Recombinant lactobacillus reuteri with anti-helicobacter pylori characteristic as well as construction and application of recombinant lactobacillus reuteri

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to recombinant lactobacillus reuteri with helicobacter pylori resistance as well as construction and application of the recombinant lactobacillus reuteri. The recombinant lactobacillus reuteri is engineered to express a gram-negative bacillus outer membrane penetrating peptide and a helicobacter pylori bacteriophage HP30 splitting system protein Artilysin 2. The recombinant lactobacillus reuteri can inhibit the growth of helicobacter pylori and relieve GES-1 cell inflammation and mouse gastric mucosa inflammation induced by helicobacter pylori ATCC43504, and compared with a wild strain, the recombinant lactobacillus reuteri remarkably improves the helicobacter pylori resisting effect. In addition, the recombinant lactobacillus reuteri can tolerate gastric acid of a mouse and is colonized in gastric mucosa of the mouse, the purpose of remarkably resisting helicobacter pylori by single probiotics is achieved, meanwhile, a new treatment thought is provided for treatment of helicobacter pylori, and a new probiotic therapy is created for treatment of helicobacter pylori.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a recombinant Lactobacillus reuteri with anti-Helicobacter pylori properties and its construction and application. Background Technology

[0002] Helicobacter pylori (H. pylori) is a Gram-negative, spiral-shaped, microaerophilic bacterium primarily found in the human gastric mucosa. It is a major cause of chronic gastritis, peptic ulcers, and gastric cancer. In addition to its effects on the gastrointestinal tract, H. pylori infection is also associated with extra-gastrointestinal diseases; for example, it is linked to an increased risk of vitamin B12 deficiency, metabolic syndrome, non-alcoholic liver disease, and cerebrovascular disease. The 2015 Kyoto Global Consensus Report defined H. pylori infection as an infectious disease; the International Agency for Research on Cancer classified H. pylori as a Group 1 carcinogen for gastric adenocarcinoma; and in 2021, the U.S. Department of Health and Human Services also classified H. pylori as a Group 1 carcinogen. Therefore, H. pylori infection should be treated promptly; the Kyoto Consensus points out that people infected with H. pylori should receive eradication therapy unless there are other special comorbidities; the Maastricht VI / Florence Consensus Report states that eradicating H. pylori before the stage of chronic atrophic gastritis can prevent the occurrence of gastritis and peptic ulcers, and thus prevent the occurrence of gastric cancer.

[0003] Currently, clinical treatment for H. pylori infection is limited to antibiotic therapy. However, the improper use of antibiotics and increasing drug resistance have led to a gradual decline in the eradication rate of H. pylori. Therefore, there is an urgent need to develop new non-antibiotic treatment options. Probiotics can replace antibiotics and eliminate a series of adverse reactions caused by antibiotic treatment; however, the eradication rate of probiotic therapy alone is very low. Studies have found that Lactobacillus reuteri (L. reuteri) has various probiotic properties and can tolerate gastric acid and bile salts. When used in combination with standard treatment regimens, it can improve the eradication rate and reduce the occurrence of adverse reactions. Therefore, L. reuteri can be modified to enhance its anti-H. pylori activity, thereby developing a new non-pharmacological treatment for H. pylori. Summary of the Invention

[0004] To address the aforementioned problems, the present invention aims to construct a recombinant Lactobacillus reuteri with significant anti-Helicobacter pylori characteristics, and to verify its anti-Helicobacter pylori effect through in vitro antibacterial experiments, cell experiments, and animal experiments.

[0005] To achieve the above objectives, this invention modifies the Lactobacillus reuteri standard strain ATCC23272, and performs PCR and WB verification on the constructed recombinant Lactobacillus reuteri (hereinafter referred to as L. reuteri-A2) to obtain the successfully constructed strain.

[0006] The technical solution of this invention:

[0007] In a first aspect, the present invention provides a recombinant Lactobacillus reuteri with anti-Helicobacter pylori properties, which is engineered to express Gram-negative bacillus outer membrane penetration peptide and Helicobacter pylori phage HP30 lysis system protein Artilysin 2.

[0008] Furthermore, the outer membrane penetration peptide of the Gram-negative bacilli is the lactic acid bacteria secretion signal peptide Usp45.

[0009] Furthermore, the encoding sequence of Usp45 is shown in SEQ ID NO:1, and the encoding sequence of Artilysin 2 is shown in SEQ ID NO:2.

[0010] In a second aspect, the present invention provides a method for constructing recombinant Lactobacillus reuteri as described herein, comprising the following steps:

[0011] (1) Construct a recombinant vector containing the Usp45 coding sequence and the Artilysin 2 coding sequence;

[0012] (2) The recombinant vector obtained in step (1) is transformed into Lactobacillus reuteri to obtain recombinant Lactobacillus reuteri with anti-Helicobacter pylori characteristics.

[0013] As used herein, the recombinant vector and the method of transforming it into Lactobacillus reuteri are well known in the art and can be routinely selected by those skilled in the art as needed. For example, the recombinant vector may be the pNZ8148 lactic acid bacteria expression vector, and the transformation method may be electroporation.

[0014] In a third aspect, the present invention provides culture supernatants, fermentation supernatants and / or intracellular contents of recombinant Lactobacillus reuteri as described herein.

[0015] Methods for obtaining culture supernatant, fermentation supernatant and / or intracellular contents from recombinant Lactobacillus reuteri are well known in the art and can be routinely selected by those skilled in the art as needed.

[0016] In a fourth aspect, the present invention provides an anti-Helicobacter pylori reagent or drug comprising recombinant Lactobacillus reuteri or its culture supernatant, fermentation supernatant and / or intracellular contents as described herein.

[0017] Furthermore, the reagent or drug may also include pharmaceutically acceptable excipients.

[0018] In a fifth aspect, the present invention provides a health food product for treating Helicobacter pylori, comprising recombinant Lactobacillus reuteri or its culture supernatant, fermentation supernatant and / or intracellular contents as described herein.

[0019] Furthermore, the health food also includes food-acceptable excipients.

[0020] Furthermore, the dosage form of the reagent or drug or the health food includes any one of the following: powder, tablet, injection, oral liquid, suppository, gel, patch, spray, lotion, and granule.

[0021] In a sixth aspect, the present invention provides a method for inhibiting Helicobacter pylori for the purpose of non-disease diagnosis and treatment, comprising using recombinant Lactobacillus reuteri or its culture supernatant, fermentation supernatant and / or intracellular substances as described herein to inhibit Helicobacter pylori.

[0022] In a seventh aspect, the present invention provides the use of recombinant Lactobacillus reuteri or its culture supernatant, fermentation supernatant and / or intracellular contents as described herein in the preparation of anti-Helicobacter pylori pharmaceuticals or health foods.

[0023] In an eighth aspect, the present invention provides the use of recombinant Lactobacillus reuteri or its culture supernatant, fermentation supernatant and / or intracellular contents as described herein in the preparation of a medicament or health food for Helicobacter pylori-induced gastric cancer.

[0024] Beneficial effects of the invention

[0025] The supernatant of *L. reuteri-A2* of this invention significantly inhibits the growth of *Helicobacter pylori* ATCC43504 and clinically resistant strains. Compared with the wild-type strain, *L. reuteri-A2* of this invention significantly alleviates *Helicobacter pylori* ATCC43504-induced GES-1 cell inflammation. *L. reuteri-A2* of this invention can colonize the gastric mucosa of mice and, compared with the wild-type strain, better alleviates *Helicobacter pylori* ATCC43504-induced gastric mucosal inflammation in mice. Attached Figure Description

[0026] Figure 1 This is a diagram of the carrier construction strategy in Example 1.

[0027] Figure 2 This is a gene-level verification diagram of L. reuteri-A2 in Example 3.

[0028] Figure 3 This is a protein-level verification diagram of L. reuteri-A2 in Example 3.

[0029] Figure 4 This is a diagram showing the inhibition zones of L. reuteri-A2 supernatant against ATCC43504 and clinically resistant strains in Example 4.

[0030] Figure 5 This is a graph showing the relative mRNA levels of TNF-α, IL-1β, and IL-6 in each group of cells treated with L. reuteri in Example 5.

[0031] Figure 6 This is a diagram showing the colonization of L. reuteri-A2 in the gastric mucosa of C57BL / 6 mice in Example 6.

[0032] Figure 7 These are H&E staining images of the stomach tissues of mice in each group in Example 6. Detailed Implementation

[0033] The present invention will be further illustrated below with reference to specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field.

[0034] The Helicobacter pylori ATCC43504 involved in the following examples was preserved by the Key Laboratory of Digestive Diseases of the Second Hospital of Lanzhou University. The metronidazole-resistant strain, metronidazole + levofloxacin-resistant strain, and metronidazole + levofloxacin + clarithromycin-resistant strain of Helicobacter pylori were also preserved by the Key Laboratory of Digestive Diseases of the Second Hospital of Lanzhou University. The Lactobacillus reuteri ATCC23272 and pNZ8148 lactic acid bacteria expression vectors were donated by the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences.

[0035] The human gastric epithelial cell line GES-1 involved in the following examples was purchased from Guangzhou Saiku Biotechnology Co., Ltd.; the experimental animals used in the experiments were male SPF-grade wild-type C57BL / 6 mice aged 6-8 weeks and weighing 20±2g, purchased from Lanzhou Veterinary Research Institute of Chinese Academy of Agricultural Sciences, and bred at the SPF-grade Animal Center of the Second Hospital of Lanzhou University.

[0036] The solution formulations involved in the following examples are as follows:

[0037] MRS solid culture medium: Weigh 6.73g of culture medium powder, dissolve it in 100mL of ultrapure water, autoclave at 121℃ for 15min.

[0038] MRS broth: Weigh 5.24g of culture medium powder, dissolve it in 100mL of ultrapure water, autoclave at 121℃ for 15min.

[0039] H. pylori solid culture medium: Dissolve 4.4 g of Columbia blood agar in 100 mL of ultrapure water, autoclave at 121 °C for 30 min, place in a biosafety cabinet, and when the temperature drops to about 50 °C at room temperature, aseptically add 7 mL of sterile defibrinated sheep blood (7% concentration).

[0040] H. pylori liquid culture medium: Weigh 3.85g of brain heart extract (BHI) broth, dissolve it in 100mL of ultrapure water, autoclave at 121℃ for 30min, place in a biosafety cabinet, and when the temperature drops to about 50℃ at room temperature, aseptically add 10mL of fetal bovine serum (10% concentration).

[0041] MRS weakened cell wall liquid culture medium: Weigh 5.24g of culture medium powder, dissolve it in 100mL of pure water, autoclave at 121℃ for 15min, cool to room temperature, add 4g of glycine, and filter sterilize using a 0.22μm filter membrane.

[0042] Washing buffer a: Mix 10 mL of 100% glycerol with 90 mL of ultrapure water, autoclave at 121 °C for 15 min.

[0043] Washing buffer b: Weigh 17.1g sucrose, 4.76mg MgCl2, and 68mg KH2PO4, dissolve them in 100mL ultrapure water, stir and mix well, and then filter through a 0.22μm filter membrane for sterilization.

[0044] MRS resuscitation medium: Dissolve 0.05 mol sucrose, 2 mmol MgCl2, and 0.2 mmol CaCl2 solution in 100 ml MRS broth and sterilize by filtration through a 0.22 μm filter membrane.

[0045] The following examples involve the resuscitation and culture methods of L. reuteri and H. pylori:

[0046] Resuscitation and culture of L. reuteri: After thawing the L. reuteri strain stored at -80℃ on ice, use a sterile inoculation loop to dip the thawed bacterial solution and spread it on MRS solid medium. Incubate under anaerobic conditions at 37℃ for 24 hours and observe the growth of the strain. After the growth of visible milky white colonies, pick a single colony and inoculate it on MRS liquid medium for further culture.

[0047] Resuscitation and culture of H. pylori: After thawing the H. pylori strain stored at -80℃ on ice, mix it thoroughly by pipetting with a micropipette, and then drop 200 μL of the bacterial suspension onto H. pylori solid medium. Spread the suspension with a sterile inoculation loop and incubate at 37℃ under microaerophilic conditions (5% O2, 10% CO2, 85% N2) for 72 h. Observe the growth of the strain. After the growth of translucent pinhead-shaped colonies that are visible to the naked eye, pick a single colony and inoculate it into H. pylori liquid medium for further culture.

[0048] The method for preparing L. reuteri supernatant in the following examples is as follows:

[0049] Preparation of L. reuteri supernatant: Take L. reuteri and L. reuteri-A2 bacterial cultures, and after they grow to the logarithmic phase, add NisinA to induce expression for 12 h. Adjust OD600 to 1 using MRS liquid medium, centrifuge at 12000 rpm for 2 min at 4℃, collect the supernatant, filter it through a 0.22 μm filter membrane, and store the L. reuteri and L. reuteri-A2 supernatant for later use.

[0050] Example 1: Design and synthesis of the target gene

[0051] To improve the targeting of H. pylori killing, the outer membrane penetration peptide of Gram-negative bacilli (lactobacterial secretion signal peptide Usp45) was selected as the target gene, linked to the lysis system of H. pylori phage HP30 (Artilysin 2). A His-tag was inserted to facilitate subsequent validation of the target protein. The tag and the target gene were synthesized into the pNZ8148 lactic acid bacteria expression vector. The vector construction strategy is as follows: Figure 1 In the constructed vector, the encoding sequences of Usp45 and Artilysin 2 are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0052] Example 2: Electroporation of recombinant Lactobacillus reuteri-A2

[0053] (1) Take L. reuteri out of the -80℃ refrigerator, thaw it at room temperature, dip the inoculation loop into the bacterial solution, streak it on the MRS solid plate, and anaerobic culture at 37℃ until a single colony grows.

[0054] (2) In a biosafety cabinet, pick a single colony from the above plate and transfer it to 10 mL of MRS liquid medium. Incubate at 37°C for 12 h.

[0055] (3) Take 1.6 mL of the above bacterial culture and transfer it to 40 mL of LMR (Limited MRS) cell wall weakening medium. Incubate at 37°C until the OD600 value is about 0.7.

[0056] (4) The above bacterial solution was centrifuged at 4℃ and 5000 rpm for 10 min, the supernatant was discarded and the bacterial precipitate was retained;

[0057] (5) Add 5 mL of washing buffer a to the above bacterial precipitate, resuspend the bacterial cells, centrifuge at 4°C and 5000 rpm for 10 min, discard the supernatant, retain the bacterial precipitate, and repeat the above steps once.

[0058] (6) Resuspend the above bacterial cells with 2 mL of washing buffer b, aliquot competent cells and store at -80°C.

[0059] (7) Take out E. coli TOP 10 strain from the ultra-low temperature freezer, thaw at room temperature, dip the inoculation loop into the bacterial solution, streak on chloramphenicol-resistant LB solid medium, and incubate overnight at 37°C. The next day, pick a single colony from the plate and inoculate it into chloramphenicol-resistant LB liquid medium. Incubate overnight at 37°C and 200 rpm. Extract plasmids from the collected bacterial solution according to the instructions of the Tiangen endotoxin-free plasmid small-scale extraction kit.

[0060] (8) Take out the L. reuteri competent cells stored in the -80℃ freezer and the recombinant plasmid pNZ8148-A2 stored in the -20℃ freezer, thaw them in an ice bath, and take out the prepared electric transfer cup (0.2cm) for pre-cooling.

[0061] (9) Use a pipette to transfer competent cells to an electroporation cuvette. Take 10 μL of recombinant plasmid pNZ8148-A2 into the electroporation cuvette, mix gently, and incubate on ice for 25 min. The above operations are performed in a biosafety cabinet.

[0062] (10) Turn on the electroporator, wipe the moisture off the outer wall of the transducer, and perform an electric shock at a voltage of 2.5kV and a time of 5ms under the conditions of resistance of 200Ω and capacitance of 25μF. After the electric shock, quickly add 1mL of MRS resuscitation medium to the transducer in the biosafety cabinet.

[0063] (11) In a biosafety cabinet, the solution in the above electroporation cup was transferred to a 1.5 mL sterile EP tube, and after recovery at 37°C for 2 h, it was spread on a chloramphenicol-resistant MRS solid plate. After anaerobic culture at 37°C for 48 h, positive transformants were picked, which were recombinant Lactobacillus reuteri-A2. After expansion culture, it was stored in a -80°C refrigerator.

[0064] Example 3: PCR and Western blot verification of L. reuteri-A2

[0065] (1) Take out the L. reuteri-A2 and empty L. reuteri stored in the -80℃ refrigerator, thaw them at room temperature, dip the inoculation loop into the bacterial suspension, streak on the 20μg / mL chloramphenicol-resistant MRS solid plate, and anaerobic culture at 37℃. After the single colony grows, inoculate it into MRS broth containing 20μg / mL chloramphenicol resistance, anaerobic culture at 37℃ for 24h, take 5mL of bacterial suspension, centrifuge and discard the supernatant, treat with lysozyme for 30min and then extract the plasmid.

[0066] (2) Using the extracted plasmid as a template, PCR identification was performed. Universal primers for the pNZ8148 vector and specific primers for the target gene were selected for PCR reactions. The PCR products were then gelled on an agarose gel. The PCR identification primer sequences were as follows: universal primer F: CGATACGCGAGCATAATAAACG, universal primer RAGCACACGTGCTGTAATTTG, target gene specific primer F: AGGCACTCACCATGAAGAAG, target gene specific primer R: AATGGTGATGGTGATGGTGT; the PCR reaction system was as follows: 20 μL of TaKaRa Taq Version 2.0, 1 μL each of 10 μM upper and lower primers, 1 μL of plasmid template, and 22 μL of ddH2O; the PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; then 30 cycles of 95℃ for 30 s, 55℃ for 30 s, and 72℃ for 1 min, followed by a final extension at 72℃ for 10 min.

[0067] (3) Take out the recombinant Lactobacillus reuteri-A2 and empty L. reuteri stored in the -80℃ freezer, thaw them at 37℃, dip the thawed bacterial solution with the inoculation loop, spread it on the chloramphenicol-resistant MRS solid plate, and anaerobic culture at 37℃ until single colonies grow.

[0068] (4) Pick a single colony from the above plate and transfer it to chloramphenicol-resistant MRS liquid medium. Incubate at 37°C for 12 hours. Use a pipette to take 1.6 mL of the above bacterial solution and transfer it to 40 mL of chloramphenicol-resistant MRS liquid medium. Incubate at 37°C until the logarithmic phase.

[0069] (5) Add 5 ng / mL of the inducer NisinA to the above logarithmic phase bacterial culture, continue anaerobic culture at 37℃, and extract protein after 12 h of culture.

[0070] (6) Take 40 mL of each of the induced L.reuteri-A2(pNZ8148-A2) and L.reuteri(pNZ8148) bacterial suspensions, centrifuge at 4℃ and 12000 rpm for 10 min, discard the supernatant and collect the bacterial cells.

[0071] (7) Add 10 mL of PBS to the above bacterial cells, resuspend the bacterial cells, and centrifuge at 4 °C and 12000 rpm for 10 min to wash the bacterial cells. Wash twice and retain the bacterial cells.

[0072] (8) Add 20 mg of lysozyme to the above bacterial cells, mix by pipetting, and incubate in a water bath at 37°C for 30 min; after lysis, incubate the cells in an ultrasonic cell disruptor for 20 min; after cell disruption, transfer the cells to a 1.5 mL EP tube and centrifuge in a high-speed refrigerated centrifuge at 4°C and 12,000 rpm for 15 min.

[0073] (9) The supernatant obtained by centrifugation was transferred to a new 1.5 mL EP tube, protein loading buffer was added, and the tube was boiled in a constant temperature metal bath at 100 °C for 10 min. The obtained protein was verified by WB using His-Tag tag antibody.

[0074] Figure 2 To validate L. reuteri-A2 at the gene level, plasmids were extracted and amplified using universal primers for the vector and specific primers for the target gene. Agarose gel electrophoresis showed bands of corresponding sizes in both cases. The empty plasmid was 3167 bp. Figure 2 1 lane), recombinant plasmid 3811bp ( Figure 2 2 lanes), universal primers for vector identification 879bp ( Figure 2 4 lanes), target gene-specific primers were used to identify 696 bp ( Figure 2 (5 lanes); Figure 3 To validate the protein level, L. reuteri-A2 bacterial protein was extracted, and a 26.8 kDa recombinant protein band was observed by Western blotting. Figure 3 (lanes 2 and 4)

[0075] Example 4: Paper disc diffusion method for drug sensitivity testing

[0076] (1) Take 1 mL of each H. pylori bacterial suspension and adjust the bacterial concentration to 2 McFarland units (about 6 × 10⁸ CFU / mL) in a biosafety cabinet using a turbidity tube. Take 100 μL and spread it evenly on a Columbia blood agar plate and place it on the work surface for later use.

[0077] (2) Take 1 mL of each of the prepared L.reuteri and L.reuteri-A2 supernatant and soak a 6 mm diameter sterile blank drug sensitivity paper disc in it for 2 min.

[0078] (3) Use sterile tweezers to pick out the soaked drug sensitivity paper, and after it dries, carefully stick it onto the Columbia blood agar plate in step (1) and incubate at 37°C, 5% O2, and 10% CO2 for 72 hours.

[0079] (4) Observe the size of the inhibition zone of Helicobacter pylori ATCC43504, metronidazole single-drug resistant strain (M-resistant), metronidazole + levofloxacin dual-drug resistant strain (M+L-resistant), and metronidazole + levofloxacin + clarithromycin triple-drug resistant strain (M+L+C-resistant).

[0080] (5) Repeat the above steps twice for each plate, measure the size of the inhibition zone, and take photos to save the photos.

[0081] Table 1: Inhibition zone diameter of L. reuteri-A2 supernatant on ATCC43504

[0082]

[0083] Table 2: Diameter of inhibition zone of L. reuteri-A2 supernatant against clinically resistant strains

[0084]

[0085] Figure 4 As can be seen, the supernatant of L. reuteri-A2 showed significant inhibition zones against both the standard strain and the clinically resistant strain of H. pylori, indicating that the introduction of the target gene Artilysin 2 enhanced the inhibitory effect of the wild-type strain on H. pylori. Furthermore, the constructed recombinant strain L. reuteri-A2 exhibited even better antibacterial activity against H. pylori. The diagrams show: A: inhibition zone of ATCC43504; B: inhibition zone of metronidazole-resistant strain; C: inhibition zone of metronidazole + levofloxacin-resistant strain; D: inhibition zone of metronidazole + levofloxacin + clarithromycin-resistant strain; 1: L. reuteri-A2 supernatant; 2: PBS; 3: L. reuteri supernatant; M: metronidazole control; L: levofloxacin; C: clarithromycin.

[0086] Example 5: L. reuteri-A2 alleviates H. pylori-induced inflammation in GES-1 cells

[0087] (1) GES-1 cells were seeded in 6-well plates at a concentration of 20,000 cells / 2 mL. H. pylori intervention group, L. reuteri intervention group, and L. reuteri-A2 intervention group were set up and the cells were cultured for 24 h.

[0088] (2) Take the H. pylori, L. reuteri and L. reuteri-A2 bacterial suspensions after expansion culture, adjust the concentration to 2×107 CFU / mL, take 1 mL of each, centrifuge at 4℃ and 5000 rpm for 5 min, and discard the supernatant.

[0089] (3) Wash the bacterial cells twice with sterile PBS buffer, discard the supernatant, and resuspend the bacterial cells in 1 mL of antibiotic-free cell culture medium (containing 10% fetal bovine serum);

[0090] (4) After the cells adhered to the culture medium, the supernatant was discarded. The control group was set up with 2 mL of cell culture medium and cultured for 2 h. The infection group was set up with 1 mL of H. pylori resuspended in cell culture medium and 1 mL of cell culture medium and cultured for 2 h. The L. reuteri intervention group was set up with 1 mL of H. pylori resuspended in cell culture medium and cultured for 1 h, followed by 1 mL of L. reuteri resuspended in cell culture medium. The L. reuteri A2 intervention group was set up with 1 mL of H. pylori resuspended in cell culture medium and cultured for 1 h, followed by 1 mL of L. reuteri-A2 resuspended in cell culture medium.

[0091] (5) After the culture time is up, collect bacteria and cells, extract RNA, and determine the expression levels of TNF-α, IL-1β and IL-6 by qRT-PCR.

[0092] Table 3: Primer names and sequences for qRT-PCR reactions

[0093]

[0094] Figure 5 As can be seen, after H. pylori infection of GES-1 cells, the expression levels of TNF-α, IL-1β, and IL-6 were significantly increased. After L. reuteri treatment, the relative expression levels of TNF-α, IL-1β, and IL-6 were significantly decreased. After L. reuteri-A2 treatment, the TNF-α and IL-6 cytokine levels decreased more significantly, returning to levels indistinguishable from the normal group.

[0095] Example 6: Colonization of L. reuteri-A2z in mouse gastric mucosa and relief of H. pylori-induced inflammation in mice

[0096] L. reuteri-A2 colonization in mouse gastric mucosa: Six- to eight-week-old male C57 / BL6 mice were randomly divided into a control group and an L. reuteri-A2 group (n=6). The control group was given 200 μL of sterile PBS buffer by gavage, while the L. reuteri-A2 group was given L. reuteri-A2 solution (1×10⁹ CFU / mL) by gavage. The gavage was continued for 5 days. The mice were sacrificed 3 days later, and the colonization of L. reuteri-A2 was observed by immunofluorescence.

[0097] H. pylori infection mouse model: Male C57 / BL6 mice were administered 200 μL of H. pylori solution (1×10⁹ CFU / mL) by gavage every other day for two weeks. Three weeks after infection, H&E staining was used to detect infection status. The infected C57BL / 6 mice were then randomly divided into 5 groups (n=6): Control group, H. pylori group, L. reuteri group, L. reuteri-A2 group, and Triple Therapy group. The H. pylori group was administered 200 μL of sterile PBS by gavage, the L. reuteri group was administered 200 μL of L. reuteri solution (1×10⁹ CFU / mL) by gavage, the L. reuteri-A2 group was administered 200 μL of L. reuteri-A2 solution (1×10⁹ CFU / mL) by gavage, and the Triple Therapy group... The Therapy group was administered omeprazole 0.6 mg / (kg / d), clarithromycin 15 mg / (kg / d), and amoxicillin 50 mg / (kg / d) by gavage for 2 consecutive weeks. The Control group was administered 200 μL of sterile PBS buffer by gavage throughout the entire course of treatment. After gavage, the mice were sacrificed and gastric tissue was collected for H&E staining and observation.

[0098] Figure 6 As can be seen, after L. reuteri-A2 was administered by gavage, the intensity of red fluorescence in the gastric mucosa was significantly higher than that in the control group, indicating that L. reuteri-A2 can tolerate gastric acid in mice and colonize the gastric mucosa of mice.

[0099] Figure 7 As can be seen, H. pylori infection in mice resulted in damage, interruption, and discontinuity of the gastric mucosa, with some mucosal thickening and extensive submucosal inflammatory cell infiltration. L. reuteri treatment resulted in partial repair of the gastric mucosa, but extensive inflammatory cell infiltration remained. Triple therapy failed to repair the gastric mucosa and extensive inflammatory cell infiltration persisted. In contrast, L. reuteri-A2 treatment resulted in gastric mucosal repair and a significant reduction in inflammatory cell infiltration.

[0100] It should be noted that while the preferred embodiments of the present invention are given in the specification and accompanying drawings, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. These embodiments are not intended to impose additional limitations on the content of the present invention; their purpose is to provide a more thorough and comprehensive understanding of the disclosure of the present invention. Furthermore, the above-described technical features can be combined with each other to form various embodiments not listed above, all of which are considered to be within the scope of the present invention specification. Moreover, those skilled in the art can make improvements or modifications based on the above description, and all such improvements and modifications should fall within the protection scope of the appended claims.

Claims

1. A recombinant Lactobacillus reuteri with anti-Helicobacter pylori properties, characterized in that, The recombinant Lactobacillus reuteri was engineered to express Gram-negative bacillus outer membrane penetration peptide and Helicobacter pylori phage HP30 lysis system protein Artilysin 2.

2. The recombinant Lactobacillus reuteri according to claim 1, characterized in that, The outer membrane penetration peptide of the Gram-negative bacilli is the lactic acid bacteria secretion signal peptide Usep45.

3. The recombinant Lactobacillus reuteri according to claim 2, characterized in that, The encoding sequence of Usp45 is shown in SEQ ID NO: 1, and the encoding sequence of Artilysin 2 is shown in SEQ ID NO:

2.

4. A method for constructing recombinant Lactobacillus reuteri according to any one of claims 1-3, characterized in that, Includes the following steps: (1) Construct a recombinant vector containing the Usp45 coding sequence and the Artilysin 2 coding sequence; (2) The recombinant vector obtained in step (1) is transformed into Lactobacillus reuteri to obtain recombinant Lactobacillus reuteri with anti-Helicobacter pylori characteristics.

5. The culture supernatant, fermentation supernatant and / or intracellular contents of recombinant Lactobacillus reuteri according to any one of claims 1-3.

6. A reagent or drug for treating Helicobacter pylori, characterized in that, Includes recombinant Lactobacillus reuteri according to any one of claims 1-3 or culture supernatant, fermentation supernatant and / or intracellular contents according to claim 5.

7. A health food product for treating Helicobacter pylori, characterized in that, Includes recombinant Lactobacillus reuteri according to any one of claims 1-3 or culture supernatant, fermentation supernatant and / or intracellular contents according to claim 5.

8. A method for inhibiting Helicobacter pylori for non-disease diagnosis and treatment purposes, characterized in that, Helicobacter pylori was inhibited using recombinant Lactobacillus reuteri according to any one of claims 1-3 or culture supernatant, fermentation supernatant and / or intracellular material according to claim 5.

9. The use of recombinant Lactobacillus reuteri according to any one of claims 1-3 or the culture supernatant, fermentation supernatant and / or intracellular contents according to claim 5 in the preparation of anti-Helicobacter pylori drugs or health foods.

10. The use of recombinant Lactobacillus reuteri according to any one of claims 1-3 or the culture supernatant, fermentation supernatant and / or intracellular material according to claim 5 in the preparation of a drug or health food for Helicobacter pylori-induced gastric cancer.

Images