Athenospermia diagnosis marker, application thereof and computer storage medium

Abstract

The invention provides an asthenospermia diagnosis marker, application of the asthenospermia diagnosis marker and a computer storage medium, the asthenospermia diagnosis marker is an ELANE gene, and the CDS sequence of the ELANE gene is shown as NM001972.4. Experiments prove that the expression level of the ELANE gene in the peripheral blood is related to the asthenospermia, meanwhile, the asthenospermia diagnostic kit is provided, the asthenospermia diagnostic kit has the advantages of being high in specificity and sensitivity, the asthenospermia can be rapidly and accurately distinguished through the peripheral blood, and the asthenospermia diagnostic kit can be used for diagnosis of asthenospermia. The asthenospermia detection efficiency can be effectively improved, and the psychological burden of a patient is reduced.

Description

Technical Field

[0001] This invention relates to the field of in vitro diagnostic technology, and more specifically, to a diagnostic marker for asthenospermia, its application, and a computer storage medium. Background Technology

[0002] Asthenospermia is one of the main causes of male infertility. Currently, the clinical diagnosis of asthenospermia relies on routine semen analysis recommended by the World Health Organization, which uses computer-aided sperm analysis systems to assess sperm concentration, motility, and morphology. However, this method still has the following limitations: First, routine semen analysis requires multiple stimulations of the semen sample to meet reliability requirements, which is cumbersome and can cause psychological burden on patients, leading to poor clinical compliance. Second, sperm quality is affected by factors such as the duration of abstinence, lifestyle, and mental stress, resulting in poor stability of test results. In addition, routine semen analysis can only assess sperm quality after the spermatogenesis cycle is completed, and cannot provide early risk warnings for asthenospermia.

[0003] In recent years, with the increasing demand for blood tests to replace routine semen analysis, a series of biomarkers related to asthenospermia have been found that can be used for the diagnosis of asthenospermia. For example, metabolites such as α-hydroxyisovaleric acid have been reported to be associated with infertility. At the same time, DNA methylation analysis has also shown that DNA methylation of spermatogenesis-related genes is associated with male infertility.

[0004] However, existing biomarkers, such as metabolites like α-hydroxyisovalerate, cannot distinguish the specific subtypes of asthenospermia, and almost all biomarkers lack validation, resulting in low diagnostic accuracy. Summary of the Invention

[0005] The purpose of this invention is to provide a new biomarker for the auxiliary diagnosis of asthenospermia.

[0006] To achieve the above objectives, the first aspect of the present invention provides a diagnostic biomarker for asthenospermia, wherein the diagnostic biomarker for asthenospermia is the ELANE gene, and the CDS sequence of the ELANE gene is shown in NM_001972.4.

[0007] This invention is the first to discover that the ELANE gene can be used as a diagnostic marker for asthenospermia. Detecting the expression level of the ELANE gene in peripheral blood can effectively replace traditional semen analysis, reduce the psychological burden of sperm collection for patients, effectively simplify the testing process, and significantly improve the accuracy of the test.

[0008] The second aspect of this invention provides the application of the aforementioned ELANE gene as a biomarker in the preparation of diagnostic products for asthenospermia.

[0009] Preferably, the application diagnoses asthenospermia by detecting the expression level of the ELANE gene in peripheral blood.

[0010] A third aspect of the present invention provides a diagnostic kit for asthenospermia, the diagnostic kit comprising an ELANE gene detection reagent for detecting the ELANE gene.

[0011] Preferably, the ELANE gene detection reagent includes The upstream primer shown in SEQ ID No. 1; The downstream primer shown in SEQ ID No. 2.

[0012] Preferably, the concentration of the upstream primer shown in SEQ ID No. 1 in the amplification system is 0.1~0.3 μM; The downstream primer shown in SEQ ID No. 2 is used in the amplification system at a concentration of 0.1–0.3 μM.

[0013] Preferably, the asthenospermia diagnostic kit further includes RNA extraction reagent, reverse transcription reagent, DNA polymerase, dNTPs, and Mg. 2+ Any one or more of the following: fluorescent dyes.

[0014] The fourth aspect of the present invention provides a computer storage medium storing a calculation program that can determine whether a patient has asthenospermia based on the ELANE gene expression results output by the asthenospermia diagnostic kit described in the third aspect.

[0015] Compared with the prior art, the present invention has the following beneficial effects: 1. The ELANE gene provided by this invention can be used as a diagnostic marker for asthenospermia. Asthenospermia can be determined by detecting its expression level in peripheral blood. It can completely replace traditional semen analysis and has broad application prospects. 2. This invention replaces traditional semen testing with peripheral blood testing, which provides stable and convenient sample acquisition, significantly reducing patient discomfort and improving compliance; 3. The asthenospermia diagnostic kit provided by this invention integrates RNA extraction, reverse transcription and qPCR, which ensures high accuracy of detection while ensuring the stability and reproducibility of test results under different laboratory conditions, and can promote the mutual recognition of test results for the diagnosis of asthenospermia. 4. This invention can predict the risk of abnormalities in the early stages of spermatogenesis by detecting the expression level of the ELANE gene, providing a new approach for the early treatment of asthenospermia. Attached Figure Description

[0016] Figure 1 This is the amplification curve from Example 1 of the present invention; Figure 2 The quantification result of the amplification curve in Example 1 of this invention; Figure 3 The ROC curve analysis results are for the control group and patients with moderate asthenospermia in Example 3 of this invention.

[0017] Figure 4 The results of ROC curve analysis are for the control group and patients with severe asthenospermia in Example 3 of this invention. Detailed Implementation

[0018] To make the above-mentioned objects, features, and advantages of the present invention more apparent and understandable, specific embodiments of the present invention are described in detail below. It should be noted that the following embodiments are only used to illustrate the implementation methods and typical parameters of the present invention, and are not intended to limit the parameter range described in the present invention. Reasonable variations derived therefrom are still within the protection scope of the present invention.

[0019] It should be noted that the endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0020] Unless otherwise defined, all terms, symbols, and other scientific terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In some instances, terms having a conventional meaning are defined herein for clarification or ease of reference, and such definitions should not be construed as indicating a significant difference from conventional understanding in the art. The technical methods described or referenced herein are generally well understood by those skilled in the art and employed by conventional methods. Unless otherwise stated, the use of commercially available kits, reagents, and instruments shall be performed according to the manufacturer's instructions and parameters.

[0021] As described in the background section, existing diagnostic methods for asthenospermia suffer from low accuracy, poor stability, and poor patient compliance.

[0022] In view of this, a specific embodiment of the present invention provides a diagnostic biomarker for asthenospermia, which is the ELANE gene, and the CDS sequence of the ELANE gene is shown in NM_001972.4.

[0023] The elastase gene (ELANE) is a protein-coding gene. Elastases are a subfamily of serine proteases that hydrolyze proteins in neutrophil-specific lysosomes and the extracellular matrix, thereby performing a variety of biological functions. Previous studies have found that ELANE gene mutations play a role in inflammatory diseases such as cyclic neutropenia, severe congenital neutropenia, and acute pancreatitis. In the field of tumor research, the ELANE gene can promote the formation of lung tumors by degrading insulin receptor substrate-1 (IRS-1). In addition, ELANE is also associated with the prognosis of clear cell renal cell carcinoma and endometrial cancer. However, whether ELANE plays a role in reproductive system diseases has not been studied. This invention is the first to discover that the expression level of the ELANE gene in male peripheral blood is associated with asthenospermia.

[0024] Another embodiment of the present invention provides the application of the ELANE gene as a biomarker in the preparation of diagnostic products for asthenospermia.

[0025] In the application of the above embodiments, asthenospermia is diagnosed by detecting the expression level of the ELANE gene in peripheral blood.

[0026] More specifically, a specific embodiment of the present invention provides a diagnostic kit for asthenospermia, the kit comprising an ELANE gene detection reagent for detecting the ELANE gene.

[0027] In the above embodiments, the ELANE gene detection reagent includes... The upstream primer shown in SEQ ID No. 1, SEQ ID No.1:CACTGCGTGGCGAATGTAAA; And the downstream primer shown in SEQ ID No. 2, SEQ ID No. 2: TTGAGCTGGAGAATCACGATGT.

[0028] In the above embodiments, the concentration of the upstream primer shown in SEQ ID No. 1 in the amplification system is 0.1~0.3 μM; The downstream primer shown in SEQ ID No. 2 is used in the amplification system at a concentration of 0.1–0.3 μM.

[0029] In the above embodiments, the asthenospermia diagnostic kit further includes RNA extraction reagent, reverse transcription reagent, DNA polymerase, dNTPs, and Mg. 2+ Any one or more of the following: fluorescent dyes.

[0030] The technical solution of the present invention is further described below through specific embodiments. Unless otherwise defined, all terms, symbols, and other scientific terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In some cases, terms having a conventional meaning are defined herein for clarification or ease of reference, and such definitions should not be construed as indicating a significant difference from the conventional understanding in the art. The technical methods described or referenced herein are generally well understood by those skilled in the art and have been employed by conventional methods. Unless otherwise stated, the use of commercially available kits, reagents, and instruments shall be performed according to the manufacturer's instructions and parameters.

[0031] Example 1 ELANE gene expression level validation First, 1 mL of whole blood was extracted from men diagnosed with severe asthenospermia, men with moderate asthenospermia, and normal men, and RNA was extracted using the TRIzol method.

[0032] Then, prepare the reverse transcription reaction system shown in Table 1 and mix well.

[0033] Table 1 Place the system shown in Table 1 on a regular PCR instrument and set the reverse transcription program shown in Table 2 to perform the reverse transcription reaction and obtain cDNA.

[0034] Table 2 After reverse transcription, the qPCR system shown in Table 3 was prepared, and qPCR amplification was performed using the reaction procedure shown in Table 4.

[0035] Table 3 Table 4 Amplification curves as follows Figure 1 As shown, the qPCR results of the three groups (control, case group, and control group) were quantified, and correlation analysis was performed on the qPCR results. p < 0.05 indicates that the data are statistically significant. The quantitative results are as follows: Figure 2 As shown. By Figure 2The results showed a significant difference in ELANE gene expression levels among the three groups (H(2) = .534, p = 0.023). The rank mean clearly showed a regular trend: the control group had the highest expression level (rank mean = 46.23), followed by the asthenospermia group (32.38), and the severe asthenospermia group had the lowest (31.75). Subsequent pairwise comparisons (Mann-Whitney U test, with Bonferroni correction) showed that the expression level in the asthenospermia group was significantly lower than that in the control group (p = 0.011). Post-hoc analysis showed a significant difference between the severe asthenospermia group and the control group (p = 0.052), indicating a decreasing trend. There was no significant difference in expression levels between the two disease groups (asthenospermia group and severe asthenospermia group) (p > 0.05). More importantly, the Jonckheere-Terpstra trend test yielded a highly significant result (JT=-2.580, p=0.010), strongly demonstrating that the expression level of the ELANE gene shows a significant decreasing trend with the increasing severity of asthenospermia. The results indicate a significant negative correlation between ELANE gene expression and asthenospermia.

[0036] Example 2 Diagnostic energy efficiency assessment First, according to the "Expert Consensus on Etiology and Clinical Diagnosis and Treatment of Asthenospermia (2023)," each sample was assigned a real label, with 0 assigned to healthy individuals and 1 assigned to those with disease.

[0037] Then, the relative expression levels of the ELANE gene in peripheral blood of healthy male samples, samples from patients with moderate asthenospermia, and samples from patients with severe asthenospermia were obtained (2). -ΔΔCT ).

[0038] ROC curve analysis was performed using R Studio software, and the results are as follows: Figure 3 As shown, where, Figure 3 In the figure, A represents the analysis results of patients with moderate asthenospermia, with AUC=0.663. Figure 4 The analysis results for patients with severe asthenospermia were as follows: AUC=0.753. Figure 3 It is evident that the ELANE gene possesses good diagnostic value, exhibiting a sensitivity of 90.3% and a specificity of 40.6% at the optimal cutoff point (CUT OFF = 0.391). Furthermore, Figure 4 The results showed that the ELANE gene demonstrated excellent ability to identify controls and severe asthenospermia cases. At the optimal cutoff point CUT OFF=0.751, the sensitivity was 64.5% and the specificity was 83.3%, suggesting that this indicator may be suitable as an auxiliary screening tool for asthenospermia.

[0039] Furthermore, the results of this study show, as shown in Table 5, that the ELANE gene is significantly correlated with multiple clinical indicators: for example, ELANE is positively correlated with absolute eosinophil count (r=0.390, p=0.001), absolute neutrophil count (r=0.294, p=0.012), and white blood cell count (r=0.291, p=0.012), suggesting that this gene may be involved in granulocyte proliferation or inflammation regulation; ELANE is negatively correlated with alanine aminotransferase (r=-0.199, p=0.014) and aspartate aminotransferase (r=-0.247, p=0.003), reflecting that it may have an indirect regulatory effect on liver function; The positive correlation between ELANE and sperm mitochondrial membrane potential (r=0.158, p=0.047) and the percentage of normal morphology (r=0.283, p=0.001) suggests that it may participate in the regulation of reproductive function by affecting cellular energy metabolism or spermatogenesis. These results provide preliminary evidence for the pleiotropic effects of the ELANE gene in the blood, liver, and reproductive system.

[0040] Table 5 As can be seen from the results of the above embodiments, the expression level of the ELANE gene is closely related to asthenospermia. Using the asthenospermia diagnostic marker and kit provided by this invention to analyze the expression level of the ELANE gene in peripheral blood, the AUC distinguishing asthenospermia patients from healthy men can reach above 0.6, with a sensitivity of 90.3% and a specificity of 40.6%. The AUC distinguishing severe asthenospermia patients from healthy men can reach above 0.7, with a sensitivity of 64.5% and a specificity of 83.3%. The ELANE gene demonstrates high detection accuracy in clinical applications. ELANE gene expression level analysis may replace existing semen analysis, showing broad application prospects and potential.

[0041] While the disclosure is as stated above, its scope of protection is not limited thereto. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of this disclosure, and all such changes and modifications will fall within the protection scope of this invention.

Claims

1. A diagnostic marker for asthenospermia, characterized by, The weak sperm diagnosis marker is an ELANE gene, and the CDS sequence of the ELANE gene is shown in NM_001972.

4.

2. Application of the ELANE gene as a biomarker in the preparation of a weak sperm diagnosis product.

3. Use according to claim 2, wherein the compound is ###0002### The application realizes the diagnosis of weak sperm by detecting the expression level of the ELANE gene in peripheral blood.

4. A diagnostic kit for asthenospermia, characterized by, The ELANE gene detection reagent for detecting the ELANE gene.

5. The asthenospermia diagnostic kit according to claim 4, wherein the antibody is an antibody against the sperm protein 17. The ELANE gene detection reagent comprises an upstream primer shown in SEQ ID No. 1; and a downstream primer shown in SEQ ID No.

2.

6. The weak sperm diagnosis kit of claim 5, wherein the concentration of the upstream primer shown in SEQ ID No. 1 in the amplification system is 0.1-0.3 μM; the concentration of the downstream primer shown in SEQ ID No. 2 in the amplification system is 0.1-0.3 μM.

7. The asthenospermia diagnostic kit according to claim 4, wherein the antibody is an antibody against the sperm protein 17. Further comprising RNA extraction reagent, reverse transcription reagent, DNA polymerase, dNTPs, Mg 2+ , any one or more of the fluorescent dyes.

8. A computer storage medium, characterized in that, The computer storage medium stores a calculation program, and the calculation program can determine whether the patient has weak sperm according to the ELANE gene expression result output by the weak sperm diagnosis kit of any one of claims 4-7.

Images