Avian infectious bronchitis virus system based on double reporter genes and application thereof

By introducing dual reporter genes into the chicken infectious bronchitis virus system, qualitative and quantitative detection of the virus was achieved, overcoming the shortcomings of existing detection methods, improving detection sensitivity and specificity, simplifying experimental operations, and providing a virus research and control tool for various application scenarios.

CN121344089APending Publication Date: 2026-01-16XIANGHU LABORATORY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511272704.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-08
Publication Date
2026-01-16

AI Technical Summary

Technical Problem

Existing methods for detecting infectious bronchitis virus in chickens are inadequate in terms of sensitivity, specificity, and ease of operation. The protective effect of vaccines is also limited by viral mutations. There is a lack of detection technologies and vaccine construction methods that can simultaneously meet qualitative and quantitative requirements.

Method used

A dual-reporter gene-based infectious bronchitis virus (IBV) system is provided, comprising a recombinant IBV genome plasmid and an auxiliary plasmid. Fluorescent protein and luciferase are used as reporter genes, which are inserted into appropriate positions in the IBV genome through genetic engineering technology to achieve qualitative and quantitative detection of the virus.

Benefits of technology

It improves the sensitivity and specificity of detection, simplifies experimental operations, reduces costs, and enables real-time monitoring of IBV infection and replication. It is suitable for various applications such as virus-susceptible cell testing, virus entry mechanism research, and antiviral drug screening, providing a new tool for IBV research and prevention.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121344089A_ABST
    Figure CN121344089A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene engineering, in particular to an avian infectious bronchitis virus system based on double reporter genes and application thereof. According to the avian infectious bronchitis virus system based on the double reporter genes, real-time monitoring of IBV infection and replication can be achieved, the detection sensitivity and specificity are improved, meanwhile, experimental operation is simplified, and cost is reduced. The system can be used for various applications including but not limited to virus susceptible cell testing, virus entry mechanism research, antiviral drug screening, vaccine and neutralizing antibody effect evaluation, virus intrusion inhibitor evaluation and influence research of virus variation on infectivity. The system and the method provided by the invention provide a new tool for research and prevention and control of IBV and other enveloped viruses, and have important scientific and practical application values.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering, in particular to a chicken infectious bronchitis virus system based on double reporter genes and application thereof. BACKGROUND

[0002] Chicken infectious bronchitis (IB) is an acute, highly contagious disease caused by the chicken infectious bronchitis virus (IBV). IBV is highly variable and can infect various tissues and organs of the respiratory tract, urogenital and digestive system of chickens. The disease is widespread in the world and is one of the major diseases that cause significant harm to the world's poultry industry. It is also a disease that must be inspected for the import and export of chicken products. The World Organization for Animal Health has listed it as a statutory report of animal diseases. At present, although there are various vaccines and prevention and control measures, due to the rapid variation of the virus and the limitations of existing detection techniques, the prevention and control of IBV still faces challenges. In particular, the existing detection methods have deficiencies in sensitivity, specificity and operational convenience, and the protective effect of the vaccine is also restricted by the variation of the virus. Therefore, the development of new detection techniques and vaccine construction methods is crucial to improve the efficiency of IBV prevention and control.

[0003] IBV is a single-stranded positive-sense RNA virus with a capsid and no segmented, belonging to the coronavirus family of gamma coronaviruses. The genome is about 27.6 kb in size, and has four major structural proteins, namely the spike protein (S), the membrane protein (M), the nucleocapsid protein (N), and the small envelope protein (E). Among them, the S protein can combine with the receptors of the cell, and plays an important role in the infectivity of IBV. IBV itself has the characteristics of high variation, and the widespread use of vaccines has further promoted its variation. There are many serotypes of IBV, and the cross-protection between different serotypes is weak, making it difficult to diagnose and prevent and control IB.

[0004] At present, the study of the pathogenesis of coronaviruses is largely limited by the lack of isolation and culture and the lack of manipulable viral genetic tools. Compared with other viruses, coronaviruses have a genome of about 27-30 kb, which presents significant challenges in engineering vectors for generating infectious clones. The distinction between natural and amplification-related mutations and sequencing errors can be extremely difficult. In addition, attempts to establish a reverse genetics system are hindered by the instability of viral genome sequences and toxicity. Reverse genetics technology is a useful platform for viral research and can play an important role in elucidating the pathogenic mechanism of viruses and vaccine development. Similarly, the construction of an avian coronavirus infectious molecular clone system can enable more effective research on specific genes of IBV and is a useful platform for research.

[0005] In the process of scientific research and drug development, qualitative and quantitative experiments are often needed to be carried out simultaneously, so two different reporter gene viruses need to be packaged respectively, and similar experiments need to be carried out respectively. This not only increases the experimental cost, but also affects the consistency of the experiment. At present, there is no chicken infectious bronchitis virus that can meet the requirements of qualitative and quantitative experiments. Therefore, it is necessary to find a chicken infectious bronchitis virus that can meet the requirements of qualitative and quantitative experiments. SUMMARY

[0006] The purpose of the present application is to provide a double reporter gene-based chicken infectious bronchitis virus system and its application, so as to solve the problems existing in the prior art. The chicken infectious bronchitis virus system provided by the present application can be used for packaging viruses carrying target genes and carrying out related research.

[0007] To achieve the above purpose, the present application provides the following scheme:

[0008] The present application provides a double reporter gene-based chicken infectious bronchitis virus system, which comprises a recombinant chicken infectious bronchitis virus genome plasmid and a helper plasmid.

[0009] The recombinant chicken infectious bronchitis virus genome plasmid comprises a chicken infectious bronchitis virus genome of reporter gene one and reporter gene two; and the helper plasmid can package the protein of the necessary N gene of the chicken infectious bronchitis virus. That is, the helper plasmid can express the N protein plasmid of the chicken infectious bronchitis virus.

[0010] Preferably, the reporter gene one is a fluorescent protein gene; and the reporter gene two is a luciferase gene.

[0011] Preferably, the fluorescent protein comprises green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP) or blue fluorescent protein (BFP), but is not limited to the foregoing fluorescent proteins; and the luciferase comprises renilla luciferase (rLuc), firefly luciferase (fLuc), gaussia luciferase (gluc) or nanoluciferse (nLuc), but is not limited to the foregoing luciferases.

[0012] Preferably, the fluorescent protein is green fluorescent protein; and the luciferase is nanoluciferse.

[0013] Preferably, the backbone plasmid of the recombinant infectious bronchitis virus genome plasmid is pSMART BAC; and the backbone plasmid of the helper plasmid is pRK5-Myc.

[0014] Further preferably, the first reporter gene is located after the M gene of the infectious bronchitis virus genome, and the second reporter gene is located after the first reporter gene.

[0015] The application provides application of the infectious bronchitis virus system to packaging of the infectious bronchitis virus.

[0016] The application provides a preparation method of the infectious bronchitis virus containing double reporter genes, which comprises the following steps: after transfecting cells one by using the infectious bronchitis virus system, virus rescue is performed to obtain the infectious bronchitis virus containing double reporter genes; and the infectious bronchitis virus containing double reporter genes is obtained by proliferating and culturing the infectious bronchitis virus containing double reporter genes by using cells two.

[0017] Preferably, the cells one are BHK-21 cells or Vero cells; and the cells two are Vero cells.

[0018] The application provides the infectious bronchitis virus containing double reporter genes obtained by using the preparation method. That is, the infectious bronchitis virus containing double reporter genes can be obtained by transfecting cells by using the recombinant infectious bronchitis virus genome plasmid and the helper plasmid, and can be observed by using fluorescent protein and detected by using luciferase.

[0019] The application provides application of the infectious bronchitis virus system or the infectious bronchitis virus containing double reporter genes in any one of the following aspects:

[0020] (1) infectious bronchitis virus susceptible cell test;

[0021] (2) infectious bronchitis virus entry mechanism research;

[0022] (3) anti-infectious bronchitis virus drug screening;

[0023] (4) vaccine and neutralizing antibody effect evaluation;

[0024] (5) infectious bronchitis virus invasion inhibitor evaluation;

[0025] (6) infectious bronchitis virus variation effect evaluation;

[0026] (7) anti-infectious bronchitis virus vaccine immune response evaluation;

[0027] (8) Evaluation of the protective effect of the anti-chicken infectious bronchitis virus vaccine;

[0028] (9) Screening of the anti-chicken infectious bronchitis virus vaccine;

[0029] (10) Evaluation of the drug activity of the anti-chicken infectious bronchitis virus.

[0030] As an additional option, the present application provides a method for monitoring a double reporter gene-containing chicken infectious bronchitis virus, which can achieve real-time monitoring of the IBV infection process by monitoring the expression levels of luciferase and GFP, providing more timely data support for disease control.

[0031] As an additional option, the present application provides a method for quantifying a double reporter gene-containing chicken infectious bronchitis virus, which uses a fluorescence detection instrument to quantitatively analyze the fluorescence signal in cell culture, thereby obtaining quantitative data on the activity of the double reporter gene-containing chicken infectious bronchitis virus.

[0032] The present application discloses the following technical effects:

[0033] The present application provides a double reporter gene-based chicken infectious bronchitis virus system, which uses two different reporter genes to monitor the infection and replication of the virus by changes in their expression levels. Compared with traditional single reporter gene systems, the double reporter gene system can provide more accurate virus activity information, thereby improving the sensitivity and specificity of detection; the system can simultaneously detect signals generated by different reporter genes in one experiment, which can shorten the experimental period, save experimental costs, and improve the consistency of experimental results. At the same time, the present application inserts fluorescent proteins and luciferase genes into appropriate positions of IBV through genetic engineering techniques, improving the accuracy and sensitivity of detection. In addition, the present application has the advantages of simple operation, low cost, etc., and is expected to play an important role in virus research and disease prevention and control. As can be seen, the double reporter gene system of the present application can achieve real-time monitoring of IBV infection and replication, improve the sensitivity and specificity of detection, and simplify experimental operations and reduce costs. The system can be used for various applications, including but not limited to virus susceptible cell testing, virus entry mechanism research, anti-viral drug screening, vaccine and neutralizing antibody effect evaluation, virus invasion inhibitor evaluation, and virus variation impact on infectivity research. The system and method of the present application provide new tools for IBV and other enveloped viruses research and prevention and control, and have important scientific and practical application value.

[0034] And, the present application establishes a method for carrying two or more functionally complementary reporter genes by a virus, and successfully obtains a representative IBV tool virus according to this theory. The double / multiple reporter gene IBV virus obtained by the method can obtain a virus tool that can simultaneously exhibit excellent performance in both qualitative (fluorescent protein) and quantitative (luciferase) levels through one virus production step, and realizes a high-efficiency and stable infection structure by inserting two different reporter genes in two different regions of the genome. Compared with the traditional single reporter gene, the present application has more application scenarios, and can greatly reduce the time and economic cost of experiments, and also performs excellently in virus packaging, infection and replication efficiency, and has good development and application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0035] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0036] Figure 1 It is a schematic diagram of the gene structure of chicken infectious bronchitis virus;

[0037] Figure 2 It is a schematic diagram of the construction of double reporter gene chicken infectious bronchitis virus;

[0038] Figure 3 It is an electrophoresis result diagram of double reporter gene chicken infectious bronchitis virus infectious clone plasmid pSB-IBV-GFP-nLuc;

[0039] Figure 4 It is a schematic diagram of transfection and rescue of double reporter gene chicken infectious bronchitis virus;

[0040] Figure 5 It is a green fluorescent protein expression observation result diagram of double reporter gene chicken infectious bronchitis virus infecting Vero cells;

[0041] Figure 6 It is an electrophoresis result diagram of double reporter gene chicken infectious bronchitis virus genome PCR identification; lane 1 is a wild type IBV virus positive control; lane 2 is double reporter gene chicken infectious bronchitis virus rescued in Vero cells; lane 3 is double reporter gene chicken infectious bronchitis virus rescued in BHK-21 cells;

[0042] Figure 7 It is a luciferase expression identification result diagram of double reporter gene chicken infectious bronchitis virus after infecting cells. DETAILED DESCRIPTION

[0043] Various exemplary embodiments of the present application will now be described in detail, with reference to the figures. The detailed description is not to be regarded as limiting the application, but rather as a description of certain aspects, features and embodiments of the application.

[0044] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. Additionally, for a range of values of a parameter, unless otherwise indicated, each intervening value by each intervening value, as well as any other stated or intervening value in that stated range is encompassed. The upper and lower limits of these intervening values can independently be included or excluded in the range, and each smaller range that "falls" within the ambit of the larger range is also encompassed. These smaller ranges can be independently combined with any other smaller range or point to form a new range that is encompassed by the original larger range.

[0045] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All patents, patent applications, publications, and descriptions mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the patents, patent applications, publications, and descriptions are cited.

[0046] Many modifications and variations of this application can be made in the light of the above teachings without departing from the spirit and scope thereof. Other implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The examples and embodiments described herein are exemplary only and are not intended to be limiting.

[0047] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended and do not exclude additional, unrecited elements or method steps.

[0048] Example 1 Construction of Infectious cIBV Genome Plasmid with Dual Reporter Genes

[0049] As Figure 1As shown, the IBV genome sequence is 5'-ORF1ab (ORF1a / 1b)-S-ORF3a-ORF3b-E-M-ORF5a-ORF5b-N-3'. According to the sequence of IBV full genome (Gene version number: AJ311317), the full-length genome is divided into 8 fragments and the IBV genome is amplified using specific primers to obtain the corresponding 8 genome fragments (IBV-1A-1 fragment (1A-1), IBV-1A-2 fragment (1A-2), IBV-2B fragment (2B), IBV-3C-1 fragment (3C-1), IBV-3C-2 fragment (3C-2), IBV-4D fragment (4D), IBV-5E-1 fragment (5E-1) and IBV-5E-2 fragment (5E-2)). The PCR amplification is performed using Q5 high-fidelity DNA polymerase, the DNA fragments are recovered and purified, and the concentration is determined. The specific primers used in the present application are shown in Table 1.

[0050] Table 1 Primer sequence list

[0051] Primer name Primer sequence (5'→ 3') SEQ ID NO. IBV-1A-F1 TCGTTTAGTGAACCGTACTTAAGATAGATAT 1 IBV-1A-R1 CTCATAGATCACAGAGAG 2 IBV-1A-F2 GGTAAGACTGTCACCTTTG 3 IBV-1A-R2 TACCACCTTACATAACACGGTCTTATAGCTAGCGACAACACTCTTAAC 4 IBV-2B-F TTCTATTTCTTGAAGGCTAGTGTTAAGAGTGTTGTCGCTAGCTATAAG 5 IBV-2B-R AGTACTTTAATCTAGCATACGCTGAAAGGTAGGCCTCAAATTTATCAC 6 IBV-3C-F1 TTAAGCTTACTAATGAGATAGGTGATAAATTTGAGGCCTACCTTTCAG 7 IBV-3C-R1 TCAGGAGTAGGACTTGG 8 IBV-3C-F2 TCTAAAGGGCATGAAACAG 9 IBV-3C-R2 ATTCTTCTGTGGCTTTTACTGTCTCTGCAGCAAAACGTCTCAATGAAT 10 IBV-4D-F ATTTTAGCAAATCGCTGTAGTGATTCATTGAGACGTTTTGCTGCAGAG 11 IBV-4D-R TAAACACCTGCAGATGTAACATCTATGGTCTCATTAGAGGTGTAAACA 12 IBV-5E-F1 CCGTATATTTAAATGGTGATCTTGTTTACACCTCTAATGAGACCATAG 13 IBV-5E-R1 TATTAGTTGTTGGAGCGCTATAATAAACTCTCTAAAACAAGATAG 14 IBV-5E-F2 CCTAATAGTATTAATTCTTCTTTGGTGTAAACTTGTACTATCTTG 15 IBV-5E-R2 GCTCTAACTCTATAC 16

[0052] As Figure 2

[0053] The nucleotide sequence of the recombinant double reporter gene chicken infectious bronchitis virus is shown as SEQ ID NO. 19+SEQ ID NO. 20+SEQ ID NO. 21+SEQ ID NO. 22+SEQ ID NO. 23+SEQ ID NO. 24+SEQ ID NO. 25+SEQ ID NO. 26, each sequence is directly connected without any base insertion, and the specific sequence is shown as follows:

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062] The expression vector pSMART BAC contains CMV promoter, HDV ribozyme and BGH terminator. The expression vector pSMART BAC and 8 gene fragments of IBV were mixed in equimolar ratio, in which the IBV-5E-2 fragment contains the sequence of double reporter gene, the ligation reaction was carried out by homologous recombination enzyme, the recombinant plasmid was transformed into DH10B competent cells, and further chloramphenicol resistance screening was carried out. Positive monoclonal was picked and recombinant plasmid was obtained by extraction, and the recombinant plasmid was named pSB-IBV-GFP-nLuc.

[0063] Example 2 Identification of chicken infectious bronchitis virus genome plasmid with double reporter gene

[0064] The IBV-GFP-nLuc full-length genome cDNA clone was identified by PCR. The pSB-IBV-GFP-nLuc was divided into 24 fragments, and the sequence of the recombinant IBV-GFP-nLuc full-length genome was identified by full-length PCR, and the steps were as follows:

[0065] The glycerol bacteria containing the correct pSB-IBV-GFP-nLuc plasmid were inoculated into 400 mL culture medium for culture. The plasmid was extracted by plasmid extraction kit (manufacturer: Omega Biotek, product number: D2154), and pSB-IBV-GFP-nLuc was obtained, and the use method of the kit was referred to the instruction (the culture medium was removed by centrifugation, the bacterial body was resuspended by adding buffer solution 1, then the bacterial body was lysed by adding lysis solution 2, and the solution was changed from turbidity to transparency by adding neutralization solution 3; the sample was mixed and placed on ice until white flocculent was generated and the mucilage was clear; the sample was centrifuged at 10000 rpm for 30 minutes to separate the precipitate and supernatant, and the supernatant after centrifugation was transferred to a new container; 20 mL of BAC binding solution was added to the collected supernatant and mixed, and incubated at room temperature for 5-10 minutes. The solution was passed through the DNA enrichment column by vacuum suction to adsorb the DNA; the washing solution was added to the enrichment column, and then centrifuged at 5000 rpm to remove the residual liquid; the DNA enrichment column was transferred to a new centrifuge tube, 500 μL of preheated ddH2O was added to the enrichment column, and incubated for 5 minutes, and pSB-IBV-GFP-nLuc was obtained by centrifugation elution).

[0066] A large amount of pSB-IBV-GFP-nLuc containing double reporter gene was extracted, and the completion of pSB-IBV-GFP-nLuc was identified, and the results were as follows Figure 3The results show that the IBV-GFP-nLuc genome containing double reporter genes is complete, and the sequencing results are consistent with the target sequence shown in SEQ ID NO. 19, and pSB-IBV-GFP-nLuc is complete, the size is as expected, and can be applied to the rescue of chicken infectious bronchitis virus with double reporter genes.

[0067] Transfection rescue of chicken infectious bronchitis virus with double reporter genes

[0068] BHK-21 cells or Vero cells were inoculated in a 12-well plate and cultured to a cell density of 60-70%. One hour before transfection, the original cell culture medium was discarded and replaced with opti-MEM medium.

[0069] TM 3000, gently tap the bottom of the tube to mix; after gently tapping the two tubes to mix, let them stand at room temperature for 15 minutes to obtain the mixture.

[0070] Add the mixture dropwise to BHK-21 or Vero cell culture medium, mix well, and then incubate in a 5% CO2, 37°C incubator. The incubation procedure is as follows: Figure 4 As shown. Figure 4 Following the steps shown, cells were cultured for 3 days (72 hpi) after transfection. The supernatant was collected and used to infect Vero cells in 12-well plates, where they were cultured for 3 days. After continuous passage in Vero cells, the virus was collected. The chicken infectious bronchitis virus with dual reporter genes rescued by transfection with pSB-IBV-GFP-nLuc was named "rIBV-GFP-nLuc".

[0071] The results of observing the expression of green fluorescent protein in Vero cells after infection with chicken infectious bronchitis virus with dual reporter genes are shown in the figure below. Figure 5 As shown in the figure. The results showed that green fluorescence signal was clearly observed in cells infected with rIBV-GFP-nLuc, proving that the chicken infectious bronchitis virus with dual reporter genes was successfully rescued and was able to express GFP protein. Through these steps, the recombinant IBV genome plasmid (pSB-IBV-GFP-nLuc) was successfully constructed and validated, and then the recombinant virus with dual reporter genes was obtained through transfection rescue, providing an important tool for subsequent virological research and applications.

[0072] Example 4: Identification and Detection of Chicken Infectious Bronchitis Virus with Dual Reporter Genes

[0073] The rescued chicken infectious bronchitis virus (rIBV-GFP-nLuc) with dual reporter genes was identified and detected using the following steps:

[0074] RNA of chicken infectious bronchitis virus with dual reporter genes was extracted using the Trizol method, and cDNA samples were further prepared by reverse transcription. The presence of the chicken infectious bronchitis virus genome with dual reporter genes was identified by PCR using the IBV gene detection sample. The upstream primer was IBV-2B-F, with the nucleotide sequence shown in SEQ ID NO.28: 5'-TTCTATTTCTTGAAGGCTAGTGTTAAGAGTGTTGTCGCTAGCTATAAG-3'; the downstream primer was IBV-TF5R, with the nucleotide sequence shown in SEQ ID NO.29: 5'-GCAGCACAGTTGAATTCAAT-3'. PCR identification results are shown below. Figure 6As shown, lane 1 is wild type IBV virus positive control; lane 2 is double reporter gene chicken infectious bronchitis virus rescued in Vero cells; lane 3 is double reporter gene chicken infectious bronchitis virus rescued in BHK-21 cells. The results prove that the double reporter gene chicken infectious bronchitis virus capable of continuous passage is successfully rescued.

[0075] The double reporter gene chicken infectious bronchitis virus rescued is used to infect Vero cells, and total protein samples of cells at 0 (Mock), 6, 12, 24, 36 and 48 hours after infection are extracted respectively, and the luciferase expression is detected by adding fluorescent substrate through luciferase activation reaction, and the results are shown in Figure 7 The results show that the nLuc expression exists in the double reporter gene chicken infectious bronchitis virus infected cells, and the luciferase activity increases with the increase of the infection time.

[0076] In conclusion, the effectiveness of the double reporter gene chicken infectious bronchitis virus is identified and detected through the above experiments, and the activity of the fluorescent protein or the luciferase is detected, so that it is determined that the double reporter gene chicken infectious bronchitis virus provided by the present application can be applied to rapidly evaluate the immune response and protective effect induced by the vaccine, and develop a high-throughput screening platform; and can also be used for identifying and evaluating the activity of the anti-chicken infectious bronchitis virus drug, and accelerating the research and development process of the antiviral drug.

[0077] The above-described embodiments are only used to describe the preferred modes of the present application, and do not limit the scope of the present application, and various modifications and improvements of the technical solutions of the present application made by those skilled in the art without departing from the design spirit of the present application shall fall within the protection scope of the present application determined by the claims.

Claims

1. A dual reporter gene based system for chicken infectious bronchitis virus characterized in that, The chicken infectious bronchitis virus system comprises a recombinant chicken infectious bronchitis virus genome plasmid and a helper plasmid; The recombinant chicken infectious bronchitis virus genome plasmid comprises a chicken infectious bronchitis virus genome of a reporter gene one and a reporter gene two; and the helper plasmid can package proteins of essential N genes of the chicken infectious bronchitis virus.

2. The chicken infectious bronchitis virus system of claim 1, wherein, The reporter gene one is a fluorescent protein gene; and the reporter gene two is a luciferase gene.

3. The chicken infectious bronchitis virus system of claim 2, wherein, The fluorescent protein comprises a green fluorescent protein, a red fluorescent protein, a yellow fluorescent protein or a blue fluorescent protein; and the luciferase comprises a Renilla luciferase, a firefly luciferase, a Gaussia luciferase or a nanoluciferase.

4. The chicken infectious bronchitis virus system of claim 3, wherein, The fluorescent protein is a green fluorescent protein; and the luciferase is a nanoluciferase.

5. The chicken infectious bronchitis virus system of claim 1, wherein, The backbone plasmid of the recombinant chicken infectious bronchitis virus genome plasmid is pSMART BAC; and the backbone plasmid of the helper plasmid is pRK5-Myc.

6. Use of the chicken infectious bronchitis virus system according to any one of claims 1-5 in packaging the chicken infectious bronchitis virus.

7. A method of producing a double reporter chicken infectious bronchitis virus, characterized by, The preparation method comprises the following steps: after transfecting cells one with the chicken infectious bronchitis virus system according to any one of claims 1-5, performing virus rescue to obtain a chicken infectious bronchitis pseudovirus carrying double reporter genes, and using cells two to proliferate and culture the chicken infectious bronchitis pseudovirus carrying double reporter genes to obtain the chicken infectious bronchitis virus containing double reporter genes.

8. The preparation method according to claim 7, characterized in that, The cells one are BHK-21 cells or Vero cells; and the cells two are Vero cells.

9. A chicken infectious bronchitis virus containing double reporter genes obtained by the preparation method according to claim 7 or 8.

10. Use of the chicken infectious bronchitis virus system according to any one of claims 1-5 or the chicken infectious bronchitis virus containing double reporter genes according to claim 9 in any one of the following: (1) chicken infectious bronchitis virus susceptible cell test; (2) chicken infectious bronchitis virus entry mechanism research; (3) anti-chicken infectious bronchitis virus drug screening; (4) vaccine and neutralizing antibody effect evaluation; (5) chicken infectious bronchitis virus invasion inhibitor evaluation; (6) evaluation of the influence of chicken infectious bronchitis virus variation on infectivity; (7) anti-chicken infectious bronchitis virus vaccine immune response evaluation; (8) anti-chicken infectious bronchitis virus vaccine protection effect evaluation; (9) anti-chicken infectious bronchitis virus vaccine screening; (10) anti-chicken infectious bronchitis virus drug activity evaluation.