Method and apparatus for high throughput ultramicro analysis of free nucleosome information in peripheral blood

Abstract

The invention discloses a method and equipment for high-throughput ultramicro analysis of free nucleosome information in peripheral blood. Compared with a traditional method, the method has the advantages that multiple histone modification types of multiple plasma samples can be synchronously detected, the detection efficiency is effectively improved, the detection cost is reduced, the requirement of ultramicro samples is met, and huge clinical application prospects are shown.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically to a method and apparatus for high-throughput ultramicro analysis of free nucleosome information in peripheral blood. Background Technology

[0002] Cell-free DNA (cfDNA) exists in peripheral blood, primarily originating from the death of blood cells, but some may also originate from cells at the site of the patient's lesion. For example, in cancer patients, cfDNA from tumor cells is called circulating tumor DNA (ctDNA). Information regarding cfDNA mutation sites, methylation, fragment length, and histone modifications in cell-free nucleosomes (cf-nucleosomes) is of great research value and has received considerable attention in recent years.

[0003] cfDNA exists primarily in the blood as free nucleosomes. Nucleosomes are the basic building blocks of chromosomes, retaining information about various histone chemical modifications. Histone modification sites are abundant and diverse, including acetylation and methylation, such as H3K4me3, H3K4me2, H3K27ac, H3K27me3, H3K9me3, and H3K36me3. These modifications affect chromatin structure and gene expression. H3K4me3 and H3K27ac are marker molecules for active genes; they are typically enriched in the promoters of active genes, and the H3K4me2 and H3K27ac signals in enhancers are positively correlated with their activity. H3K27me3 and H3K9me3 are typically enriched in heterochromatin and inactive genes; H3K36me3 is enriched in the gene bodies of active genes. Therefore, histone modification combinations endow free nucleosomes with tissue-specific genetic information and reflect the state of gene expression and regulation within cells. Compared with studies on cfDNA mutation sites, methylation, and fragmentation length, research on free nucleosome modifications in blood is still in its early stages. The main reason for this is the diversity of nucleosome modifications and the abundance of sites, while existing detection technologies have limited library construction throughput, low efficiency, high cost, and low sensitivity, resulting in large sample requirements (current technologies require at least 1 ml of plasma for each modification). Therefore, there is an urgent need to develop a stable, efficient, low-sample-requirement, and low-cost free nucleosome mapping technology to promote the research and application of free nucleosome modifications.

[0004] Recently, in order to obtain information on the histone modification map of free nucleosomes, the cfChIP-seq (cell-free ChIP-seq) technology has been developed based on the conventional ChIP-seq (chromatin immunoprecipitation followed by sequencing) technology. ChIP-seq combines chromatin immunoprecipitation with next-generation sequencing technology and is the "gold standard" for mapping DNA-binding proteins. Unlike conventional ChIP-seq, plasma samples studied by cfChIP-seq have special characteristics: (1) other antibodies are present in peripheral blood, which may interfere with the ChIP process; (2) most of the free nucleosome DNA is the length of one or two nucleosomes and does not require fragmentation; (3) the content of cfDNA in peripheral blood is very low, which requires higher sensitivity and specificity for detection. To address the issue that other antibodies in peripheral blood might interfere with ChIP efficacy, Sadeh et al. constructed a cfChIP-seq process that binds antibodies to Dynabeads™ M-270 epoxy resin magnetic beads. These antibody-bound beads can then be directly mixed with plasma for ChIP to capture target sequences. However, due to the complexity of preparing the antibody-magnetic bead covalent complex, the large amount of antibody required, and the potential adverse effects on antibody binding ability, Baca et al. further improved the cfChIP-seq process by pre-incubating plasma samples with protein A / G magnetic beads to remove antibodies present in the plasma, thus simplifying the process. Furthermore, based on total internal reflection microscopy (TIRFM), Fedyuk et al. developed the EPINUC (epigenetics of plasma-isolated nucleosomes) system to achieve single-molecule, multi-factor parallel mapping of free nucleosomes. Based on these technologies, proof-of-concept studies were conducted, mapping the modification characteristics of free nucleosomes in the blood of patients with various cancer types, demonstrating the importance and broad application prospects of research on free nucleosome modifications in blood. However, these technologies still have limitations: (1) Each sample requires separate ChIP and library construction, resulting in low throughput and high costs due to the large amount of consumables such as antibodies and library construction reagents; (2) Low detection sensitivity leads to a large sample demand, high sample processing time and labor costs, and limits the number of modification types that can be studied in the same batch of samples; (3) The fluorescence microscopy technology used by EPINUC is expensive and requires matching chips and microfluidic systems, which most laboratories lack. The limitations of existing technologies make it difficult to apply them to large-scale sample studies.Therefore, developing novel peripheral blood free nucleosome modification mapping technology, and improving detection throughput and efficiency while reducing sample input and library construction costs are key technical issues that need to be addressed.

[0005] The information in the background section is merely intended to illustrate the general background of the invention and should not be construed as an admission or implication in any way that such information constitutes prior art known to those skilled in the art. Summary of the Invention

[0006] Based on the current state and limitations of the technology, this invention provides a method and apparatus for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood. Specifically, this invention includes the following:

[0007] A first aspect of the present invention provides a method for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood, comprising the following steps: (1) Take m plasma samples from the subjects and add a specific nucleic acid tag corresponding to each plasma sample to each plasma sample to obtain m labeled samples; (2) Mix the m labeled samples to obtain a mixed sample; (3) Based on the characteristics of free nucleosomes, the mixed sample is divided into n parallel samples; (4) In each parallel sample, free nucleosomes are enriched using a specific molecule targeting a feature of the free nucleosome, and nucleic acid molecules are separated from the free nucleosomes to obtain n test samples; (5) Detect the nucleic acid sequence information in the n test samples respectively, and obtain m×n different classification information based on the combination of m specific nucleic acid tags and n parallel samples, where m and n each represent integers greater than 1.

[0008] In some embodiments, according to the method for high-throughput ultramicro analysis of free nucleosome information in peripheral blood according to the present invention, the specific nucleic acid tag comprises a single linker molecule targeting DNA, which preferably comprises a tag sequence composed of different bases.

[0009] In some embodiments, according to the method for high-throughput ultramicro analysis of free nucleosome information in peripheral blood according to the present invention, the free nucleosomes are characterized by histone characteristics.

[0010] In some embodiments, according to the method for high-throughput ultramicro analysis of free nucleosome information in peripheral blood according to the present invention, the histone features are selected from at least one of acetylation features, methylation features, phosphorylation features, ubiquitination features, SUMOylation features, ADP ribosylation features, propionylation features, and butyrylation features.

[0011] In some embodiments, according to the method for high-throughput ultramicro analysis of free nucleosome information in peripheral blood according to the present invention, the histone is characterized by at least one of H3K4me3, H3K4me2, H3K27ac, H3K27me3, H3K9me3 and H3K36me3.

[0012] In some embodiments, according to the method for high-throughput ultramicro analysis of free nucleosome information in peripheral blood according to the present invention, the free nucleosome information includes histone information and DNA sequence information, including sequence length information and / or sequence composition information.

[0013] In some embodiments, according to the method for high-throughput ultramicro analysis of free nucleosome information in peripheral blood according to the present invention, step (1) includes constructing a labeling reaction system, wherein the labeling reaction system includes a specific nucleic acid tag and a buffer, but does not include the ligation activator polyethylene glycol (sometimes referred to herein as PEG).

[0014] In some embodiments, according to the method for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood according to the present invention, step (5) includes library construction and sequencing for n test samples to obtain DNA sequence information.

[0015] In some embodiments, the method for high-throughput ultramicro analysis of free nucleosome information in peripheral blood according to the present invention further includes the step of analyzing free nucleosome information in different subjects.

[0016] A second aspect of the present invention provides an apparatus for high-throughput ultramicro analysis of free nucleosome information in peripheral blood, wherein the apparatus includes: a memory, a processor, and an executable program stored in the memory and capable of running on the processor, the executable program being configured to implement the steps of the method described in the first aspect.

[0017] This invention provides a high-throughput method for detecting histone modification profiles in ultra-micro plasma free nucleosomes. This method can simultaneously detect multiple histone modification types in multiple plasma samples, effectively improving detection efficiency, reducing detection costs, and meeting ultra-micro sample requirements (as low as 25 μL per sample per detection type). Traditional methods require detecting the distribution of each modification type in each sample, resulting in low detection efficiency, high cost, and large sample requirements (at least 1000 μL per sample per detection type). Furthermore, the sample labeling system provided by this invention exhibits high repeatability and good stability. Attached Figure Description

[0018] Figure 1The technical roadmap of a high-throughput ultra-micro plasma free nucleosome histone modification profile detection method is shown, and its comparison with traditional methods is presented.

[0019] Figure 2 This is a visualization example of the free nucleosome H3K4me3 map.

[0020] Figure 3 The results of the correlation analysis of aggregation sites using the method of this invention and the conventional method are shown (taking the BC05 sample as an example).

[0021] Figure 4 This paper compares the efficiency, cost, and material requirements of the method of this invention with those of conventional methods for building a library.

[0022] Figure 5 This paper compares the costs of the method of the present invention with those of conventional methods for different samples and the number of detection targets.

[0023] Figure 6 This invention demonstrates the effectiveness of the method for simultaneous multi-sample, multi-factor detection of histone modification maps in free nucleosomes. (A) A visualization example of the histone modification maps; (B) A heatmap showing the distribution characteristics of the four histone modifications in the gene and its upstream and downstream 3 kb signals.

[0024] Figure 7 For histone modification-associated cell-free nucleosome DNA length analysis. (A) Box plot showing the median distribution of histone modification-associated cell-free DNA; (B) Box plot comparing the differences in the median distribution of histone modification-associated cell-free DNA between breast cancer patients and healthy controls.

[0025] Figure 8 The frequency distribution of cell-free DNA mononucleosome and binucleosome lengths associated with different modifications.

[0026] Figure 9 The ratio of single nucleosomes to binucleosomes of free DNA is distributed across the entire genome.

[0027] Figure 10 ROC curves were used to evaluate the performance of a histone modification-associated free DNA fragmentation pattern classifier.

[0028] Figure 11 A visualization example of the H3K4me3 spectra of free nucleosomes detected by PEG-labeled and PEG-free plasma sample labeling reactions. Detailed Implementation

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that the upper and lower limits of the range and each intermediate value between them are specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, are also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0031] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0032] The method disclosed in this invention uses single-strand linking technology to attach a single linker containing a barcode sequence to the 3' end of free nucleosome DNA, thereby labeling the free nucleosomes in the sample. Multiple labeled samples can be mixed together and then divided into multiple components. Each component can be simultaneously immunoprecipitated to detect the corresponding modification pattern, thus realizing the mapping of multi-sample, multi-factor patterns of peripheral blood free nucleosomes.

[0033] The single-stranded ligation technology disclosed in this invention utilizes terminal transferase to extend the 3' end of sample DNA to form an extended single-stranded DNA structure, obtaining extended DNA. Under the action of a clamp, the extended DNA and the single-stranded ligation head are ligated to obtain pre-ligated nicked DNA. The 3' end of the single-stranded DNA structure and the 5' end of the single-stranded ligation head are adjacent and have a nick. DNA ligase is used to connect the nick with a phosphodiester bond to obtain pre-ligated DNA with a single-stranded ligation head. This achieves a one-tube labeling reaction for free nucleosomes, which is simple and efficient to operate.

[0034] This invention provides a high-throughput, ultra-micro plasma free nucleosome histone modification mapping method. This method can be used to determine or detect the distribution characteristics and functions of nucleosome histone modifications at the genomic level, and the differences in length of different modified fragments are correlated with the differences in binucleosome fragment lengths. Therefore, this method can determine the modification information of free nucleosome histones in peripheral blood with high throughput and ultra-micro volume. In some embodiments, the information on free nucleosome histones in peripheral blood determined by this method is used for non-therapeutic or diagnostic purposes; that is, the modification information is only used as an intermediate result for disease diagnosis or treatment, or only for adjuvant therapy or diagnostic purposes. In some embodiments, the information on free nucleosome histones in peripheral blood determined by this method can be used for disease detection, such as for breast cancer detection. The method of this invention will be described in detail below.

[0035] Step (1) of the present invention involves obtaining peripheral blood and further separating it to obtain plasma and labeling the plasma sample. The steps of peripheral blood extraction and plasma separation are known in the art and are not particularly limited thereto.

[0036] m plasma samples from the subject are collected, and a specific nucleic acid tag corresponding to each plasma sample is added to each plasma sample to obtain m labeled samples. In some embodiments, m represents an integer greater than 1. In a preferred embodiment, the specific nucleic acid tag has the following sequence: 5'-M1CAGCGATCGACN n AGATCGGAAGAGCACACGTCTGAACTCCAGTCA / ddC / -3', / ddC / represents dideoxycytosine nucleoside, N x This represents a tag sequence having x identical or different bases, where x is an integer greater than or equal to 4, such as 5, 6, 7, 8, 9, 10, or even an integer greater than 10. In another preferred embodiment, the specific nucleic acid tag has the sequence shown below: 5' M1 GTCGATCGCTCCCCCC M2 3', M1 and M2 are each independently modified with a phosphate group, a SpacerC12 group, or an NH2C6 group.

[0037] In this invention, the ligation system preferably does not contain PEG. Therefore, the ligation system of this invention preferably consists of a specific nucleic acid tag, T4 DNA ligase buffer, dGTP, T4 DNA ligase, T4 polynucleotide kinase, terminal deoxynucleotidyl transferase, and ddH2O. Specifically, 5'-M1CAGCGATCGACN nAGATCGGAAGAGCACACGTCTGAACTCCAGTCA / ddC / -3' and 5' M1 GTCGATCGCTCCCCCC M2 The molar ratio of 3' is preferably 1:2, more preferably 1:1.5, and most preferably 1:1.

[0038] In this invention, the connection conditions are 30-45°C, preferably 35-40°C, for example, 35, 36, 37, 38, 39, or 40°C, for incubation for 0.5-3 h, preferably 0.5-2 h, for example, 0.5, 1, 1.5, or 2 h. Then, 0.1-1 M, preferably 0.2-0.8 M, of EDTA and 1%-15%, preferably 5%-15%, of SDS are added, and the reaction is terminated at 30-45°C, preferably 35-40°C, for example, 35, 36, 37, 38, 39, or 40°C.

[0039] Step (2) of this invention is the mixing of labeled samples. Centrifuge at 10000-20000×g for 5-15 minutes at a low temperature below 10°C, for example, 4°C, preferably 15000-20000×g. Transfer the supernatant to a new tube. Before proceeding to the next step, prepare an antibody-magnetic bead complex, wherein the antibody is an antibody against nucleosome histones, and the magnetic beads are known Pierce™ ChIP-grade Protein A / G Magnetic Beads.

[0040] Steps (3) and (4) of this invention are post-dissociation immunoprecipitation steps. The mixed sample is evenly divided according to a predetermined number of modification types, and a pre-incubated antibody-magnetic bead complex is added. The mixture is then incubated at a low temperature, for example below 10°C, at a low rotation speed, for example below 50 rpm, for at least 12 hours. The free nucleosome-antibody-magnetic bead complex is then washed with a low-salt washing buffer. In this invention, the low-salt washing buffer comprises: 0.05-1%, preferably 0.05-0.5%, most preferably 0.1% SDS; 0.1-5%, preferably 0.5-2%, most preferably 1% Triton X-100; 1-5 mM, preferably 1-4 mM, most preferably 2 mM EDTA; 100-200 mM, preferably 120-180 mM, most preferably 150 mM NaCl; and 5-50 mM, preferably 10-30 mM, most preferably 20 mM Tris-HCl (pH 7.5). The solution is then washed with a high-salt buffer, which differs from the low-salt buffer in that the NaCl concentration is 300-600 mM, preferably 400-600 mM, and most preferably 500 mM. The solution is then washed with a lithium chloride washing buffer comprising: 200-300 mM, preferably 220-280 mM, and most preferably 250 mM LiCl; 0.1-5%, preferably 0.5-2%, and most preferably 1% IGEPA® CA-630; 0.1-5%, preferably 0.5-2%, and most preferably 1% Sodium deoxycholate; 0.1-2 mM, preferably 0.5-2 mM, and most preferably 1 mM EDTA; and 5-50 mM, preferably 5-20 mM, and most preferably 10 mM Tris-HCl (pH 7.5). Finally, the mixture was washed with TE buffer, which consisted of 5-50 mM, preferably 5-20 mM, most preferably 10 mM Tris-HCl (pH 8.0) and 0.1-2 mM, preferably 0.5-2 mM, most preferably 1 mM EDTA. The washed magnetic bead complex was then purified using a handbook method with commercially available reagents to remove the captured DNA.

[0041] Step (5) of the present invention is to construct a library, amplify the library, and sequence the captured DNA. The library construction, amplification, and sequencing can be performed using methods, kits, and sequencing platforms known in the art, and are not particularly limited thereto.

[0042] Example 1 In this embodiment, the method for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood mainly includes: (1) collecting blood samples and separating plasma; (2) linking free nucleosome DNA to a single linker carrying a barcode sequence and labeling the plasma sample; (3) mixing and grouping the labeled samples; (4) performing immunoprecipitation; (5) constructing a library and sequencing the DNA captured by immunoprecipitation, and splitting and analyzing the sequencing data according to the barcode sequence. Figure 1 ).

[0043] 1. Plasma separation Collect venous blood using K3 EDTA anticoagulant tubes, gently invert to mix, centrifuge at 1500×g for 10 minutes at 4°C, transfer the plasma layer to a new centrifuge tube, centrifuge at 3000×g for 10 minutes at 4°C, add 1× protease inhibitor, mix well, aliquot for subsequent operations, or flash freeze in liquid nitrogen and store at -80°C for later use. Collected blood samples must be stored at 4°C, and plasma separation must be completed within 4 hours.

[0044] 2. Plasma sample labeling For each plasma sample, take 100 μL and add 8 μL of 10 µM P7 / P7SPlintC adapter (20 µM P7 and 20 µM P7SPlintC mixed in a 1:1 ratio, annealed at 95 °C for 5 min followed by cooling at 0.1 °C / s, where P7:5' p CAGCGATCGACNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCA / ddC / 3', of which 5' p indicates 5' phosphate group modification, / ddC / indicates dideoxycytosine nucleoside, NNNN indicates tag sequences formed by different base combinations, representing the diversity of tag sequences; P7SPlintC: 5' SpacerC12 GTCGATCGCTCCCCCC NH2C6 The following ingredients were added: 3' and 5' spacerC12 modified, 3' end NH2C6 modified; 20 μL T4 DNA ligase buffer; 2.5 μL 10 mM dGTP; 10 U T4 DNA ligase; 20 U T4 polynucleotide kinase; 40 U terminal deoxynucleotidyl transferase; ddH2O to a total volume of 200 μL; mix well and incubate at 37°C for 1 h. Then add 3 μL of 0.5 M EDTA and 2 μL of 10% SDS, and terminate the reaction at 37°C for 20 min.

[0045] During this period, for each histone modification, 2 μg of the corresponding antibody (Anti-Histone H3 (acetyl K27) antibody - ChIP Grade: ab4729; Anti-Histone H3 (trimethyl K4) antibody - ChIP Grade: ab8580; Anti-Histone H2A.Z antibody - ChIP Grade: ab4174; Anti-Histone H3 (trimethyl K9) antibody - ChIP Grade: ab8898) and 10 μL of Pierce™ ChIP-grade Protein A / G Magnetic Beads were added to 500 μL ChIP buffer (containing 50 mM Tris-HCl pH 7.5, 1 mM EDTA, and 1% IGEPAL® CA-630) and incubated at 4°C and 10 rpm for at least 3 hours to form the antibody-Pierce™ ChIP-grade Protein A / G Magnetic Beads complex.

[0046] 3. Mixed-group Multiple plasma samples containing different barcode sequence markers were mixed together and centrifuged at 16,000×g for 10 minutes at 4°C. The supernatant was transferred to a new centrifuge tube, and 50 μL of Pierce™ ChIP-grade Protein A / G Magnetic Beads were added. The tubes were incubated at 10 rpm at 4°C for at least 2 hours. After incubation on a magnetic rack for 1 minute, the supernatant was transferred to a new centrifuge tube for downstream immunoprecipitation experiments.

[0047] 4. Immunoprecipitation Depending on the number of subjects to be tested, the mixed samples were divided into equal numbers of components, and pre-incubated antibody-Pierce™ ChIP-grade Protein A / G Magnetic Beads complex was added. The mixture was then incubated overnight at 4°C and 10 rpm. On the second day, the free nucleosome-antibody-magnetic bead complex was washed twice with 500 μL low-salt wash buffer (containing 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 150 mM NaCl, and 20 mM Tris-HCl, pH 7.5), twice with 500 μL high-salt wash buffer (containing 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 500 mM NaCl, and 20 mM Tris-HCl, pH 7.5), once with 500 μL lithium chloride wash buffer (containing 250 mM LiCl, 1% IGEPAL® CA-630, 1% Sodium deoxycholate, 1 mM EDTA, and 10 mM Tris-HCl, pH 7.5), and twice with 500 μL TE buffer (containing 10 mM Tris-HCl, pH 8.0, and 1 mM EDTA), 10 μL each time. Rotate at rpm and 4℃ for 5 minutes, then transfer to a new centrifuge tube for the final time.

[0048] 5. Library construction, sequencing, and data splitting After washing, 40 μL of elution buffer (containing 10 mM Tris-HCl pH 8.0, 1 mM EDTA, 0.5% SDS and 150 mM NaCl) and proteinase K to a final concentration of 1 mg / ml were added to the magnetic bead complex. The mixture was digested at 55°C for 1 hour, and the captured DNA was purified using 1.8×SPRIselect beads according to the instruction manual.

[0049] The purified DNA was dissolved in 18 μL of ddH2O, and 20 μL of 1×KAPA HiFi HotStart ReadyMix and 2 μL of 10 µM P7Rev (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC) were added for extension. The reaction program was 98 °C for 30 seconds, followed by extension at 63 °C for 5 minutes. After the reaction, the DNA was purified using 1.2×SPRIselect™ beads. The purified DNA was dissolved in 1×T4 DNA ligation buffer, 0.5 µM P5 / P5Splint adapter (ACACTCTTTCCCTACACGACGCTCTTCCGATCT; NH2C6-AGATCGGAAGAGC), and 10 U of T4 DNA ligase, and reacted at 25 °C for 30 minutes. After the reaction, the DNA was purified using 1.0×SPRIselect™ beads. DNA was eluted in 20 µl ddH2O, 25 µl KAPA HiFi HotStartReadyMix was added, and 2.5 µl each of 10 μM universal P7 and P5 index primers were added for library amplification. The amplified library was purified using 0.85×SPRIselect™ beads and sequenced. The sequencing data were split and analyzed downstream based on the 5' tag sequence of Read2.

[0050] Example 2 This embodiment uses five peripheral blood samples as an example to illustrate the stability and reliability of the method of the present invention, and the advantages of the present invention in terms of high throughput, low cost and ultra-small sample requirements compared with traditional methods.

[0051] As described in Example 1, samples were labeled, mixed, and then subjected to free nucleosome H3K4me3 modification chromatogram detection. This example used different input volumes (25 μL and 100 μL plasma / chromatogram) and performed simultaneous detection and comparison of each sample using conventional methods. In short, the plasma volume was 1000 μL, directly incubated with the antibody-Pierce™ ChIP-grade Protein A / G Magnetic Beads complex for immunoprecipitation, and then the purified DNA from each sample was used to construct a library.

[0052] The data obtained by the method of this invention, after being split, was analyzed using the same process as traditional methods. Correlation analysis of enriched site distribution and signal intensity showed that the data obtained by the method of this invention and the traditional method exhibited a high degree of consistency, with the correlation of enriched sites reaching 0.9 or higher. Figure 2 and Figure 3 ).

[0053] Mixing multiple samples together for spectral detection can significantly improve detection efficiency while reducing sample input and library construction costs. Figure 4 In this embodiment, the operation time for each spectrum in the method of the present invention is reduced from about 5 hours in the traditional method to about 1 hour, the library construction cost is reduced from about 500 yuan in the traditional method to about 200 yuan, and the plasma input is reduced from 1000 microliters in the traditional method to 25 microliters.

[0054] Example 3 The following illustrates the application of the method of the present invention to the detection of histone modification profiles in peripheral blood of breast cancer.

[0055] This embodiment uses the method of the present invention to detect four histone modifications (H2A.Z, H3K4me3, H3K27ac, and H3K9me3) in the plasma of breast cancer patients (21 cases) and healthy controls (17 cases) to further illustrate the advantages of the method and demonstrate its potential clinical application prospects.

[0056] As described in Example 1, the samples were labeled, mixed, and divided into four portions for detection of free nucleosome histone modifications H2A.Z, H3K4me3, H3K27ac, and H3K9me3. This example yielded a total of 152 plasma free nucleosome histone modification profiles. The increase in sample size and detection factors improved detection efficiency while further reducing detection costs. Figure 5 ).

[0057] First, the unsplit data were analyzed holistically to assess the enrichment effect. The results showed that the obtained enrichment site signals were as expected. Histone markers H2A.Z, H3K4me3, and H3K27ac, representing active promoters or enhancers, were highly enriched at transcription start sites (TSS), while the heterochromatin marker H3K9me3 showed low signal characteristics at transcription start sites. Figure 6 These results demonstrate that the method maintains high stability even with an increased sample size.

[0058] After data splitting, analysis of the length of free nucleosome DNA fragments based on these detection maps revealed significant differences in the length of free DNA associated with different modifications. The median length of these modified free DNA fragments was significantly higher than that of the Input (without immunoprecipitation, i.e., all free DNA in plasma) (P<0.0001, paired t-test). Furthermore, the median length of free DNA associated with H2A.Z, H3K27ac, and H3K9me3 in breast cancer patients was significantly shorter than that in healthy controls (P<0.001, Welch's t-test). A weakly significant difference in the length of free DNA associated with H3K4me3 was also observed between patients and library-constructed samples (P<0.05), while no significant difference was found in the Input data (P>0.05). Figure 7 ).

[0059] Further analysis revealed that the differences in the length of different modified fragments mainly stemmed from the differences in the length of the binucleosome fragments. Figure 8 This difference is also observed at the whole-genome level. Figure 9 Based on genome-wide differential patterns, samples were randomly divided into two groups: a training group and a detection group. A weighted elastic network machine learning model was constructed to establish a classifier. The area under the curve (AUC) results for specificity and sensitivity showed that the H2A.Z and H3K9me3-associated cell-free DNA fragment length classifier had excellent breast cancer detection performance. Figure 10 ).

[0060] Comparative Example The difference between this comparative example and Example 1 is that the reagent used for labeling the plasma samples further includes PEG. The results are as follows: Figure 11 As shown, Figure 11 A visualization example of the H3K4me3 spectra of free nucleosomes detected by the labeling reaction of plasma samples with and without PEG is shown. After H3K4me3 spectra detection of samples with and without PEG, the results showed that the presence of PEG significantly increased the background noise.

[0061] Example 5 This embodiment illustrates a device (or apparatus) for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood, comprising: The sample processing unit is used to perform the following steps: acquiring m plasma samples from the subject, adding a specific nucleic acid tag corresponding to each plasma sample to each plasma sample, and obtaining m labeled samples; A mixing unit is used to perform the following steps: mixing the m labeled samples to obtain a mixed sample; A splitting unit is used to perform the following steps: splitting the mixed sample into n parallel samples based on the characteristics of free nucleosomes; The data processing unit performs the following steps: enriching free nucleosomes in each parallel sample using a specific molecule targeting a feature of the free nucleosome, and separating nucleic acid molecules from the free nucleosomes to obtain n test samples; detecting the nucleic acid sequence information in the n test samples respectively, and obtaining m×n different classification information based on m specific nucleic acid tags and n parallel samples, where m and n each represent an integer greater than 1.

[0062] According to the method for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood according to this embodiment, the specific nucleic acid tag includes a single linker molecule targeting DNA, which preferably includes a tag sequence composed of different bases.

[0063] According to the method for high-throughput ultramicro analysis of free nucleosome information in peripheral blood according to this embodiment, the characteristics of the free nucleosomes are histone characteristics.

[0064] According to the method for high-throughput ultramicro analysis of free nucleosome information in peripheral blood according to this embodiment, the histone features are selected from at least one of acetylation features, methylation features, phosphorylation features, ubiquitination features, SUMOylation features, ADP ribosylation features, propionylation features, and butyrylation features.

[0065] According to the method for high-throughput ultramicro analysis of free nucleosome information in peripheral blood according to this embodiment, the histone is characterized by at least one of H3K4me3, H3K4me2, H3K27ac, H3K27me3, H3K9me3 and H3K36me3.

[0066] According to the method for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood according to this embodiment, the free nucleosome information includes histone information and DNA sequence information, including sequence length information and / or sequence composition information.

[0067] According to the method for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood according to this embodiment, the sample processing unit further includes a labeling reaction system construction unit, wherein the labeling reaction system includes a specific nucleic acid tag and a buffer, but does not include the ligation-promoting reagent PEG.

[0068] According to the method for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood according to this embodiment, the steps performed by the data processing unit further include: constructing libraries and sequencing n test samples respectively to obtain DNA sequence information.

[0069] According to the method for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood according to this embodiment, the steps performed by the data processing unit further include: analyzing free nucleosome information in different subjects.

[0070] Those skilled in the art will understand that the various exemplary embodiments described in this invention can be implemented by software or by combining software with necessary hardware. Therefore, specific embodiments of the invention can be embodied in the form of a software product, which can be stored on a non-volatile storage medium or a non-transitory computer-readable storage medium (such as a CD-ROM, USB flash drive, portable hard drive, etc.) or on a network, including several instructions to cause a computing device (such as a personal computer, server, mobile terminal, or network device, etc.) to execute the method according to the invention.

[0071] In exemplary embodiments, the program product of the present invention can employ any combination of one or more readable media. A readable medium can be a readable signal medium or a readable storage medium. A readable storage medium can be, for example, but not limited to, an electrical, magnetic, optical, electromagnetic, infrared, or semiconductor system, apparatus, or device, or any combination thereof. More specific examples of readable storage media include, but are not limited to: electrical connections having one or more wires, portable disks, hard disks, random access memory (RAM), read-only memory (ROM), erasable programmable read-only memory (EPROM or flash memory), optical fibers, portable compact disk read-only memory (CD-ROM), optical storage devices, magnetic storage devices, or any suitable combination thereof.

[0072] Accordingly, based on the same inventive concept, the present invention also provides an electronic device.

[0073] In an exemplary embodiment, the electronic device is manifested as a general-purpose computing device. Components of the electronic device may include, but are not limited to: at least one processor, at least one memory, and a bus connecting different system components (including the memory and the processor).

[0074] The memory stores program code that can be executed by the processing unit to cause the processing unit to perform the method described in this invention. The processor includes at least the data processing unit (also referred to as a "module") described in this invention. The memory may include readable media in the form of volatile memory cells, such as random access memory (RAM) and / or cache memory cells, and may further include read-only memory (ROM).

[0075] The memory of the present invention may also include a program / utility having a set (at least one) of program modules, including but not limited to: an operating system, one or more application programs, other program modules, and program data, each or some combination of these examples may include an implementation of a network environment.

[0076] A bus can represent one or more of several types of bus structures, including a memory bus or memory controller, a peripheral bus, a graphics acceleration port, a processing unit, or a local bus that uses any of the various bus structures.

[0077] Electronic devices can also communicate with one or more external devices (such as keyboards, pointing devices, Bluetooth devices, etc.), and with one or more devices that enable users to interact with the electronic device, and / or with any device that enables the electronic device to communicate with one or more other computing devices (such as routers, modems, etc.).

[0078] This communication can be achieved through input / output (I / O) interfaces. Furthermore, the electronic device can communicate with one or more networks (e.g., local area networks (LANs), wide area networks (WANs), and / or public networks, such as the Internet) via a network adapter. The network adapter communicates with other modules of the electronic device via a bus. It should be understood that, although not shown herein, other hardware and / or software modules can be used in conjunction with the electronic device, including but not limited to: microcode, device drivers, redundant processing units, external disk drive arrays, RAID systems, tape drives, and data backup storage systems.

[0079] Although the invention has been described with reference to exemplary embodiments, it should be understood that the invention is not limited to the disclosed exemplary embodiments. Various adjustments or changes may be made to the exemplary embodiments described in this specification without departing from the scope or spirit of the invention. The scope of the claims should be interpreted in the broadest possible sense to cover all modifications and equivalent structures and functions.

Claims

1. A method for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood, characterized in that, Includes the following steps: (1) Take m plasma samples from the subjects and add a specific nucleic acid tag corresponding to each plasma sample to each plasma sample to obtain m labeled samples; (2) Mix the m labeled samples to obtain a mixed sample; (3) Based on the characteristics of free nucleosomes, the mixed sample is divided into n parallel samples; (4) In each parallel sample, free nucleosomes are enriched using a specific molecule targeting a feature of the free nucleosome, and nucleic acid molecules are separated from the free nucleosomes to obtain n test samples; (5) Detect the nucleic acid sequence information in the n test samples respectively, and obtain m×n different classification information based on the combination of m specific nucleic acid tags and n parallel samples, where m and n each represent integers greater than 1.

2. The method for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood according to claim 1, characterized in that, The specific nucleic acid tag includes a single linker molecule targeting DNA, which preferably includes a tag sequence composed of different bases.

3. The method for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood according to claim 1, characterized in that, The free nucleosomes are characterized by histone features.

4. The method for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood according to claim 3, characterized in that, The histone features are selected from at least one of acetylation features, methylation features, phosphorylation features, ubiquitination features, SUMOylation features, ADP ribosylation features, propionylation features, and butyrylation features.

5. The method for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood according to claim 3, characterized in that, The histone is characterized by at least one of H3K4me3, H3K4me2, H3K27ac, H3K27me3, H3K9me3, and H3K36me3.

6. The method for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood according to claim 1, characterized in that, The free nucleosome information, histone information, and DNA sequence information include sequence length information and / or sequence composition information.

7. The method for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood according to claim 1, characterized in that, Step (1) includes the construction of a labeling reaction system, wherein the labeling reaction system includes a specific nucleic acid tag and a buffer, but does not include the ligation activator polyethylene glycol.

8. The method for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood according to claim 1, characterized in that, Step (5) includes library construction and sequencing for each of the n test samples to obtain DNA sequence information.

9. The method for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood according to claim 1, characterized in that, Further steps include analyzing free nucleosome information in different subjects.

10. A device for high-throughput ultra-micro analysis of free nucleosome information in peripheral blood, characterized in that, The device includes: a memory, a processor, and an executable program stored in the memory and capable of running on the processor, the executable program being configured to implement the steps of the method according to any one of claims 1-9.

Images