Establishment of ALKBH5 gene knockout cell line and application of ALKBH5 gene knockout cell line as foot and mouth disease virus vaccine production cell line
By targeting and knocking out the ALKBH5 gene using CRISPR-Cas9 technology, an ALKBH5 gene knockout cell line was constructed, solving the problem that ALKBH5 inhibitors promote foot-and-mouth disease virus replication in existing technologies, and achieving efficient vaccine production and virus inhibition effects.
Patent Information
- Application Number
- CN202511703344.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-19
- Publication Date
- 2026-03-03
AI Technical Summary
In the existing technology, inhibitors of the ALKBH5 gene are thought to be able to inhibit the replication of a variety of viruses, but they were unexpectedly found to promote the replication of foot-and-mouth disease virus, and there is a lack of effective cell lines for the production of foot-and-mouth disease virus vaccines.
By targeting and knocking out the ALKBH5 gene in host cells using CRISPR-Cas9 technology, an ALKBH5 gene knockout cell line was constructed. This cell line was then used to promote the replication and antigen expression of foot-and-mouth disease virus, thereby increasing vaccine production.
The ALKBH5 gene knockout cell line significantly promoted the replication and antigen expression of foot-and-mouth disease virus, increased vaccine production, and can be used to prepare drugs that inhibit foot-and-mouth disease virus infection.
Smart Images

Figure CN121592601A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering, specifically relating to the establishment of an ALKBH5 gene knockout cell line and its application as a cell line for the production of foot-and-mouth disease virus vaccine. Background Technology
[0002] Foot-and-mouth disease (FMD) is a highly contagious disease caused by the foot-and-mouth disease virus (FMDV), classified as a Category A animal disease by the World Organisation for Animal Health (OIE). This virus specifically infects cloven-hoofed animals, with cattle and pigs being the most susceptible. The virus is primarily transmitted through the respiratory and digestive tracts, has a short incubation period, and is extremely contagious. Clinical manifestations in infected animals include high fever, vesicles and ulcers on the mouth, nose, and hooves, often accompanied by drooling, lameness, and difficulty eating. Although the mortality rate in adult animals is low, infection leads to severe economic losses, including decreased productivity (such as reduced milk and meat production), abortion in pregnant sows, and mortality of young animals, causing a devastating impact on the livestock industry.
[0003] Foot-and-mouth disease virus (FMDV) belongs to the genus *Aphthaovirus* of the family Picornaviridae. It is a non-enveloped, icosahedral viral particle, approximately 25–30 nanometers in diameter. The viral genome is a single-stranded positive-sense RNA of about 8.5 kb, possessing mRNA function. It binds to the host cell's ribosomes and initiates the translation of viral proteins. The capsid is assembled from 60 copies of four structural proteins (VP1, VP2, VP3, and VP4), exhibiting structural stability and strong survival ability in the environment. In addition, the virus encodes various non-structural proteins, including L, 2A, 2B, 2C, 3A, 3B, 3C, and 3D, which participate in viral replication, protein processing, and immune evasion.
[0004] m 6 N6-methyladenosine (A) modification, the most abundant internal chemical modification in eukaryotic mRNA, occurs at the sixth nitrogen atom of adenine. This process is catalyzed by methyltransferase complexes (writers, such as METTL3 / METTL14-WTAP) and can be reversibly removed by demethylases (erasers, such as FTO and ALKBH5). Ultimately, its function is mediated by recognition proteins (readers, such as the YTHDF family), thereby regulating mRNA splicing, transport, stability, and translation. The demethylase ALKBH5 can specifically remove N6-methyladenosine from RNA. 6A-modification reverses the methylation state and has modifying activity on non-coding RNA in addition to mRNA. Studies have confirmed that the function of ALKBH5 depends on its demethylase activity, which is mainly maintained by its arginine residue at position 131. Mutating this site to alanine (R131A) leads to complete loss of enzyme activity. Recent research (CN110420331B) indicates that ALKBH5 is associated with viral infection. ALKBH5 inhibitors (such as inhibitors targeting the ALKBH5 protein, nucleic acid molecules encoding the protein, small interfering RNA targeting ALKBH5, CRISPR / Cas9 gene editing products, and specific antibodies) achieve antiviral effects through innate immunity-independent mechanisms and can be used to prevent and treat viral infectious diseases, including herpes simplex virus, vesicular stomatitis virus, encephalomyocarditis virus, Sendai virus, influenza virus, hepatitis B virus, adenovirus, poxvirus, small DNA virus, and adeno-associated virus.
[0005] However, the present invention unexpectedly discovered that, contrary to the above-mentioned viruses, ALKBH5 can inhibit the replication of foot-and-mouth disease virus, while inhibiting ALKBH5 actually promotes the replication of foot-and-mouth disease virus. This can be used to construct a production cell line for foot-and-mouth disease virus vaccine, which is of great significance. Summary of the Invention
[0006] To address the aforementioned problems, this invention unexpectedly discovered that inhibiting the expression of the ALKBH5 gene in host cells can promote the replication of foot-and-mouth disease virus (FMDV), making it a promising cell line for FMDV vaccine production. Secondly, this invention provides a specific sgRNA targeting the ALKBH5 gene. This sgRNA specifically targets the ALKBH5 gene, and by combining it with CRISPR-Cas9 technology, ALKBH5 gene knockout was achieved. The resulting monoclonal cell line significantly promoted FMDV replication, increasing the production volume and antigen expression level of FMDV vaccine. Furthermore, this invention found that reintroducing ALKBH5 can inhibit FMDV replication and can be used to prepare drugs that inhibit FMDV infection. Specifically, this includes the following:
[0007] In a first aspect, the present invention provides the application of the ALKBH5 gene / protein in the preparation of drugs that inhibit foot-and-mouth disease virus infection.
[0008] Secondly, the present invention provides an application of the ALKBH5 gene / protein knockout cell line as a cell line for the production of foot-and-mouth disease virus or foot-and-mouth disease virus vaccine.
[0009] Thirdly, the present invention provides an application of a reagent for inhibiting or silencing the expression of the ALKBH5 gene / protein in cells in the preparation of foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production cell lines.
[0010] Preferably, the reagent comprises sgRNA that targets and knocks out the ALKBH5 gene / protein.
[0011] Preferably, the sgRNA includes at least one of HamALKBH5-KO-#1, HamALKBH5-KO-#2, HamALKBH5-KO-#3, and HamALKBH5-KO-#4, and the primer sequence of the sgRNA is as follows:
[0012] HamALKBH5-KO-#1-F:CACCGCGAAGCCCTCGGGGATAACG,
[0013] HamALKBH5-KO-#1-R:AAACCGTTATCCCCGAGGGCTTCGC;
[0014] HamALKBH5-KO-#2-F: CACCGATCAACGACTACCAGCCTGG,
[0015] HamALKBH5-KO-#2-R:AAACCCAGGCTGGTAGTCGTTGATC;
[0016] HamALKBH5-KO-#3-F: CACCGGGACATTAAAGAACGCCGAG,
[0017] HamALKBH5-KO-#3-R: AAACCTCGGCGTCTTTAATGTCCC;
[0018] HamALKBH5-KO-#4-F: CACCGCACCAAACGGAAATACCAGG,
[0019] HamALKBH5-KO-#4-R:AAACCCTGGTATTTCCGTTTGGTGC.
[0020] Fourthly, the present invention provides an sgRNA that specifically targets the ALKBH5 gene / protein, wherein the sgRNA includes at least one of HamALKBH5-KO-#1, HamALKBH5-KO-#2, HamALKBH5-KO-#3, and HamALKBH5-KO-#4, and the primer sequence of the sgRNA is as follows:
[0021] HamALKBH5-KO-#1-F:CACCGCGAAGCCCTCGGGGATAACG,
[0022] HamALKBH5-KO-#1-R:AAACCGTTATCCCCGAGGGCTTCGC;
[0023] HamALKBH5-KO-#2-F: CACCGATCAACGACTACCAGCCTGG,
[0024] HamALKBH5-KO-#2-R:AAACCCAGGCTGGTAGTCGTTGATC;
[0025] HamALKBH5-KO-#3-F: CACCGGGACATTAAAGAACGCCGAG,
[0026] HamALKBH5-KO-#3-R: AAACCTCGGCGTCTTTAATGTCCC;
[0027] HamALKBH5-KO-#4-F: CACCGCACCAAACGGAAATACCAGG,
[0028] HamALKBH5-KO-#4-R:AAACCCTGGTATTTCCGTTTGGTGC.
[0029] Fifthly, the present invention provides the application of the sgRNA described in the fourth aspect above in the preparation of ALKBH5 gene / protein knockout cell lines.
[0030] In a sixth aspect, the present invention provides a method for constructing an ALKBH5 gene / protein knockout cell line, wherein the method comprises knocking out the ALKBH5 gene / protein in the host cell through gene targeting technology.
[0031] Preferably, the method is CRISPR-Cas9 technology.
[0032] Preferably, the method includes the following steps:
[0033] (1) Prepare the sgRNA primers specifically targeting the ALKBH5 gene / protein as described in the above four aspects;
[0034] (2) Insert the primer fragment prepared in step (1) into the lentiCRISPR V2 expression plasmid to obtain a recombinant vector that simultaneously expresses the Cas9 protein gene and the targeting sgRNA sequence;
[0035] (3) Transfect the host cells with the recombinant vector prepared in step (2) and screen them with puromycin antibiotic to obtain the ALKBH5 gene / protein knockout cell line.
[0036] In a seventh aspect, the present invention provides an ALKBH5 gene / protein knockout cell line prepared by the method described in the sixth aspect above.
[0037] The beneficial effects of this invention are: ① This invention first discovered that inhibiting the expression of the ALKBH5 gene in host cells can promote the replication of foot-and-mouth disease virus; ② This invention provides an sgRNA targeting the ALKBH5 gene, which can specifically target the ALKBH5 gene. Combined with CRISPR-Cas9 technology, it can achieve the knockout of the ALKBH5 gene in host cells with accurate targeting and high knockout efficiency; ③ This invention provides a method for constructing a cell line with loss of function of the ALKBH5 gene-encoded protein by transfecting the sgRNA into host cells using CRISPR-Cas9 technology; ④ The ALKBH5 knockout cell line obtained according to the method of this invention can significantly promote the replication of foot-and-mouth disease virus, increase the production volume and antigen expression level of foot-and-mouth disease virus vaccine, and can be used as a production cell line for foot-and-mouth disease virus vaccine; ⑤ This invention further discovered through a remedial experiment that ALKBH5 can inhibit the replication of foot-and-mouth disease virus and can be used to prepare drugs that inhibit foot-and-mouth disease virus infection, with broad application prospects. Attached Figure Description
[0038] Figure 1 Sequencing results of LentiCRISPR sgRNA plasmid.
[0039] Figure 2 Sequencing results of plov-ALKBH5 and R131A enzyme activity mutant plasmids.
[0040] Figure 3 ALKBH5 gene knockout cell viability assay results, ns indicates no statistical significance.
[0041] Figure 4 The knockout effect of ALKBH5 gene knockout cells on ALKBH5 protein levels.
[0042] Figure 5 The mRNA transcription level of ALKBH5 knockout cells was detected by qPCR at 0h, 9h and 15h after infection with FMDV.
[0043] Figure 6 The expression levels of ALKBH5 protein and 2C protein at different time points after FMDV infection were detected in ALKBH5 knockout cells.
[0044] Figure 7 Detection of FMDV progeny virus titers in ALKBH5 knockout cells infected with FMDV; **: P < 0.01, ***: P < 0.001.
[0045] Figure 8qPCR detection of FMDV transcriptional levels by ALKBH5 knockout cell reinjection with WT and R131A.
[0046] Figure 9 The titer of FMDV progeny virus infection by ALKBH5 knockout cell reinjection with WT and R131A was determined. ns indicates no statistical significance; **: P < 0.01, ***: P < 0.001. Detailed Implementation
[0047] To make the objectives, technical solutions, and advantages of this invention clearer, the various embodiments of this invention will be described in detail below with reference to the accompanying drawings. However, those skilled in the art will understand that many technical details have been provided in the embodiments of this invention to facilitate a better understanding of this application. However, the technical solutions claimed in this application can be implemented even without these technical details and various variations and modifications based on the following embodiments.
[0048] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent companies.
[0049] The plasmids, viruses, and cells involved in the following examples: 293T and BHK-21 cells, as well as plov and lentiCRISPR V2 plasmids, were all preserved and provided by our laboratory and can be purchased through commercial platforms; the FMDV strain (O / BY / CHA / 2010, gene accession number JN998085) was provided by the National Foot-and-Mouth Disease Reference Laboratory of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences.
[0050] The reagents and antibodies used in the following examples are as follows: DMEM culture medium and 0.05% EDTA trypsin were purchased from Gibco; fetal bovine serum (FBS) was purchased from Biological Industries. Restriction endonuclease BbsI was purchased from NEB; BamHI, NheI, Esp3I, T4 DNA ligase, and pre-stained protein markers were all purchased from Thermo Fisher Scientific. Gel extraction kits and plasmid extraction kits were purchased from OMEGA; CCK-8 kits were purchased from Guangzhou Hucheng Technology Co., Ltd.; puromycin was purchased from Beijing Solarbio Science & Technology Co., Ltd. β-Actin antibody and PBS buffer were purchased from Wuhan Saiwei Biotechnology Co., Ltd.; ALKBH5 antibody and HRP-labeled goat anti-rabbit secondary antibody were purchased from Ibotek. Anti-FMDV 2C polyclonal antibody was prepared and preserved by our research group. Escherichia coli DH5α competent cells were purchased from Shenzhen Kangti Life Technology Co., Ltd.
[0051] The ALKBH5 gene sequence described in the following examples is shown in SEQ ID NO.13, and the amino acid sequence is shown in SEQ ID NO.14.
[0052] This invention, based on direct targeted splicing of the ALKBH5 gene, utilizes a CRISPR / Cas9 combined method to specifically knock out the ALKBH5 gene. Taking young hamster kidney cells (BHK-21) as an example, ALKBH5 gene knockout was performed, providing a strategy to improve the efficiency of FMDV vaccine production. Although this invention only knocks out the ALKBH5 gene in young hamster kidney cells (BHK-21), obtaining a gene knockout host cell, the method described in this invention can be extrapolated and extended to knocking out the ALKBH5 gene in other host cells, constructing gene knockout cell lines with enhanced FMDV antigen expression.
[0053] The CRISPR / Cas9 system achieves targeted gene recognition and cleavage through sgRNA and Cas9. sgRNA determines the targeting and cleavage activity of Cas9. This invention aims to utilize CRISPR / Cas9 gene editing technology to accurately and efficiently knock out the ALKBH5 gene by screening for sgRNA sequences targeting the ALKBH5 gene in vitro and in vivo. The goal is to obtain an ALKBH5 gene knockout monoclonal cell line that significantly promotes FMDV replication, thus providing a new strategy for FMDV vaccine production.
[0054] All experimental data were obtained from at least three independent repeated experiments and are expressed as mean ± standard deviation. Independent samples t-tests were used to analyze the significance of differences between the experimental and control groups, with the following definitions: P < 0.05 was considered significant (*), P < 0.01 was considered highly significant (**), P < 0.001 was considered extremely significant (***), and no significance (ns) indicated P ≥ 0.05.
[0055] Example 1: Primer Design and Synthesis
[0056] The full-length sequence of the ALKBH5 gene from the golden hamster (Mesocricetus auratus) was obtained from the NCBI database (GenBank accession number: XM_005067672.3). Using the CHOPCHOP online tool, sgRNA sequences targeting this gene were designed, and four pairs of candidate sequences were selected. CACC was added to the 5′ end and AAAC sticky ends were added to the 3′ end of each sgRNA sequence to adapt it to the lentiCRISPR V2 vector. Simultaneously, using the ALKBH5 gene as a template, corresponding vector homologous arms were added to both ends of its coding region to construct overexpression plasmids. The ALKBH5 enzyme activity mutant plasmid (R131A) was designed using a site-directed mutagenesis protocol. All primer sequences are shown in Table 1 and were synthesized by Qingke Biotechnology (Xi'an) Co., Ltd.
[0057] Table 1. Primer sequences for ALKBH5 sgRNA from golden rats and for wild-type and enzyme activation site mutations of ALKBH5.
[0058]
[0059] Example 2: Construction of lenti CRISPR-ALKBH5-sgRNA and plasmids containing wild-type ALKBH5 and R131A enzyme activity mutants.
[0060] The lentiCRISPR V2 plasmid was digested with Esp3Ⅰ restriction endonuclease at 37℃ for 2 hours. The digestion products were separated by agarose gel electrophoresis, and a fragment of approximately 12992 bp was recovered as a linearization vector. The synthesized sgRNA oligonucleotide chains were diluted separately, and equal volumes were mixed in a 50 μL system. Gradient annealing was then performed using a PCR instrument to form double strands. Subsequently, the linearization vector, annealing product, T4 DNA ligase, and corresponding buffers were mixed in a 1:2:1:1 ratio, and water was added to a 10 μL reaction system. Ligation was carried out at room temperature for 5 hours to complete the recombination of sgRNA and vector, obtaining lentiCRISPR-ALKBH5-sgRNA.
[0061] To construct the wild-type overexpression plasmid of ALKBH5, the full-length coding region (1188 bp) of the ALKBH5 gene was first amplified from the genomic DNA of golden hamsters via PCR. The purified PCR product was used as the insert fragment, and the plov-stop empty vector plasmid was linearized by double digestion with BamHI and NheI. Subsequently, homologous recombination was performed using the Exnase II recombinase system: the linearized plov vector, the ALKBH5 target fragment, Exnase II, 5×CEII buffer, and ddH2O were mixed in a ratio of 2:2:1:2:3 to form a 10 μL reaction system, which was incubated at 50°C for 1 hour to obtain the recombinant plasmid with enzyme activity mutant. Using the wild-type ALKBH5 plasmid as a template, PCR amplification was performed using site-directed mutagenesis primers. The resulting product was digested with DpnI enzyme to remove the template plasmid, yielding the ALKBH5 point-mutant recombinant plasmid.
[0062] The resulting ligation product was transformed into DH5α competent cells and screened on ampicillin-resistant plates. Single colonies were picked and expanded, and plasmids were extracted and sent to Qingke Biotechnology Co., Ltd. for sequencing. Sequence alignment confirmed the successful construction of sgRNA and plasmids for ALKBH5 wild-type and R131A enzyme activity mutants. Sequencing results were consistent with the expected sequences. (See details below.) Figure 1 and Figure 2 .
[0063] Example 3: Establishment of ALKBH5 knockout cell line
[0064] To construct a stable ALKBH5 knockout BHK-21 cell line, 293T and BHK-21 cells were first revived and passaged. When 293T cells reached the logarithmic growth phase, the original culture medium was discarded, and the cells were gently washed with PBS. Then, 0.05% trypsin was added and the cells were digested at 37°C for 1 minute, followed by the addition of complete culture medium to terminate the digestion. Cells were evenly seeded into 6-well plates. When the cell density reached 70%–80%, the successfully constructed lentiCRISPR-ALKBH5-sgRNA mixed plasmid and the control empty vector were transfected into 293T cells using the polyethyleneimine (PEI) transfection method. Twelve hours after transfection, the medium was replaced with antibiotic-free medium, and the cells were cultured at 37°C in a 5% CO2 incubator for 36 hours. The cell supernatant containing lentivirus was collected. The obtained viral supernatant was mixed, filtered through a 0.45 μm filter membrane, and mixed with an appropriate amount of antibiotic-free complete culture medium. This mixture was then used to infect BHK-21 cells in the logarithmic growth phase. Infected cells were cultured until fully confluent, then passaged, and puromycin was added to the culture medium at a final concentration of 0.5% for continuous selection. After five consecutive passages, a stable ALKBH5 knockout BHK-21 cell line was finally obtained.
[0065] Example 4: Viability assay of ALKBH5 knockout cell lines
[0066] To evaluate the effect of ALKBH5 knockout on the growth activity of BHK-21 cells, stable knockout cell lines and control cell lines were simultaneously passaged. Approximately 2000 cells (100 μL) were seeded per well in 96-well plates, with three replicates per group. When cells reached 70%–80% confluence, 10 μL of CCK-8 solution was added to each well, and the cells were incubated at 37°C for 3 hours. The color change of the culture medium was then observed, and the absorbance of each well was measured at 450 nm using a microplate reader. The data were compared to analyze the effect of ALKBH5 knockout on cell proliferation activity.
[0067] The results are as follows Figure 3 As shown, there was no significant difference in cell viability between the ALKBH5 gene knockout cell line and the control BHK-21 cell line (P>0.05), indicating that ALKBH5 gene knockout has no significant effect on cell proliferation.
[0068] Example 5: Identification of the knockout effect of ALKBH5 knockout cell lines
[0069] ALKBH5 knockout cell lines (5 generations after puromycin selection) and control cell lines were collected. The culture medium was discarded, and the cells were washed with PBS. 100 μL of 2×SDS loading lysis buffer was added to lyse the cells, and the cells were boiled in a 100℃ metal bath for 12 minutes. Western blot analysis was performed on the resulting samples: 10 μL of each sample was loaded into the control and experimental groups. Electrophoresis was first performed at a constant voltage of 80V until the sample reached the separating gel, then the voltage was adjusted to 120V and electrophoresis continued until the bromophenol blue indicator reached the bottom of the gel. Transfer was then performed at a constant voltage of 100V for 90 minutes. After transfer, the membrane was blocked with 5% skim milk at room temperature with shaking for 30 minutes. Primary and secondary antibodies were then added, and the membranes were incubated at room temperature with shaking for 2 hours and 1 hour, respectively. After each antibody incubation, the membrane was washed 5 times with 1×TBST solution for 5 minutes each time. Finally, ECL solutions A and B were mixed in a 1:1 ratio and evenly added to the membrane for chemiluminescent imaging.
[0070] The results are as follows Figure 4 As shown, the ALKBH5 gene knockout cell line showed a significantly reduced ALKBH5 protein level compared to the control cell line.
[0071] Example 6: qPCR detection of FMDV transcription level
[0072] Control and ALKBH5 stably knocked-out BHK-21 cells were seeded in 12-well plates with FMDV at an MOI of 0.1. Cell samples were collected at different time points after infection. Total RNA was extracted using the Trizol method and reverse transcribed into cDNA using 5×HiScriptⅡ qRTSuperMixⅡ reagent. After diluting the cDNA 30-fold, FMDV mRNA was relatively quantified by qPCR using GAPDH as an internal control gene. Gene expression changes were calculated using the 2^(–ΔΔCt) method to assess the impact of ALKBH5 gene deletion on FMDV replication.
[0073] The results are as follows Figure 5 As shown, compared with control cells, the FMDV transcription level in ALKBH5 knockout cells was significantly increased at both time points, indicating that ALKBH5 gene deletion can significantly promote FMDV transcription.
[0074] Example 7 Identification of the effect of ALKBH5 knockout on 2C expression
[0075] Control BHK-21 cells and ALKBH5 stable knockout cells were seeded in 12-well plates. FMDV was seeded at an MOI of 0.1, and cell samples were collected at different time points after infection. The expression level of FMDV2C protein was detected by Western blot as described in Example 5.
[0076] The expression levels of ALKBH5 and FMDV 2C proteins were detected by Western blot. The results are as follows: Figure 6 As shown, ALKBH5 protein expression was significantly reduced in knockout cells, and FMDV 2C protein expression was significantly higher than in control cells, further confirming that ALKBH5 deficiency can promote viral protein synthesis.
[0077] Example 8: FMDV titer determination
[0078] Following the method described in Example 7, cell supernatant was collected after complete cytopathic effect was observed in the cells. The virus solution was serially diluted 10-fold (10... -1 Up to 10 -8 Different dilutions were seeded into 96-well plates confluent with wild-type BHK-21 cells and cultured in serum-free DMEM at 37°C and 5% CO2 for 72 hours. Cytopathic effect (CPE) was observed daily, and the results for each well were recorded after 72 hours. The Reed-Muench method was used to calculate the median tissue-cell infection dose (TCID) of the virus. 50 ), calculate virus titer.
[0079] Using TCID 50 The viral titer was determined by a method, and the results were as follows: Figure 7 As shown, the viral titer in the supernatant of ALKBH5 knockout cells was significantly higher than that in the control group, indicating that ALKBH5 deficiency can significantly enhance the infectivity of progeny viruses.
[0080] The results in summary indicate that the deletion of the ALKBH5 gene can significantly promote the transcriptional activity of FMDV, viral protein expression, and progeny virus yield, suggesting that ALKBH5 has an inhibitory effect on FMDV replication in host cells.
[0081] Example 9: Effects of ALKBH5 gene knockout cell replacement with WT and R131A on FMDV replication
[0082] In ALKBH5 knockout cell lines, empty vector plasmids (control group), wild-type ALKBH5 plasmids, and R131A enzyme activity mutant plasmids were transfected, respectively. FMDV was inoculated at MOI=0.1 18 hours after transfection. Results were obtained via qPCR and TCID45 assays. 50 Detect viral mRNA transcription levels and progeny virus titers.
[0083] qPCR results as follows Figure 8 As shown, reintroducing wild-type ALKBH5 into knockout cells significantly inhibited FMDV mRNA transcription, while reintroducing the R131A mutant did not have this inhibitory effect.
[0084] TCID 50 Experiments such as Figure 9 As shown, reintroducing wild-type ALKBH5 significantly reduced the progeny virus titer, while the virus titer of the reintroduced ALKBH5 R131A mutant group was not significantly different from that of the control group.
[0085] The above results indicate that ALKBH5 can inhibit FMDV replication and that this inhibition depends on the demethylase activity of ALKBH5.
Claims
1. Application of ALKBH5 gene / protein in the preparation of drugs to inhibit foot-and-mouth disease virus infection.
2. Application of ALKBH5 gene / protein knockout cell lines as cell lines for the production of foot-and-mouth disease virus or foot-and-mouth disease virus vaccines.
3. Application of reagents for inhibiting or silencing the expression of the ALKBH5 gene / protein in cells in the preparation of cell lines for foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production.
4. The application as described in claim 2, characterized in that, The reagents include sgRNA that targets and knocks out the ALKBH5 gene / protein.
5. The application as described in claim 4, characterized in that, The sgRNA includes at least one of HamALKBH5-KO-#1, HamALKBH5-KO-#2, HamALKBH5-KO-#3, and HamALKBH5-KO-#4, and the primer sequence of the sgRNA is as follows: HamALKBH5-KO-#1-F:CACCGCGAAGCCCTCGGGGATAACG, HamALKBH5-KO-#1-R:AAACCGTTATCCCCGAGGGCTTCGC; HamALKBH5-KO-#2-F: CACCGATCAACGACTACCAGCCTGG, HamALKBH5-KO-#2-R:AAACCCAGGCTGGTAGTCGTTGATC; HamALKBH5-KO-#3-F: CACCGGGACATTAAAGAACGCCGAG, HamALKBH5-KO-#3-R: AAACCTCGGCGTCTTTAATGTCCC; HamALKBH5-KO-#4-F: CACCGCACCAAACGGAAATACCAGG, HamALKBH5-KO-#4-R:AAACCCTGGTATTTCCGTTTGGTGC.
6. A sgRNA that specifically targets the ALKBH5 gene / protein, characterized in that, The sgRNA includes at least one of HamALKBH5-KO-#1, HamALKBH5-KO-#2, HamALKBH5-KO-#3, and HamALKBH5-KO-#4, and the primer sequence of the sgRNA is as follows: HamALKBH5-KO-#1-F:CACCGCGAAGCCCTCGGGGATAACG, HamALKBH5-KO-#1-R:AAACCGTTATCCCCGAGGGCTTCGC; HamALKBH5-KO-#2-F: CACCGATCAACGACTACCAGCCTGG, HamALKBH5-KO-#2-R:AAACCCAGGCTGGTAGTCGTTGATC; HamALKBH5-KO-#3-F: CACCGGGACATTAAAGAACGCCGAG, HamALKBH5-KO-#3-R: AAACCTCGGCGTCTTTAATGTCCC; HamALKBH5-KO-#4-F: CACCGCACCAAACGGAAATACCAGG, HamALKBH5-KO-#4-R:AAACCCTGGTATTTCCGTTTGGTGC.
7. The application of the sgRNA as described in claim 6 in the preparation of ALKBH5 gene / protein knockout cell lines.
8. A method for constructing an ALKBH5 gene / protein knockout cell line, characterized in that, The method involves knocking out the ALKBH5 gene / protein in host cells using gene targeting technology.
9. The method as described in claim 8, characterized in that, The method includes the following steps: (1) Prepare the sgRNA primers that specifically target the ALKBH5 gene / protein as described in claim 6; (2) Insert the primer fragment prepared in step (1) into the lentiCRISPR V2 expression plasmid to obtain a recombinant vector that simultaneously expresses the Cas9 protein gene and the targeting sgRNA sequence; (3) Transfect the host cells with the recombinant vector prepared in step (2) and screen them with puromycin antibiotic to obtain the ALKBH5 gene / protein knockout cell line.
10. The ALKBH5 gene / protein knockout cell line prepared by the method of claim 9.
Citation Information
Patent Citations
Application of ALKBH5 inhibitors in the treatment of viral infectious diseases
CN110420331B