Application of GH5GH6 dual-catalytic structural domain compound enzyme in cellulose degradation
By applying the GH5_GH6 dual-catalytic domain complex enzyme, the problems of insufficient efficiency and stability in existing enzymatic cellulose degradation methods have been solved, achieving efficient and stable cellulose degradation in industrial environments.
Patent Information
- Application Number
- CN202511729311.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2025-01-13
- Filing Date
- 2025-11-24
- Publication Date
- 2026-02-17
AI Technical Summary
Existing enzymatic cellulose degradation methods suffer from insufficient degradation efficiency and stability in industrial applications. Single GH5 or GH6 enzyme systems are inefficient during long-term reactions, making it difficult to achieve efficient and continuous cellulose degradation.
The GH5_GH6 dual-catalytic domain complex enzyme, derived from the symbiotic bacterium Teredinibacter, was amplified by PCR and inserted into an expression vector for efficient expression and purification, forming a fusion gene sequence of GH5, CBM and GH6, suitable for different industrial environments.
It significantly improves cellulose degradation efficiency and stability, adapts to a wide range of temperatures and pH, is suitable for industrial conditions, and its synergistic effect significantly enhances the degradation capacity of enzymes.
Smart Images
Figure CN121538201A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to cellulase technology in the field of enzymology. More specifically, it relates to the application of a GH5_GH6 dual-catalytic domain complex enzyme (containing glycoside hydrolase family 5 (GH5) and glycoside hydrolase family 6 (GH6)) in cellulose degradation. Background Technology
[0002] Cellulose is one of the most abundant biomass resources on Earth and an important source of biomass energy. It is estimated that the total amount of cellulose produced globally each year through photosynthesis reaches 1 to 1.1 billion tons. However, cellulose is a linear polymer composed of glucose molecules linked by β-1,4 glycosidic bonds. Its highly crystalline structure makes it difficult for microorganisms or other organisms to utilize it directly. Therefore, the degradation of cellulose usually requires physical, chemical, or enzymatic methods to break it down into smaller sugars before it can be further utilized. Compared to traditional acid-base treatment methods, enzymatic degradation of cellulose, due to its pollution-free and low-energy consumption characteristics, is gradually becoming a more sustainable option and has shown broad application potential in various fields such as food, medicine, and environmental protection.
[0003] Despite this, the application of existing enzymatic methods in cellulose degradation still faces several challenges, especially in industrial applications, where the degradation efficiency and stability of enzymes often fail to meet the demands for efficient cellulose degradation. Cellulose degradation primarily relies on the synergistic work of different types of enzymes. For example, the GH5 domain belongs to the GH family of glycosidases, which can randomly cleave the middle of the cellulose chain to generate oligosaccharides, a process that plays a crucial role in the initial stages of cellulose degradation. The GH6 domain, on the other hand, belongs to the exoglycosidase family, which can cleave from the non-reducing end of the cellulose chain, releasing monosaccharides (such as glucose) to provide feedstock for subsequent fermentation. However, single GH5 or GH6 enzyme systems still have many shortcomings in terms of degradation efficiency, stability, and synergistic catalytic processes. Currently, some studies have attempted to use single-enzyme systems for cellulose degradation. Although GH5-type glycosidases show good cleavage effects in the initial stages of cellulose degradation, their stability and degradation efficiency remain low over long periods. While GH6-type enzymes can effectively release monosaccharides, they suffer from slow catalytic rates and low reaction efficiency during degradation. Therefore, single enzyme systems often cannot achieve efficient and continuous degradation in industrial applications.
[0004] Therefore, there is an urgent need for a new solution to improve the degradation of cellulose through a more efficient and stable complex enzyme system, especially in the fields of biomass energy production, agricultural waste treatment and environmental protection, to provide more sustainable and economical technical support for efficient cellulose degradation. Summary of the Invention
[0005] The purpose of this invention is to provide a GH5-GH6 dual-catalytic domain complex enzyme (shipworm symbiont). Teredinibacter Applications of cellulose degradation (cellulose degradation in waste treatment, biofuel production and pulp industry) isolated from the genus containing GH5, CBM and GH6 domain complex enzymes.
[0006] To achieve the above objectives, the present invention adopts the following technical solution: Application of a GH5-GH6 dual-catalytic domain complex enzyme in cellulose degradation.
[0007] The GH5_GH6 dual-catalytic domain complex enzyme is derived from the shipworm symbiotic bacteria.
[0008] The shipworm symbiotic bacteria are known strains. Teredinibacter Genus species, especially Teredinibacter turnerae strains.
[0009] Specifically, the GH5_GH6 dual-catalytic domain complex enzyme was obtained as follows: (1) From the symbiotic bacteria of shipworms ( Teredinibacter The fusion gene sequence of the GH5_GH6 dual catalytic domain was amplified by PCR technology in the genus *Shippus*. Genomic extraction technology was used to extract the symbiotic bacteria of *Shippus* (in the genus *Shippus*). Teredinibacter turnerae (Taking GH5 as an example) Genomic DNA was amplified by PCR using specific primers (including GH5 domain forward primer, GH5 domain reverse primer, CBM2 domain forward primer, CBM2 domain reverse primer, GH6 domain forward primer and GH6 domain reverse primer) to directly obtain the fusion gene sequence containing GH5, CBM and GH6.
[0010] Primers specifically include: The GH5 domain forward primer (GH5-F) sequence is 5'-ATGCGGAAGATAAACAAGCAGAAGCC-3' (SEQ ID NO:1), located at the beginning of the GH5 domain (near the start position 42 of the sequence).
[0011] The reverse primer (GH5-R) sequence for the GH5 domain is 5'-GCCGACCTGAACCTGACCGACCTGA-3' (SEQ ID NO:2), located at the end of the GH5 domain, near the junction with the CBM2 domain.
[0012] The CBM2 domain forward primer (CBM2 aF) sequence is 5'-TCAGTCGGTCAGGTTCAGGTCGGC-3' (SEQ ID NO:3), located in the junction region between GH5 and CBM2.
[0013] The reverse primer (CBM2 bR) sequence for the CBM2 domain is 5'-CAGGTCGTCGAGCTGCAGGTCTTC-3' (SEQ ID NO:4), located at the end of the CBM2 domain (sequence end is 697).
[0014] The GH6 domain forward primer (GH6-F) sequence is 5'-GAAGACCTGCAGCTCGACGACCTG-3' (SEQ ID NO:5), located in the connection region between CBM2 and GH6 (sequence start position 793).
[0015] The reverse primer (GH6-R) sequence for the GH6 domain is 5'-GTAGTGTGTGAAGTGACCTATGTG-3' (SEQ ID NO: 6), located at the end of the GH6 domain (sequence end position 1127).
[0016] (2) Insert the fusion gene into the expression vector: The amplified fusion gene sequence is inserted into a suitable expression vector (such as the pET series vectors) using the Gibson assembly method. The vector selection is characterized by high-efficiency expression, enabling high-level protein expression in hosts such as E. coli.
[0017] (3) Expression of the fusion protein induced by IPTG at 37℃: As a general implementation method, induction can be performed at, for example, 37°C. To obtain a higher proportion of soluble protein, the preferred induction conditions are 16°C for 18 hours, and these conditions can be optimized as needed. The expression of the fusion protein is induced by adding IPTG (isopropyl-β-D-thiogalactoside). The induction concentration and time will be optimized according to experimental conditions to ensure efficient expression of the fusion protein.
[0018] (4) The fusion protein was purified using affinity chromatography (such as nickel column purification) and gel filtration chromatography to obtain the complex enzyme: The expressed fusion protein was initially purified by affinity chromatography (e.g., His-tag affinity purification using a nickel column), followed by further purification using gel filtration chromatography to obtain a high-purity GH5_GH6 dual-catalytic domain complex enzyme.
[0019] The GH5_GH6 dual-catalytic domain complex enzyme sequence is shown in SEQ ID NO:7 (full length 3573 bp), encoding the natural protein sequence SEQ ID NO:8 (1190 aa). The precise composition and boundary definition of each domain are shown in the "Domain Composition" section below.
[0020] Application of the GH5_GH6 dual-catalytic domain complex enzyme in the degradation of waste.
[0021] The waste is agricultural waste, waste paper or pulp from the papermaking industry.
[0022] A multifunctional enzyme complex for degrading fibers, the complex containing shipworm symbiotic bacteria ( Teredinibacter The GH5_GH6 dual catalytic domain sequence of the genus is shown in SEQ ID NO: 7.
[0023] Domain composition Precise definition based on natural sequences (verified by BLAST comparison with the CAZy database and Phyre2 structure): (1) GH5 catalytic domain: nucleotide position 79-984 bp (corresponding to amino acid 27-328 aa), containing a complete β-glucan hydrolysis active center; (2) CBM2a binding domain: nucleotide position 1129-1422 bp (amino acids 377-474 aa), specifically binds to microcrystalline cellulose; (3) CBM2b binding domain: nucleotide position 1828-2115 bp (amino acids 610-705 aa), its sequence is highly similar to the typical CBM2 domain in the CAZy database, which can enhance the affinity of cellulose chains; (4) GH6 catalytic domain: nucleotide position 2320-3570 bp (amino acids 774-1190 aa), its catalytic triplet (D 795 / D 899 / E 906 Located in this region, the novel features of this topology include a specific subtype combination of dual CBM2 modules and a naturally fused enzyme system of GH5 and GH6.
[0024] Application conditions of complex enzymes: The composite enzyme of this invention maintains high activity over a wide temperature range (5℃~70℃) and pH range (3.0~10.0), adapting to the application requirements of different industrial environments. The composite enzyme operates stably under high temperature, strong acid, or strong alkaline conditions, significantly improving cellulose degradation efficiency and meeting the needs of large-scale industrial applications.
[0025] Advantages of this invention: This invention utilizes symbiotic bacteria from shipworms. Teredinibacter This invention yields a multifunctional enzyme complex catalyzed by a dual GH5 and GH6 domain. This complex integrates three different functional domains—GH5, GH6, and 2-4 CBMs—through an arrangement of GH5, GH6, and GH6, significantly improving the efficiency and stability of cellulose degradation. The enzyme complex of this invention not only possesses a high cellulose degradation capacity that is difficult to achieve with a single enzyme system, but also maintains high stability under industrial conditions, adapting to different production environments.
[0026] The innovation lies in the naturally fused topology of the GH5-GH6 dual domains, which enhances substrate binding capacity through dual CBM2 modules and works synergistically with GH5 / GH6 to significantly improve cellulose degradation efficiency (as shown in Examples 2 and 3). This enzyme complex maintains high activity within a temperature range of 5°C to 70°C and a pH range of 3.0 to 10.0, meeting the requirements of industrial environments. Attached Figure Description
[0027] Figure 1 The protein electrophoresis results show the successful gene amplification and its integrity verification; the left column shows the molecular weight scale.
[0028] Figure 2 The graph shows the results of the complex enzyme activity test under different temperature and pH conditions, demonstrating broad-spectrum adaptability. Detailed Implementation
[0029] The specific embodiments of the present invention will be described in detail below with reference to the examples. It should be noted that these embodiments are only used to explain the present invention and are not intended to limit the scope of protection of the present invention.
[0030] This invention addresses several technical bottlenecks hindering the large-scale industrial application of existing complex enzyme systems: First, insufficient enzyme stability; many enzymes are easily inactivated under conditions such as high temperatures, extreme pH levels, or the presence of organic solvents required for industrial processing, resulting in unsustainable degradation efficiency. Second, poor synergistic effects; not all complex enzyme combinations achieve ideal synergistic effects. Steric hindrance between different enzyme molecules can lead to interference at their catalytic sites, affecting the full realization of their respective functions. Third, high production costs: existing complex enzyme systems often require the isolation and purification of multiple enzyme components from various microbial sources, leading to complex production processes and significantly increased enzyme preparation costs. Furthermore, the expression level, purification yield, and economic viability of large-scale production of single enzymes also pose challenges. This invention proposes a single-enzyme specific multi-domain complex system strategy, aiming to achieve synergistic effects through the combination of different enzymes.
[0031] This invention utilizes shipworm symbiotic bacteria Teredinibacter turneraeA complex enzyme was obtained, comprising: a GH5 catalytic domain (27-328 aa, corresponding to DNA 79-984 bp); a CBM2a binding domain (377-474 aa, corresponding to DNA 1129-1422 bp); a CBM2b binding domain (610-705 aa, corresponding to DNA 1828-2115 bp); and a GH6 catalytic domain (774-1190 aa, corresponding to DNA 2320-3570 bp).
[0032] Example 1: Expression and purification of a complex enzyme (1) Gene construction symbiotic bacteria of shipworms Teredinibacter turnerae Using genomic DNA as a template, the GH5_GH6 dual catalytic domain fusion gene sequence (SEQ ID NO:7) was constructed by PCR. The boundaries of the amplified fragments were strictly defined according to the original gene: GH5 core domain: 79-984 bp (corresponding to amino acid 27-328 aa); CBM2a: 1129-1422 bp (corresponding to amino acid 377-474 aa); CBM2b: 1828-2115 bp (corresponding to amino acid 610-705 aa); GH6 core domain: 2320-3570 bp (corresponding to amino acid 774-1190 aa). Specific primers (completely identical to those in fragment 0011) were used for amplification.
[0033] (2) Construction of recombinant carrier After Gibson assembly, the full-length gene (3573 bp, SEQ ID NO:7) was cloned into the NdeI / XhoI site of pET-28a(+) and transformed into E. coli BL21(DE3) pLysS competent cells.
[0034] (3) Induced expression To optimize soluble expression, 0.1 mM IPTG was used to induce expression at 16°C for 18 hours (37°C is the general condition in the invention description; this example uses a low temperature to enhance solubility).
[0035] (4) Purification and Validation HisTrap HP column elution: 20-250 mM imidazole gradient (10 column volumes); Superdex 200 purification: flow rate 0.8 mL / min (50 mM sodium phosphate buffer, pH 7.4, 150 mM NaCl); SDS-PAGE showed a single 130 kDa band. Figure 1 ALL represents the entire complex enzyme. (Mass spectrometry molecular weight (matching the theoretical value of the 1190aa fusion protein, 1190 aa × 110 Da / aa = 130.9 kDa).
[0036] SEQ ID NO:7 (3573 bp in total) SEQ ID NO:8(1190 aa)
[0037] Example 2: Enzymatic Properties Test of Complex Enzymes (1) Temperature adaptability The temperature adaptability of the complex enzyme was determined within a temperature range of 5°C to 70°C. The reaction system contained 1 wt% CMC substrate (sodium carboxymethyl cellulose) dissolved in 0.1 M phosphate buffer (pH 6.5), the purified complex enzyme from the above-described example at a concentration of 1 U / mL (enzyme activity unit (U) is defined as the amount of enzyme required to catalyze the production of 1 μmol of glucose per minute from sodium carboxymethyl cellulose (CMC) substrate under specified conditions), and 0.02% (v / v) Triton X-100 stabilizer, with a total system volume of 1 mL. The reaction was carried out for 30 minutes at 5°C, 10°C, 20°C, 30°C, 40°C, 50°C, 60°C, and 70°C, with temperature test points spaced 10°C apart. The amount of reducing sugar produced was determined using the DNS method, and enzyme activity was defined as 1 activity unit (U) for the catalyzed production of 1 μmol of reducing sugar per minute. The experimental results showed that the compound enzyme reached its peak activity of 152±3 U / mL at 45℃, and the activity fluctuation range was less than ±15% in the range of 5-50℃, with the activity at 5℃ being 98±2 U / mL and at 50℃ being 130±4 U / mL.
[0038] (2) pH adaptability The pH adaptability of the complex enzyme was determined within a pH range of 3.0 to 10.0. The buffer systems included 0.1 M citrate-sodium buffer (pH 4.0–6.0), 0.1 M phosphate buffer (pH 6.0–8.0), and 0.1 M Tris-HCl buffer (pH 8.0–9.0). The reaction system consisted of 1 wt% CMC substrate, 1 U / mL complex enzyme, and 0.02% Triton X-100, with a total volume of 1 mL. The reaction was carried out for 30 minutes. The amount of reducing sugar produced was determined by the DNS method. The results showed that the optimal pH for the complex enzyme was 6.5 (activity 160±3 U / mL). The activity remained above 90% of the peak activity in the pH range of 5.5-7.5, with an activity of 145±3 U / mL at pH 5.5 and 142±2 U / mL at pH 7.5. When the pH dropped to 3.0, the activity decreased to 85±3 U / mL, and when the pH rose to 10.0, the activity was 82±4 U / mL.
[0039] (3) Substrate degradation efficiency Degradation efficiency was tested using 1% CMC as the substrate. The reaction system contained substrate dissolved in 0.1 M phosphate buffer (pH 6.5), 1 U / mL of a complex enzyme or a single GH5 enzyme (1 U / mL) or a single GH6 enzyme (1 U / mL) (shipworm). Teredinibacter turnerae The reaction mixture consisted of GH5 (UniProt ID: A0A0K1K5X7) and GH6 (UniProt ID: A0A0K1K4T3) and 0.02% Triton X-100 (to prevent substrate aggregation). Waste containing Triton X-100 was disposed of according to REACH regulations. The total volume of the reaction system was 1 mL. The reaction was carried out at a constant temperature of 45°C for 60 minutes, with samples taken every 10 minutes. The control group consisted of an equal volume of CMC-buffer-Triton without the enzyme. The degradation rate was calculated using the following formula: Degradation rate = ×100% Table 1. CMC substrate degradation kinetics data
[0040] The experimental results are listed in Table 1. The final degradation rate of CMC by the composite enzyme was 91.2±0.8%, significantly higher than that of the single GH5 enzyme (48.1±1.2%) and GH6 enzyme (33.4±0.9%). The activity of the composite enzyme was increased by 89.6% compared with that of the GH5 enzyme. ×100%), an increase of 173.0% compared to GH6 enzyme ( ×100%). This synergistic effect stems from the functional complementarity of the GH5-GH6 domains (GH5 is responsible for endocleavage, and GH6 enhances the efficiency of cellobiose hydrolysis).
[0041] Example 3: Degradation performance of composite enzymes on heterogeneous cellulose This example aims to verify the broad-spectrum adaptability of the complex enzyme to heterogeneous cellulose substrates. The experiment was conducted in 0.1 M citrate-sodium buffer at pH 6.5 (close to the optimal pH 6.5 in Example 2 to avoid activity loss). The reaction system contained 2% (w / v) substrate (PASC, microcrystalline cellulose Avicel PH-101, or 60-mesh corn stalks pretreated with 0.5 M NaOH), 1 U / mL of the complex enzyme, 0.05% (w / v) β-glucosidase (to eliminate cellobiose inhibition), and 0.02% (v / v) Triton X-100 (consistent with Example 2 to avoid variable interference), with a total system volume of 10 mL. The reaction was carried out at 45°C with constant shaking (150 rpm) for 48 hours, and the amount of reducing sugar generated was measured every 12 hours (to meet the dissociation requirements of the crystallization zone). Simultaneously, either GH5 enzyme alone (1 U / mL) or GH6 enzyme alone (1 U / mL) served as a control; the saccharification rate was calculated using the following formula: Saccharification rate = ×100% The coefficient 0.9 represents the cellulose-to-glucose conversion factor, and the cellulose content of the substrate was determined by the ANSI / ASTM E1758 standard method.
[0042] Table 2. Broad-spectrum adaptability test data of the complex enzyme to heterogeneous cellulose
[0043] Kinetic synergistic coefficient = Initial reaction rate of complex enzyme / (Initial rate of single GH5 enzyme + Initial rate of single GH6 enzyme) (μmol / min / mL) The experimental results are listed in Table 2. The saccharification rate of the composite enzyme for the three types of substrates was significantly higher than that of the single enzyme component (P<0.01), and the kinetic synergy coefficient >1.38 proved the functional synergy effect: PASC was the easiest to degrade (88.5%) due to the phosphate group swelling structure (degree of substitution 0.8–1.2); Avicel required a longer dissociation time due to its high crystallinity (>80%) (75.3%); the saccharification rate of corn straw with lignin content ≤15% after pretreatment with 0.5 M NaOH reached 65.2%, which was better than the 58.7% of the commercial enzyme Cellic CTec2 under the same conditions (official instruction manual data).
[0044] All experiments were repeated three times (n=3), and the relative standard deviation was <3.0% (in accordance with the heterogeneous substrate testing specifications).
[0045] Technical features description: (1) Consistency of reaction conditions: The enzymatic hydrolysis system at pH 6.5 and 45℃ was used (aligned with the peak activity conditions in Example 2) to avoid activity decay; (2) Surfactant consistency: Triton X-100 (0.02% v / v) is continued, as there is no risk of alkylphenol release due to the short reaction time (48 hours), reducing variable interference; (3) Enhanced synergistic mechanism: GH5 endonuclease cleaves amorphous region to reduce crystallinity, GH6 exonuclease releases cellobiose from chain end, bifunctional domains overcome steric hindrance (<10Å) by shortening catalytic distance to achieve efficient synergy, and the kinetic synergy coefficient >1.38 is quantitative evidence (see Table 2).
[0046] Example 4: Industrial and Agricultural Waste Treatment 1) The agricultural waste treatment experiment aims to verify the degradation efficiency of compound enzymes on rice straw and corn straw.
[0047] After drying (moisture content ≤5%), the corn stalks were pulverized into 0.5–1 cm fragments and then pretreated with 0.5 M NaOH for 30 minutes. The reaction system contained 5 wt% pretreated stalk substrate dissolved in 0.1 M citrate-sodium buffer at pH 6.5 (this pH does not affect the ability of the complex enzyme to cleave the amorphous cellulose region via GH5 and synergistically break down the lignin physical barrier with the GH6 exonuclease), with 1 U / mL of the complex enzyme and 0.02% (v / v) Triton X-100 stabilizer added. The reaction was carried out at a constant temperature of 45°C with shaking for 72 hours. The control group was treated under the same conditions but with the addition of an inactivated complex enzyme and allowed to degrade naturally.
[0048] Table 3. Degradation rate data of agricultural waste
[0049] The experimental results are shown in Table 3: the degradation rate of rice straw by the compound enzyme was 38.5±1.2% (control group 12.3±0.8%), and the degradation rate of corn straw was 35.6±1.0% (control group 11.1±0.6%), with a degradation efficiency increase of over 210%. Observations showed that the straw fiber structure was significantly loosened after treatment, confirming that the compound enzyme effectively degraded cellulose through the cleavage of the amorphous region of cellulose by GH5 endonuclease and the synergistic effect of GH6 exonuclease.
[0050] 2) Biofuel production experiments validate the application value of complex enzymes in the cellulosic ethanol conversion chain: Rice straw pretreated with 5 wt% NaOH was added to a citrate-sodium buffer solution at pH 6.5, and a complex enzyme of 1 U / mL was added. The mixture was degraded at 40℃ (a setting of 40℃ is chosen to balance cellulase stability and factory costs, and is commonly used on an industrial scale) for 72 hours, yielding a glucose yield of 35.2 ± 0.9 g / L. The pH of the reaction system was then adjusted to 6.0, and the mixture was inoculated with a known strain of *Saccharomyces cerevisiae* (Saccharomyces cerevisiae). Saccharomyces cerevisiae (10) 7 Fermentation (CFU / mL) was carried out at 30°C for 48 hours. Ethanol conversion was calculated using the formula: Ethanol conversion rate = ×100% Table 4 Biofuel Production Data
[0051] As shown in Table 4, the ethanol yield of the pretreated group with the compound enzyme reached 16.8 ± 0.5 g / L (compared to 3.2 ± 0.2 g / L in the control group), with an ethanol conversion rate of 91.3%, representing a 425% increase in yield compared to the control group. This result demonstrates that the compound enzyme significantly improves the efficiency of biofuel production by efficiently releasing fermentable sugars.
[0052] 3) Pulp pretreatment experiments to evaluate the optimization effect of compound enzymes on the bleaching process. Using 5 wt% waste corrugated paper pulp (OCC) as a substrate, 0.3 U / mL of a complex enzyme (industrial dosage is generally about 300 mL / t pulp ≈ 0.3 U / mL) was added and treated at pH 6.5 and 45℃ for 40 minutes. The treated pulp was then bleached with chloride dioxide (ClO2) at an initial dosage of 800 mL / t pulp (compared to 1000 mL / t pulp in the control group). Direct bleaching was used as a control. Test parameters included kappa number (TAPPI T236 standard), brightness (ISO 2470), and permeability (°SR, ISO 5267).
[0053] Table 5 Pulp Pretreatment Data
[0054] The experimental results are shown in Table 5: the kappa value of the compound enzyme pretreatment group was 14.2±0.3 (compared to 18.6±0.4 in the control group), the whiteness was improved to 68.5±0.7% ISO (compared to 60.1±0.9% in the control group), the water permeability was optimized to 25.3±0.5°SR (compared to 38.7±0.8°SR in the control group), and the bleaching agent dosage was reduced by 20%. This synergistic effect is due to the synergistic effect of the GH5 and GH6 domains. The GH5 endonuclease cleaves the cellulose chain, and the GH6 exonuclease releases monosaccharides, effectively degrading cellulose, thereby improving pulp properties and meeting the clean production requirements of the paper industry.
[0055] Comparative Example 1: Cellulose Degradation Efficiency of Single GH5 and GH6 Enzymes To fairly verify the synergistic effect of the composite enzyme (dual-domain GH5-GH6) of this invention, this comparative example uses the same shipworms as described in the above examples. Teredinibacter turneraeThe enzymes used were GH5 (UniProt ID: A0A0K1K5X7) and GH6 (UniProt ID: A0A0K1K4T3). Significant differences in enzyme activity exist between different species within the same family (e.g., GH5 activity fluctuates by up to 8 times). Therefore, using a unified enzyme source eliminates species interference. The reaction substrates included: 1 wt% CMC (carboxymethyl cellulose) (amorphous structure); 1 wt% PASC (phospholyzed cellulose) (crystallinity ≈ 65%); and 5 wt% NaOH-pretreated rice straw (lignocellulose complex). The reaction system was standardized as follows: buffer solution: 0.1 M citrate-sodium buffer (pH 6.5, same as Example 3 of the main invention); enzyme concentration: 1 U / mL (based on filter paper enzyme activity FPA); reaction temperature: 45℃ (optimal temperature of the main invention); reaction time: 72 hours (sampling every 24 hours); reducing sugar detection employed the DNS method to determine total reducing sugar and HPLC quantification of glucose and C1-oxidation products (such as gluconic acid) using a DNS-HPLC coupled method (to avoid missed detection of GH6 oxidation activity).
[0056] Degradation rate formula: Degradation rate = ×100% Table 6. Comparison of degradation efficiency between single enzymes and complex enzymes (72 hours)
[0057] The experimental results are shown in Table 6. GH5 showed high activity on CMC (28.5%) because its endonuclease properties preferentially attacked the amorphous region. GH6 had a degradation rate of only 12.7% for PASC, and the exonuclease mechanism was inhibited by the steric hindrance of the phosphate group. The degradation rate of rice straw by the complex enzyme (38.5%) far exceeded the arithmetic summation value (27.2%), confirming that the dual domains synergistically broke through the lignin barrier.
[0058] Comparative Example 2: Activity Defects of Heterologous GH5-GH6 Fusion Enzyme The following fusion enzyme was constructed for comparison: Thermobifida fusca GH5 + Coptotermes formosanus GH6; fusion strategy: (Gly4Ser)3 linker ligation, expressed using Pichia pastoris (the original E. coli lacked glycosylation modification); activity calibration: the specific activity of the fusion enzyme was determined experimentally compared with the above examples. Reaction conditions were the same as the main invention: substrate: rice straw pretreated with 5 wt% NaOH (same batch of raw materials); pH 6.5, 45℃, 72 hours; enzyme loading: equivalent specific activity (1 U / mL FPA); detection method was the same as Comparative Example 1 (DNS-HPLC coupled).
[0059] Heterogeneous single enzymes were selected, namely: (1) Coptotermes formosanus GH6:
[0060] (2)Thermobifida fusca GH5: ATGCTGGTCGAGGGTGGGCATGCGGATGTCGTCATTGCCGGTGGGAGCGACAGTGTGAGCAATGCGGAGCTCCCACTACCACGCTCGGTGACTCACGGGCTCATGATGGCCCAAAGGAAGGGCATCATGGGCTTCTTCAAGGAGGCGGGCTACAACCCGTCCAGGTGGCTTCCAAGCGGCGTCGCAATGACAGAGCGGAGCACCGGAAAAACCATGGGGTGGGACGGAGATGTCATTGGGGAGCTGAACAGCATCTCACGCGAGGACCAGGAAGCTCTGGCGGTGGCGTCACATGCTAACGCCGCCCGGGCTGAGAAGGCGGGGTACTTCAACGACGAAATTGTCCCGGTGATGGTTGATGCAACGAAGAACATCGAAGTGAAATGCGACGATGTTCTGCAGCGCGACACCGAGATGATGAAGGCCAAGATGCCAAGCCTGAAGCCTGTTTTCCGAAAAGGTAAAGGGACCATCACGGCCGCCACGTCAAGCGCCTTGACAGATGGAGGTAGTGCGATGCTCGTCATGTCCGAGGAGAAGGCGAAGAAGCTGGGATACCCGACCGATGTCTCTGTCAAGAGCTGGTACTTCTGCGGAATAGACCCTTATCCGCAGCTCCTCCTCGCACCTGTTCTGGGCTGGGGCCCTGCGCTGAGAAAGGCGGGCCTGGCGCCGAAGGACATCGATCTCTACGAGATCCATGAAGCCTTCGCAGCTCAGGTGCTCGCAACGATCAAGTGCCTACGGTCACAGGAGTTCTTCGACCGATATGCTGGCGGTGGCAAGCCGCTTCTCACGGAAGACATTGACCGGTCGAGGCTGAACGTCAATGGCGGGTCTCTGGCACTGGGTCACCCGTTCGCTGCAACTGGTGGCCGGATTGTGACCTCGCTTGCCAACGAGCTACGACGGTCCGGCAAGCGTCACGGCCTTGTGAGCATTTGCGCTGCTGGGGGTCTCGGTGGTGTTGCTGTTCTGGAGCACACTCCGAAGAAGTGA。
[0061] Table 7 Comparison of rice straw degradation rates between heterologous fusion enzymes and the composite enzyme of this invention.
[0062] Table 7 shows that the heterologous fusion enzyme activity was only 61% of that of the present invention. The artificial linker disrupted the conformation of the catalytic microenvironment. The heterologous GH6 gene introns caused truncation and inactivation: the Poly-T region (Gene ID: 36987) led to erroneous splicing of mRNA, and a 45 kDa truncated protein (expected 130 kDa) was detected by Western blot. Therefore, the natural dual domain co-evolution of the shipworm GH5-GH6 forms a substrate channel, which cannot be reproduced by artificial fusion.
[0063] The above description is a preferred embodiment of the present invention. It should be noted that, for those skilled in the art, several improvements and modifications can be made without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. Application of a GH5-GH6 dual-catalytic domain complex enzyme in cellulose degradation.
2. The application according to claim 1, characterized in that: The GH5_GH6 dual-catalytic domain complex enzyme is derived from the shipworm symbiotic bacteria.
3. The application according to claim 2, characterized in that: The shipworm symbiotic bacteria are known strains. Teredinibacter Species.
4. A method for preparing a GH5-GH6 dual-catalytic domain complex enzyme, characterized in that, Includes the following steps: (1) Genome assembly: using shipworm symbiotic bacteria ( Teredinibacter Using the genomic DNA of the genus as a template, the GH5 domain gene fragment, the CBM2 domain gene fragment, and the GH6 domain gene fragment were amplified using specific primers; then, the above gene fragments were assembled into the GH5-CBM2-GH6 fusion gene using overlap extension PCR technology. (2) Vector construction: The fusion gene obtained in step (1) is cloned into the expression vector using the Gibson assembly method to obtain the recombinant expression vector; (3) Expression and purification: The recombinant expression vector was transformed into host cells, and the fusion protein was induced to be expressed at 16°C in the presence of an inducer. The fusion protein was then purified by affinity chromatography and gel filtration chromatography to obtain the complex enzyme.
5. The application according to claim 1, characterized in that: Application of the GH5_GH6 dual-catalytic domain complex enzyme in the degradation of waste.
6. The application according to claim 5, characterized in that: The waste is agricultural waste, waste paper or pulp from the papermaking industry.
7. A multifunctional enzyme complex for degrading fibers, characterized in that: The complex contains the GH5_GH6 dual catalytic domain sequence from the shipworm symbiotic bacteria, and the complex contains the amino acid sequence shown in SEQ ID NO:8, whose encoding gene sequence is shown in SEQ ID NO:7.