 1 Environmental DNA extraction Sample information: environmental DNA filter membrane sample Kit information: Trelief Hi-Pure Animal Genomic DNA kit (cat# TSP202) Extraction preparation: 1. Confirm that Buffer GA and Buffer GB have no precipitate, and if there is, dissolve them in a 37℃ water bath.

[0037] 2、Buffer WB1 and WB2 were added with 12 mL and 60 mL of anhydrous ethanol respectively, and mixed well for standby use.

[0038] 3、RNase A (100 mg / mL) and Proteinase K (20 mg / mL) were stored at -20 °C and taken out for use.

[0039] 4、The water bath was preheated to 56 °C.

[0040] 5、The instruments (small scissors and curved forceps for filter membrane processing) were sterilized by autoclaving (121 °C, 30 min) one day in advance and then dried for standby use.

[0041] 6、The ultraclean workbench was sterilized by ultraviolet for 30 min in advance.

[0042] Extraction steps: 1、The filter membrane samples and blank controls were taken out from the -80 °C refrigerator and placed in sterile culture dishes.

[0043] 2、Sterile operation, each sample was cut into pieces with a set of instruments to avoid cross contamination.

[0044] 3、The filter membrane pieces were placed in a 2 mL tube, 600 μL of Buffer GA was added, and oscillation was performed at 50 Hz for 2 min to completely lyse.

[0045] 4、60 μL of Proteinase K was added, vortexed to mix well, and lysed at 56 °C for 2 h (every 30 min, invert to mix well).

[0046] 5、15 μL of RNase A was added, and incubated at room temperature for 10 min to remove RNA impurities.

[0047] 6、600 μL of Buffer GB was added, vortexed to mix well, and incubated at 56 °C for 10 min.

[0048] 7、Centrifugation was performed at 12000 rpm for 30 s, the supernatant was transferred to a new tube, and 600 μL of anhydrous ethanol was added and mixed well.

[0049] 8、The supernatant was added to the adsorption column in several portions, centrifuged at 12000 rpm for 1 min, and the waste liquid was discarded.

[0050] 9、The adsorption column was washed with Buffer WB1 (500 μL) and Buffer WB2 (600 μL) in turn, each time centrifuged at 12000 rpm for 1 min.

[0051] 10、Buffer WB2 (600 μL) was used again for one more time.

[0052] 11、After centrifugation at 12000 rpm for 2 min, the residual liquid was evaporated at room temperature for 5 min.

[0053] 12. Add 30 μL of sterile, enzyme-free water to the adsorption membrane, let it stand at room temperature for 5 min, and then centrifuge at 12000 rpm for 2 min.

[0054] 13. Repeat the elution with the elution buffer once, centrifuge at 12000 rpm for 2 min to obtain a high-concentration DNA solution.

[0055] The above extraction process achieves the following: Aseptic background control: Individually sterilized instruments avoid cross-contamination and ensure the authenticity and reliability of eDNA signals; Mechanochemical synergistic lysis: 50Hz high-frequency oscillation combined with Buffer GA for efficient DNA release; Low-volume, high-efficiency elution: 30 μL of enzyme-free water is used instead of TE buffer for elution, avoiding the inhibition of downstream PCR by EDTA and increasing the DNA recovery concentration.

[0056] Concentration determination (Qubit fluorometer), details are shown in Table 2.

[0057] Table 2 Concentration Measurement Results

[0058] Example 2 Design of seal-specific primers and probes 1. Download Spotted Seal ( Phoca largha ) and mitochondrial sequences of closely related species, and multiple sequence alignment to screen for specific regions.

[0059] 2. Design primers and probes using Primer Express 3.0.1 software: Primer length: 18–25 nt, Tm 56–60℃ Probe length: 15–25 nt, Tm 8–10℃ higher than primers Fluorescent labeling: 5′ end FAM, 3′ end MGB 3. The design results were validated for specificity using NCBI Primer-BLAST, and no cross-amplification of closely related species was observed.

[0060] Final primer and probe sequences: P-lar-ND2-F: TCTGAGTGCCCGAAGTGACA (20bp) P-lar-ND2-R: ACGGATGCGATTGCTATGGT (20bp) P-lar-ND2-P:FAM-TCTCGCTATCCTCAGGCA-MGB (18bp) The relative positions of primers and probes in the mitochondria of spotted seals are shown in the figure.Figure 1 .

[0061] Example 3 Seal blood genomic DNA extraction Using Trelief kit, blood sample 400 μL, adding Proteinase K, RNase A, Buffer GB, after ethanol precipitation, adsorption column purification, eluted with 30 μL sterile water to obtain genomic DNA solution. The concentration was determined by Qubit fluorometer: seal-1 genomic DNA 2.2 ng / μL; seal-2 genomic DNA 2.9 ng / μL.

[0062] Example 4 PCR verification and agarose gel electrophoresis detection Sample information: seal-1 genomic DNA 2.2 ng / μL; seal-2 genomic DNA 2.9 ng / μL Primer information: P.lar-ND2-F 10 μM Tm=58.8℃; P.lar-ND2-R 10 μM Tm=56.9℃ Kit information: 2× TransStart® FastPfu PCR SuperMix (+dye) (cat# AS221) 1. Reaction system preparation (25 μL x 2) as shown in Table 3.

[0063] Table 3 Reaction system

[0064] 2. Reaction steps (denaturation, annealing, extension for 35 cycles): Pre-denaturation: 98℃ 1min, denaturation: 98℃ 10s, annealing: 54℃ 5s, extension: 72℃ 10s, post-extension: 72℃ 1min, 4℃ +∞ 3. Agarose gel electrophoresis detection (2% TAE gel, 100V for about 1h), P.lar-ND2 primer amplification fragment about 150bp can be clearly seen, to ensure the specificity of subsequent detection. Details see Figure 2 , wherein seal primer 1 is the control primer P.lar-COI-F+R of this experiment, and the amplification fragment is about 100bp; seal primer 2 is P.lar-ND2-F+R, and the amplification fragment is about 150bp.

[0065] Example 5 TA cloning and sanger sequencing The PCR product obtained in Example 4 was used for TA cloning, and then the cloned positive colonies were sent to GenScript Biotech Corporation for Sanger sequencing. By sequencing the positive clones obtained by cloning, the specificity and accuracy of the primers and probes were confirmed. The plasmid returned by TA cloning was used for subsequent probe verification experiments as a standard for sensitivity and specificity testing. The PCR product was sequenced after TA cloning, and the sequence was completely consistent with the design expectation, with no mutation site, proving that the primer probe system was accurate and reliable for sequencing. The sequencing results have been summarized and shown in Figure 3 wherein, Seal sample 1 and 2 were all sequenced, and there were no base mutations, and it was recommended to use 1-2-2 Seal sample 1-P.lar-ND2-F+R-TA clone number 2.

[0066] Example 6 Probe synthesis According to the designed high-specificity probe sequence, the probe was synthesized by Sheng Wu Company. The label of the probe used 5' end FAM fluorescent group and 3' end MGB quenching group. The final concentration of the probe was 10 µM, and it was stored at -20°C in the dark for subsequent use.

[0067] Example 7 Probe verification Standard information: P.lar-ND2-pUCm-T recombinant plasmid (initial concentration of 20 ng / μL, full length of 2848 bp, copy number of 6.41×109 copies / μL, 3 technical repeats for each concentration) Standard gradient dilution: The standard solution was diluted by 10 times in sequence, i.e. 6.41×10 8 copies / μL, 6.41×10 7 copies / μL, 6.41×10 6 copies / μL, 6.41×10 5 copies / μL, 6.41×10 4 copies / μL, 6.41×10 3 copies / μL, 6.41×10 2 copies / μL (3 technical repeats for each gradient, standard curve was constructed for quantitative analysis) Primer probe information: P.lar-ND2-F 10 μM, P.lar-ND2-R 10 μM, P.lar-ND2-P 10 μM (avoid light).

[0068] Information on samples to be tested: Filter membrane samples: 2-1, 10-1, 18-1, 19-1, 45-1; Filter membrane controls: K1-2 (2025.04.16), K2-2 (2025.04.17); No template control (NTC).

[0069] Real-time PCR reaction system and conditions: Reagent kit information: PerfectStart® II Probe Real-Time PCR SuperMix (cat# AQ711) 1. The reaction system was prepared (20 μL / well) as shown in Table 4.

[0070] Table 4 Reaction System

[0071] 2. Reaction steps: Pre-denaturation: 94℃ for 30s; Denaturation: 94℃ for 5s; Annealing + Extension: 60℃ for 30s. Fluorescence signal is collected during the annealing and extension steps. The denaturation, annealing and extension cycles are repeated 45 times.

[0072] Example 8 Quantitative testing 1. Take the logarithm (log) of the Ct values ​​of each gradient of the standard and their corresponding copy numbers. 10 Linear regression was performed on the copy number to obtain the regression equation: Ct = m × log 10 C+b Ct: Cycle threshold obtained by real-time PCR detection, which refers to the number of cycles corresponding to when the fluorescence signal in the PCR reaction exceeds the set threshold; C: Target gene copy number in the reaction system; m: Slope of the standard curve, which represents the rate at which the Ct value changes with the logarithm of the target gene copy number, and determines the PCR amplification efficiency; b: Intercept of the standard curve, which represents the Ct value corresponding to when the logarithm of the target gene copy number is zero.

[0073] 2. Quantitative calculation of eDNA samples Substituting the average Ct value of the environmental DNA sample into the standard curve equation, the copy number of the spotted seal ND2 gene in the sample is deduced: log 10 (C sample copy number) = (Ct sample) b) / m Then, based on the total volume of DNA extracted from each environment, the filter membrane sampling volume, and the template volume, the actual concentration of spotted seal eDNA in the environmental sample (copies / L) is calculated: eDNA concentration (copies / L) = (sample copy number × total elution volume (μL)) / (volume of template used for quantitative PCR (μL) × filter sampling volume (L)) 3, limit of detection (LOD) determination method The standard deviation (sigma) of the Ct value is calculated using more than 6 technical repeats with no template control (NTC). Based on 3 times the standard deviation, the minimum detection limit is calculated: LOD 拷贝数 / 反应 = 3 x sigma / |m| As shown in Figures 4-6 , the standard curve clearly shows a linear relationship between the Ct value and the log copy number; the environmental sample Ct value is clearly indicated, and the DNA concentration of each sample is calculated; the NTC has no amplification, confirming that there is no pollution, Figures 4-6 The fluorescence quantitative PCR results of the spotted seal ND2 gene are shown, the standard curve shows efficient PCR amplification (slope -3.1106, amplification efficiency 110%), the Cq value of the sample is negatively correlated with its DNA concentration, and the experimental results show that the method has good quantitative ability. Among them, Figure 4 The fluorescence signal change of samples with different template concentrations in the fluorescence quantitative PCR reaction is shown, and the different starting inflection points (Ct values) of each amplification curve reflect the differences in the copy number of the target gene in each reaction system. Figure 5 The standard curve is linearly regressed with the log copy number of the standard as the horizontal coordinate and the Ct value as the vertical coordinate, the regression equation is Y = -3.1106X + 12.76, the correlation coefficient (R 2 ) is 0.99, and the amplification efficiency is 110%, indicating that the established fluorescence quantitative PCR method has good linear relationship and detection sensitivity. Figure 6 The Ct value distribution of different environmental samples and controls is shown, and the high and low Ct values of each sample reflect the abundance difference of the target gene in different environmental DNA samples.

[0074] The present application designs a high-specificity segment of the mitochondrial ND2 gene of the spotted seal, ensures accurate recognition of the spotted seal by the primers, and avoids cross-reaction of other seal populations; the present application adopts a plurality of optimization measures for the extraction process of environmental DNA (eDNA), improves the recovery efficiency of trace DNA, especially effectively removes inhibitors and improves the recovery rate in a complex marine environment, and provides a strong guarantee for the detection of low-abundance eDNA; the present application combines fluorescence quantitative PCR technology, can accurately quantify the concentration of spotted seal eDNA, and establishes a reliable standard curve, and ensures the accuracy and consistency of the data by real-time monitoring of the Cq value (threshold cycle number).

Claims

1. A primer and probe set for monitoring the distribution of spotted seals based on environmental DNA, characterized in that, This includes primer P-lar-ND2-F with the sequence shown in SEQ ID No. 1, primer P-lar-ND2-R with the sequence shown in SEQ ID No. 2, and probe P-lar-ND2-P with the sequence shown in SEQ ID No.

3.

2. The primer-probe set according to claim 1, characterized in that, The 5' end of the probe P-lar-ND2-P is modified with FAM, and the 3' end is modified with MGB.

3. A reagent kit, characterized in that, It includes the primer and probe set as described in claim 1 or 2.

4. The use of the primer-probe set according to claim 1 or 2 for monitoring the distribution of spotted seals based on environmental DNA.

5. Use of the primer-probe set according to claim 1 or 2 in the preparation of a kit for monitoring the distribution of spotted seals based on environmental DNA.

6. A method for monitoring the distribution of spotted seals based on environmental DNA, characterized in that, include: The standard curve construction steps involve using a series of serially diluted plasmids with known copy numbers as templates, performing real-time PCR amplification using the primer and probe set described in claim 1 or 2, recording the Ct values ​​of each gradient standard, and then performing linear regression with logarithmic copy number as the abscissa and Ct value as the ordinate to obtain the regression equation for the standard curve: Ct=m×log 10 C+b Where Ct is the cycle threshold obtained by real-time PCR detection, which refers to the number of cycles when the fluorescence signal in the PCR reaction exceeds the set threshold; C is the copy number of the target gene in the reaction system; m is the slope of the standard curve, which represents the rate at which the Ct value changes with the logarithm of the target gene copy number and determines the PCR amplification efficiency; b is the intercept of the standard curve, which represents the Ct value when the logarithm of the target gene copy number is zero. The steps for quantifying environmental DNA samples are as follows: using the environmental DNA to be tested as a template, fluorescent quantitative PCR is performed using the primer and probe set described in claim 1 or 2, and the Ct value of each sample is recorded. The average Ct value of the environmental DNA samples is substituted into the established standard curve regression equation to calculate the copy number of the spotted seal ND2 gene in the sample. log 10 C = (Ct sample) b) / m The actual concentration of environmental DNA in the spotted seals was then calculated based on the total volume of environmental DNA extracted, the volume of the filter membrane sampling, and the volume of the template for each sample.

7. The method for monitoring the distribution of spotted seals based on environmental DNA according to claim 6, characterized in that, The actual concentration of spotted seal environmental DNA in environmental samples = (sample copy number × total elution volume) / (volume of template used for quantitative PCR × filter membrane sampling volume).

8. The method for monitoring the distribution of spotted seals based on environmental DNA according to claim 6, characterized in that, It also includes the step of determining the detection limit: performing at least 6 technical replicates using a template-free control, calculating the standard deviation σ of the Ct value, and calculating the lowest detection limit based on 3 times the standard deviation. LOD 拷贝数 / 反应 =3×σ / ∣m∣。 9. The method for monitoring the distribution of spotted seals based on environmental DNA according to claim 6, characterized in that, Environmental DNA samples were obtained using the following methods: The instruments used for environmental DNA sample extraction were sterilized separately. Filter membrane fragments were placed in tubes, Buffer GA was added, and DNA was completely lysed by oscillation at 50 Hz. Impurities were removed and the membrane was washed with an adsorption column. 30 μL of sterile enzyme-free water was added to the adsorption membrane for elution to obtain the environmental DNA sample.

10. The method for monitoring the distribution of spotted seals based on environmental DNA according to claim 9, characterized in that, Environmental DNA samples were obtained using the following methods: Remove the filter membrane sample and blank control from the 80℃ refrigerator and place them in a sterile petri dish; Aseptic technique was used, and each sample was individually cut using a set of instruments to avoid cross-contamination; The filter membrane fragments were placed in a 2 mL tube, 600 μL of Buffer GA was added, and the mixture was shaken at 50 Hz for 2 min to completely lyse the membrane. Add 60 μL Proteinase K, vortex to mix, and lyse in a 56℃ water bath for 2 h, inverting to mix every 30 min. Add 15 μL of RNase A and incubate at room temperature for 10 min to remove RNA impurities; Add 600 μL Buffer GB, vortex to mix, and incubate in a 56°C water bath for 10 min; Centrifuge at 12000 rpm for 30 s, transfer the supernatant to a new tube, add 600 μL of anhydrous ethanol and mix well; The supernatant was added to the adsorption column in portions, centrifuged at 12,000 rpm for 1 min, and the waste liquid was discarded. The adsorption column was washed sequentially with 500 μL Buffer WB1 and 600 μL Buffer WB2, and centrifuged at 12000 rpm for 1 min each time. Wash again with 600 μL Buffer WB2; After centrifugation at 12000 rpm for 2 min, allow to stand at room temperature for 5 min to evaporate the residual liquid; Add 30 μL of sterile, enzyme-free water to the adsorption membrane, let it stand at room temperature for 5 min, and centrifuge at 12000 rpm for 2 min. The elution buffer was used to elute once more, and the mixture was centrifuged at 12,000 rpm for 2 min to obtain a high-concentration DNA solution.

Images