CRISPR-Ca12a system based on AND disordered logic gate as well as preparation method and application of CRISPR-Ca12a system
By utilizing the CRISPR-Ca12a system based on 'AND' disordered logic gates, and employing gold nanoparticle carriers and specific nucleic acid complexes, the problems of low DNAzyme cleavage efficiency and strong time dependence in existing technologies have been solved. This has enabled the specific detection and live-cell imaging of miRNA-141 and APE1, improving the accuracy of detection and the visualization capabilities for tumor cell identification.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-31
- Publication Date
- 2026-03-31
AI Technical Summary
Existing detection technologies based on CRISPR or DNA logic gates suffer from low efficiency in cutting free DNAzymes and strong time-dependent logic gate detection, making it difficult to efficiently and specifically detect multiple disease-related biomarkers simultaneously and achieve live-cell imaging in dynamic biological environments.
The CRISPR-Ca12a system, based on the 'AND' disordered logic gate, utilizes gold nanoparticles as a carrier to improve the cleavage efficiency of DNAzymes through spatial confinement effects. Specific nucleic acid complexes are designed to construct the 'AND' disordered logic gate, which activates CRISPR-Cas12a-mediated signal amplification only when miRNA-141 and APE1 are present simultaneously, enabling specific detection of dual targets and live-cell imaging.
It achieves synergistic recognition and signal amplification of miRNA-141 and APE1, improves detection specificity, effectively avoids false positives, enhances the ability to distinguish tumor cells from normal cells, and improves the accuracy of tumor cell imaging.
Smart Images

Figure CN121759602A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biodetection technology, and in particular to a CRISPR-Ca12a system based on "AND" disordered logic gates, its preparation method, and its application. Background Technology
[0002] MicroRNAs (miRNAs) are non-coding single-stranded RNA molecules, approximately 22 nucleotides in length, encoded by endogenous genes. They participate in important physiological and pathological processes and are considered effective and promising biomarkers for early disease diagnosis and treatment. Endogenous depurinyl / depyrimidine endonuclease 1 (APE1) is an enzyme responsible for repairing DNA damage, specifically cleaving AP sites from the DNA double strand. Furthermore, it participates in the regulation of gene expression and plays a crucial role in maintaining genome stability. APE1 is highly expressed in the cytoplasm of various tumor cells but rarely in the cytoplasm of normal cells. Moreover, because some biomarkers are not tumor-specific, detecting a single biomarker is insufficient to provide a high-confidence diagnosis. For example, certain miRNA types may be associated with specific tumor types or prognostic specificity, and aberrant APE1 expression may also be associated with tumor malignancy. Simultaneous detection of multiple biomarkers may improve detection accuracy and help determine whether a patient is suitable for a specific treatment strategy.
[0003] A logic gate is a Boolean logic actuator that uses "1" to represent "true value" or "high signal" and "0" to represent "false value" or "low signal." This logic platform can recognize multiple labeled inputs and generate signal outputs, offering significant advantages in analytical detection. Due to its programmability and design flexibility, DNA logic gates have attracted widespread attention in liquid biopsy and cell identification imaging. Examples include "AND" logic gates based on double-locked DNases for intracellular biomarker detection and cancer cell identification; "OR"-based "AND" logic gates, combined with strand displacement reactions, for sensitive detection of miRNAs at the subcellular level; cascaded "OR-AND" and "AND-AND" logic gates built on framework nucleic acids for intracellular mRNA imaging; and dual-logic gates, amplified cascaded logic DNA circuits for dual miRNA imaging and cell subtype identification. These DNA logic gate designs provide more accurate detection methods for biomarkers.
[0004] However, existing detection technologies based on CRISPR or DNA logic gates still have some limitations: for example, free DNAzymes are not very efficient at cutting substrates; some logic gates have strict requirements on the reaction order of the input target (ordered logic gates), which limits their application in dynamic biological environments; and efficiently delivering the detection system into cells and achieving multi-target imaging at the live cell level still faces challenges.
[0005] Therefore, there is an urgent need to develop a novel detection technology that can efficiently, specifically, and flexibly detect multiple disease-related biomarkers simultaneously and is applicable to live-cell imaging. Summary of the Invention
[0006] The purpose of this invention is to address the problems of high false positive rate in single-target detection, low DNAzyme cleavage efficiency, and time-dependent logic gate detection by providing a CRISPR-Ca12a system based on an "AND" disordered logic gate, its preparation method, and applications. Using gold nanoparticles as a carrier, the spatial confinement effect is utilized to improve the cleavage efficiency of DNAzymes, while simultaneously achieving efficient cell transfection of nucleic acid chains. By designing specific nucleic acid complexes and constructing "AND" disordered logic gates, the detection system activates CRISPR-Cas12a-mediated signal amplification only when miRNA-141 and APE1 are present simultaneously, achieving specific detection of dual targets and live-cell imaging.
[0007] To achieve the above objectives, the present invention adopts the following technical solution:
[0008] This invention provides a CRISPR-Ca12a system based on "AND" disordered logic gates, comprising:
[0009] (1) Gold nanoparticle carrier;
[0010] (2) Blocked DNA zyme and blocked crRNA are fixed on the surface of the gold nanoparticle carrier by Au-S bonds;
[0011] The blocking DNAzyme comprises a DNAzyme sequence and a first blocking strand that blocks the activity of the DNAzyme sequence; the first blocking strand comprises a sequence complementary to the target miRNA-141;
[0012] The blocking crRNA comprises a crRNA sequence and a second blocking strand that blocks the activity of the crRNA; the second blocking strand comprises the cleavage substrate sequence of the DNAzyme and the cleavage site of APE1;
[0013] (3) Cas12a protein and its activation chain;
[0014] (4) Signal reporter probes (FQ) labeled with fluorescent and quenching groups, whose sequences can be non-specifically cleaved by activated Cas12a protein;
[0015] The presence of the target miRNA-141 can release the DNAzyme from its blockage via a strand displacement reaction, and the activated DNAzyme can cleave the second blocking strand. The presence of APE1 can cleave the cleavage site on the second blocking strand. Only when the target miRNA-141 and APE1 are present simultaneously can the crRNA be completely released. Then, the Cas12a protein binds to the released crRNA and the activated strand, and the activated Cas12a complex cleaves the signal reporter probe FQ to generate a detection signal.
[0016] Furthermore, the system is disordered, meaning that the order in which the target miRNA-141 and the APE1 trigger reactions occur does not affect the generation of the final detection signal.
[0017] Furthermore, the sequence of the DNAzyme is as shown in SEQ ID NO: 1, or a functional variant thereof.
[0018] Furthermore, the sequence of the crRNA is as shown in SEQ ID NO: 4, or it may be a variant capable of guiding the Cas12a protein to cleave the reporter probe.
[0019] Furthermore, the sequence of the blocking DNAzyme is shown in SEQ ID NO: 3; the sequence of the blocking crRNA is shown in SEQ ID NO: 5.
[0020] Furthermore, the ratio of the gold nanoparticles to the blocking DNAzyme is 1:80; the ratio of the gold nanoparticles to the blocking crRNA is 1:250.
[0021] In addition, the present invention also provides a method for simultaneously detecting miRNA-141 and APE1 using the above system, comprising the following steps:
[0022] (1) The sample to be tested is mixed and incubated with a gold nanoparticle carrier loaded with blocking DNAzyme and blocking crRNA on its surface, so that the target miRNA-141 and / or APE1 react with the corresponding complex.
[0023] (2) Add Cas12a protein, activation chain and signal reporter probe FQ to the reaction system;
[0024] (3) The signal generated after the detection signal report probe FQ is cut.
[0025] The presence of the detection signal indicates that the target miRNA-141 and APE1 are present simultaneously in the sample to be tested.
[0026] Preferably, in step (1), the target miRNA-141 and the APE1 can be added in any order or simultaneously.
[0027] Preferably, in step (1), the sample to be tested is a cell lysis buffer or a live cell culture system treated with a transfection reagent.
[0028] It is evident that the above system can be used to detect the target miRNA-141 and APE1, and to distinguish tumor cells from normal cells.
[0029] In summary, due to the adoption of the above technical solution, the present invention has the following beneficial effects:
[0030] This invention constructs a CRISPR-Cas12a system based on an AND-disordered logic gate, capable of simultaneously detecting miRNA-141 and APE1. This system achieves synergistic recognition and signal amplification of these two biomarkers, providing a highly specific method for the synergistic detection of dual-target molecules. The system uses gold nanoparticles (AuNPs) as a carrier, leveraging spatial confinement to enhance DNAzyme cleavage efficiency and serving as a vector for transfecting nucleic acid strands into cells, enabling sensitive fluorescence imaging of miRNA-141 in live cells. This system only operates when miRNA-141 and APE1 are present simultaneously. The synergistic effect of the two detection channels significantly improves detection specificity, effectively avoiding the false positive problem common in single-target detection. Furthermore, given the high expression of APE1 and miRNA in tumor cytoplasm, the accuracy of this CRISPR-Cas12a system for tumor cell imaging is improved, enhancing the ability to distinguish tumor cells from normal cells.
[0031] Compared to traditional single-target detection strategies, the system constructed in this invention establishes a disordered logic gate by introducing a dual-target triggering mechanism. This disordered nature allows miRNA-141 and APE1 to trigger reactions in any order or simultaneously, overcoming the time-dependent limitations of traditional biosensing. Experiments using target concentration gradients demonstrate that cascade signal amplification is activated only when miRNA-141 and APE1 are present simultaneously. Intracellular fluorescence imaging experiments show that this strict "AND" logic gate can effectively distinguish between breast cancer cells MDA-MB-231 and normal cells HK-2, providing visual validation for the specific identification of tumor cells and offering a new approach to molecular logic gating platforms for the joint detection of multiple biomarkers. Attached Figure Description
[0032] Figure 1 The images shown are transmission electron microscopy (TEM) characterization images of AuNPs and AuNPs-crRNA-DNAzyme complexes in the examples (where A represents AuNPs; B and C represent AuNPs-crRNA-DNAzyme complexes).
[0033] Figure 2 The UV-Vis spectra, particle size, and zeta potential characterization diagrams of AuNPs and the AuNPs-crRNA-DNAzyme complex in the examples are shown below (where A is the UV-Vis spectrum; B is the particle size distribution diagram; and C is the zeta potential).
[0034] Figure 3 This is a schematic diagram illustrating the working principle of the detection system of the present invention.
[0035] Figure 4 The fluorescence spectrum analysis diagram and logic gate disorder verification diagram of the detection system are shown (where A is the fluorescence emission spectrum of the system under different conditions; B is the effect of the sample addition order of the AND logic gate).
[0036] Figure 5 Agarose gel electrophoresis image (2 µmol / L DNA, 37℃ reaction for 120 min) to verify the feasibility of the detection principle.
[0037] Figure 6 The results of the optimized reaction conditions are shown in the figure (A represents the optimized ratio of locked crRNA to AuNPs; B represents the optimized ratio of locked zyme to AuNPs; C represents the optimized amount of AuNPs-DNA).
[0038] Figure 7The results of the optimized reaction conditions are shown in the figure (A is the optimization of DNAzyme reaction time; B is the optimization of Cas12a concentration; C is the optimization of FQ probe concentration; D is the optimization of CRISPR-Cas12a reaction time).
[0039] Figure 8 The graphs show the performance of the disordered logic gate-based CRISPR-Ca12a system for the analysis and detection of miRNA-141 and APE1 (A is the fluorescence emission spectrum of the system at different concentrations; B is the relationship between the fluorescence intensity change (F-F0) of the system and the concentration of the target miRNA-141, with the inset showing the working curve of miRNA-141; C is the fluorescence emission spectrum of the system at different concentrations; D is the relationship between the fluorescence intensity change (FF0) of the system and the concentration of the target APE1, with the inset showing the working curve of APE1).
[0040] Figure 9 The diagram shows the specificity analysis of the detection system. In this diagram, A represents the miRNA specificity analysis of the system (8 nmol / L miRNA-141, 80 nmol / L homologous miRNA); B represents the APE1 specificity analysis of the system (4.5 U / mL APE1, 45 U / mL other nucleases).
[0041] Figure 10 The figure shows the results of the analysis of miRNA-141 and APE1 content in different cell lines and cell numbers.
[0042] Figure 11 This is a confocal fluorescence imaging analysis of different live cells based on the system of this invention. Detailed Implementation
[0043] To more clearly illustrate the present invention, the following specific embodiments will be used to further explain the invention.
[0044] The chemical reagents and pharmaceuticals used in each embodiment of this invention are shown in Table 1. All reagents met analytical grade purity standards. The instruments and equipment used in the experiments are shown in Table 2. All centrifuge tubes, pipette tips, and DNA sequences purified by high-performance liquid chromatography (HPLC) were purchased from Shanghai Sangon Biotech Co., Ltd. The oligonucleotide sequences used in this experiment are shown in Table 3. The MDA-MB-231 cells, HeLa cells, and HL-7702 cells used in the experiments were purchased from the Cell Bank / Stem Cell Bank of the Chinese Academy of Sciences.
[0045] Table 1 Main Reagent Materials
[0046] reagents Specification Supplier Tris(hydroxymethyl)aminomethane 500 g Shanghai Sangon Biotech Co., Ltd. Sodium chloride 500 g Guangdong Xilong Chemical Co., Ltd. Sodium dihydrogen phosphate 500 g Guangdong Xilong Chemical Co., Ltd. Trisodium citrate 500 g Guangdong Xilong Chemical Co., Ltd. Sodium hydrogen phosphate 500 g Guangdong Xilong Chemical Co., Ltd. Chloroauric acid trihydrate 10 g Shanghai Aladdin Biochemical Technology Co., Ltd. Tris(2-carboxyethyl)phosphine hydrochloride 250 g Shanghai Aladdin Biochemical Technology Co., Ltd. Magnesium chloride hexahydrate 500 g Beijing Huawi Ruike Chemical Co., Ltd. Tween-20 500 mL Beijing Solarbio Technology Co., Ltd. Lipofectamine® 3000 Reagent Kit 1 mL Thermo Fisher Scientific DMEM culture medium 500 mL Thermo Fisher Scientific RPMI 1640 culture medium 500 mL Thermo Fisher Scientific Opti-MEM culture medium 500 mL Thermo Fisher Scientific fetal bovine serum 500 mL Shanghai Ekosei Biological Products Co., Ltd. Hoechst 33342 staining solution 1 mL Beijing Solarbio Technology Co., Ltd. Trypsin-EDTA digestion solution 100 mL Beijing Solarbio Technology Co., Ltd. Penicillin-streptomycin mixture 100 mL Beijing Solarbio Technology Co., Ltd. confocal dish 35 mm Lanjie Technology Co., Ltd.
[0047] Table 2 Main Instruments
[0048] instrument model Supplier Dynamic light scattering instrument Zetasizer Nano ZS Shanghai Sibaiji Instrument Systems Co., Ltd. Transmission electron microscope Talos F200S Thermo Scientific Fluorescence spectrophotometer LS-55 Perkin Elmer Gel imaging system Omega 16 µLtra-Lum UV-Vis spectrophotometer Cary-60 Agilent Technologies Ultrasonic instrument KQ5200B Kunshan Ultrasonic Instruments Co., Ltd. Smart pH meter PHS-3C Chengdu Century Ark Technology Co., Ltd. Miniature vortex mixer XW-80A Huxi Instrument Factory Co., Ltd. Ultrapure water system Direct-Q3 Merck Millipore High-speed refrigerated centrifuge TGL-16M Xiangyi Co., Ltd. Super constant temperature water bath DKB-501A Jinghong Experimental Equipment Co., Ltd. Micro-wave oven M1-L213B Midea Kitchen Appliances Manufacturing Co., Ltd. Inverted fluorescence microscope TE2000-S Nikon Corporation Ultrasonic device FS-150N Shanghai Shengxi Ultrasonic Instruments Co., Ltd. Two-photon laser confocal microscope TCS SP8 DIVE Leica, Germany
[0049] Table 3. DNA and RNA sequences used in the experiment
[0050] Serial Number name Sequence (5'-3') SEQ ID NO: 1 DNAzyme AAGATGGCAACTTTCTCCGAGCCGGTCGAAATATAACACTG SEQ ID NO: 2 DNAzyme-SH HS-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCAACTTTCTCCGAGCCGGTCGAAATATAACACTG SEQ ID NO: 3 Locker-zyme CCATCTTTACCAGACAGTGTTATATTTCAGAAAGTTGG SEQ ID NO: 4 Cr-RNA UAAUUUCUACUAAGUGUAGAUCAGGACAGGCACAAACACGC SEQ ID NO: 5 Locker-crRNA GCGGTTTTTCCCACTAT / rA / GGAAAGTTGTTGCCTGTCCTG / idSp / ATCTACACTTTTCCCACTAT / rA / GGAAAGTTGTTAGTAGAAATATTTTTTTTTTTTTTTT-HS-SH SEQ ID NO: 6 Activation chain GCGTGTTTGTGCCTGTCCTG SEQ ID NO: 7 FQ probe FAM -TTTTTTTT-BHQ1 SEQ ID NO: 8 miRNA-141 UAACACUGUCUGGUAAAGAUGG SEQ ID NO: 9 mimic-miRNA-141 TAACACTGTCTGGTAAAGATGG SEQ ID NO: 10 antisequence of miRNA-141 CCATCTTTACCAGACAGTGTTA SEQ ID NO: 11 miRNA-21 UAGCUUAUCAGACUGAUGUUGA SEQ ID NO: 12 miRNA-122 UGGAGUGUGACAAUGGUGUUUG SEQ ID NO: 13 Let-7a UGAGGUAGUAGGUUGUAUAGUU SEQ ID NO: 14 miRNA-221 ACCUGGCAUACAAUGUAGAUUU SEQ ID NO: 15 miRNA-223 UGUCAGUUUGUCAAAUACCCCA SEQ ID NO: 16 NC Chain UUCUCCGAACGUGUCACGUTT
[0051] Preparation of the required solution:
[0052] (1) 20 mmol / L Tris-HCl buffer: 20 mmol / L Tris, 100 mmol / L NaCl, 10 mmol / L MgCl2, pH 7.4;
[0053] (2) NEBufferr 2.1 (1×): 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg / mLBSA, pH 7.9;
[0054] (3) TBE buffer (1×): 90 mmol / L Tris-H3BO3, 2 mmol / L EDTA, pH 8.3;
[0055] (4) Cell incubation reaction solution:
[0056] Solution A: Mix 7 μL of Lipofectamine® 3000 reagent with 390 μL of Opti-MEM medium thoroughly and let stand for 5 min;
[0057] Solution B: Take 7 μL of Lipofectamine® 3000 reagent, 18 μL of AuNPs-crRNA-DNAzyme complex, 6.5 nmol / L Cas12a, 5 nmol / L activating strand, 0.2 μmol / L FQ probe and mix thoroughly with 400 μL of Opti-MEM medium, and let stand for 5 min;
[0058] Mix solution A and solution B to obtain the cell incubation reaction solution, and let it stand for 15 min for later use.
[0059] Example 1:
[0060] This embodiment constructs a CRISPR-Ca12a system based on "AND" disordered logic gates, including the following steps:
[0061] (1) Preparation of gold nanoparticles (AuNPs):
[0062] This embodiment uses the sodium citrate reduction method to prepare gold nanoparticles. Specifically, the solution of chloroauric acid trihydrate (HAuCl4·3H2O) in a round-bottom flask was heated in an oil bath with vigorous stirring. After boiling, trisodium citrate solution was added, and stirring and heating continued. When the solution in the flask turned from blue-purple to wine-red, the reaction was continued for 15 minutes. After heating was stopped, stirring was maintained, and the solution was allowed to cool naturally to room temperature. After cooling, the resulting solution was centrifuged at 11,000 rpm for 40 min. The solution was carefully removed, ultrafiltered, and collected. Finally, the prepared AuNPs solution was stored at 4°C.
[0063] (2) Modification and activation of DNA strands:
[0064] Thiol modification was performed at the 5' end of DNAzyme (sequence shown in SEQ ID NO: 1) to obtain DNAzyme-SH (sequence shown in SEQ ID NO: 2). DNAzyme-SH was annealed with the first blocking strand (sequence shown in SEQ ID NO: 3) at a molar ratio of 1:1.1 in a water bath (90℃-25℃) to form a blocked DNAzyme complex. It was then activated with tris(2-carboxyethyl)phosphonate (TCEP-HCl) at a molar ratio of 1:200 at room temperature for 2 h to open the disulfide bonds.
[0065] Thiolation modification was performed on the 3' end of Locker-crRNA to obtain modified Locker-crRNA (sequence shown in SEQ ID NO: 5). The crRNA (sequence shown in SEQ ID NO: 4) and the second blocking strand Locker-crRNA (sequence shown in SEQ ID NO: 5) were annealed in a water bath (90℃-25℃) at a molar ratio of 1:1.1 to form a blocked crRNA complex. The complex was then activated with tris(2-carboxyethyl)phosphonate (TCEP-HCl) at a molar ratio of 1:200 at room temperature for 2 h to open the disulfide bond.
[0066] (3) Assembly:
[0067] The activated blocking DNAzyme complex, blocking crRNA complex, and AuNPs solution were mixed in a certain proportion, and an appropriate amount of TE solution was added to prevent aggregation. The mixture was then frozen at -20°C. After freezing, a PBS-Tween mixture was added to the solution. After the solution dissolved, it was centrifuged at 10,000 rpm, and the AuNPs-DNA complex was collected. Finally, it was resuspended in Buffer 2.1.
[0068] The prepared AuNPs and AuNPs-DNA complexes were characterized using transmission electron microscopy (TEM), ultraviolet-visible spectroscopy (UV-Vis), and dynamic light scattering (DLS). The results are as follows: Figure 1 , Figure 2 As shown.
[0069] TEM images show that AuNPs exhibit a monodisperse spherical morphology with a uniform particle size distribution. Figure 1 A). After nucleic acid modification, a transparent nucleic acid coating layer can be observed on the periphery of the nanoparticles. Figure 1 B, C).
[0070] DLS characterization results show that the hydrated particle size of unmodified AuNPs is 30 nm, and the surface Zeta potential is -15.4 mV; while after DNA modification, the hydrodynamic diameter of the AuNPs-DNA complex increases to 68 nm, and the surface potential shifts negatively to -32.5 mV. Figure 2 As shown in Figures B and C, this change confirms the efficient assembly of negatively charged DNA molecules on the AuNPs surface. Meanwhile, as shown in Figure 2A, the UV-Vis spectrum reveals that AuNPs exhibit characteristic absorption at 520 nm, while AuNPs-DNA shows a characteristic nucleic acid absorption peak at 260 nm, and the absorption peak at 520 nm also shows a slight red shift.
[0071] The results above demonstrate that thiol-modified DNA was successfully anchored to the surface of gold nanoparticles AuNPs via Au-S bonds.
[0072] In addition, the schematic diagram of the detection principle of the system constructed in this embodiment is as follows: Figure 2 As shown, the specific working principle of this system is as follows:
[0073] like Figure 1 As shown in Figure A, a blocking DNAzyme (sequence as shown in SEQ ID NO: 3) and a blocking crRNA (sequence as shown in SEQ ID NO: 5) are first labeled on the surface of gold nanoparticles AuNPs. The blocking DNAzyme comprises a DNAzyme sequence and a first blocking strand that blocks the activity of the DNAzyme sequence. The first blocking strand contains a sequence complementary to the target miRNA-141 (sequence as shown in SEQ ID NO: 10). The blocking crRNA comprises a crRNA sequence and a second blocking strand that blocks the activity of the crRNA. The second blocking strand contains the cleavage substrate sequence of the DNAzyme (sequence as shown in SEQ ID NO: 5) and the cleavage site of APE1.
[0074] In the presence of miRNA-141 (path 1), miRNA-141 (sequence shown in SEQ ID NO: 8) displaces the first blocking strand of the DNAzyme, exposing the DNAzyme. The exposed DNAzyme can act as the arm of AuNPs to cleave surrounding rA sites. The crRNA after the rA sites are cleaved remains in a blocked state. In the presence of another target, APE1, APE1 cleaves the AP site, breaking the second blocking strand and releasing the crRNA into the solution. At this point, Cas12a protein and its activation strand are added, which bind to the free crRNA. The activated CRISPR-Ca12a can trans-cleave the FQ probe, moving the FAM fluorescent group away from the BHQ quenching group, and the fluorescence signal is restored.
[0075] In the presence of the target APE1 (pathway 2), APE1 cleaves the AP site, and the crRNA remains in a closed state. When another target miRNA-141 is present, the exposed DNAzyme cleaves the surrounding rA sites, the second blocking strand falls off, and the crRNA is released. Under the action of Cas12a, it cleaves the FQ probe, and the fluorescence signal is restored.
[0076] It is evident that both pathway 1 and pathway 2 only output signals when both miRNA-141 and APE1 are present simultaneously. This is achieved by simultaneously activating the "AND" logic gate of both miRNA-141 and APE1, thus enabling the simultaneous detection of both miRNA-141 and APE1 biomarkers. Figure 1 B), to improve the accuracy of detection and tumor cell imaging.
[0077] Example 2:
[0078] This embodiment verifies the feasibility of the detection principle of the system constructed in Embodiment 1, as follows:
[0079] (1) Fluorescence spectroscopy verification:
[0080] Different concentrations of miRNA-141 and APE1 were added to 1.8 μL of AuNPs-DNA complex, and then diluted to 20 μL with Tris-HCl buffer. After reacting for 2 h, 6.5 nmol / L Cas12a protein, 0.2 μmol / L FQ probe (sequence shown in SEQ ID NO: 7), and 5 nmol / L activation strand (sequence shown in SEQ ID NO: 6) were added. After reacting for 20 min, the fluorescence intensity was measured. The fluorescence measurement parameters were: voltage 600 V, excitation and emission slits both 10 nm, excitation wavelength 488 nm, and fluorescence intensity changes of the reaction solution recorded at an emission wavelength of 520 nm.
[0081] The results are as follows Figure 4 As shown in Figures 4A and 4B, the fluorescence signal changes are not significant when only miRNA-141 or only APE1 is present. Only when both target miRNAs, miRNA-141 and APE1, are present does the system exhibit a noticeable fluorescence signal. Furthermore, regardless of whether miRNA-141 is added first and APE1 is added 20 min later, or vice versa, the system is activated and the resulting fluorescence signal shows little difference. This further demonstrates that the designed CRISPR-Cas12a logic gate detection system can achieve the joint detection of miRNA-141 and APE1 in any order or simultaneously using an "AND" disordered logic gate.
[0082] (2) Gel electrophoresis verification:
[0083] Weigh 2.2 g of agarose and mix it with 55 mL of TBE (1×) buffer. Heat the mixture in a microwave oven until boiling, then remove and shake to remove air bubbles. Repeat twice. After the third boiling, when no air bubbles remain, pour the mixture into a gel mold and allow it to cool naturally to prepare a 5% gel. Add 1.2 μL of nucleic acid dye and 1.0 μL of Gel Red to a centrifuge tube after the reaction has completed, mix well, and then add the mixture to the gel wells. Place the gel in an electrophoresis tank and pour in TBE solution until the gel is completely submerged. Electrophoresis is performed at a constant voltage of 100 V for 1 h. After electrophoresis, remove the gel, rinse with tap water, and then scan and image using an Omega 16ic gel imaging system.
[0084] Experimental results are as follows Figure 5 As shown.
[0085] As can be seen from Figure 5, both the blocked DNAzyme and the blocked crRNA can form their own stable structures (lanes 3 and 5). No other new bands appeared when they coexisted (lane 6), indicating that the two will not hybridize in the absence of miRNA-141 and APE1.
[0086] When the blocked DNAzyme reacted with the target miRNA-141, a new band was generated (lane 4), and the original blocked DNAzyme band disappeared, indicating that the target miRNA-141 could effectively open the blocked DNAzyme. However, after the opened DNAzyme reacted with the blocked crRNA, the band of the blocked crRNA did not disappear (lane 7), indicating that the blocked crRNA was still in a blocked state at this time.
[0087] Furthermore, when APE1 was reacted with the blocking crRNA, the band of the blocking crRNA remained (lane 8), because APE1 alone could not open the blocking crRNA and trigger the reaction. However, when miRNA-141 and APE1 were co-incubated with the blocking system, a new band was generated and the band belonging to the blocking crRNA disappeared (lane 9), indicating that the blocking crRNA could only be opened when miRNA-141 and APE1 were present together, strongly demonstrating the feasibility of this dual-target synergistic activation reaction principle.
[0088] Example 3: Optimization of Reaction Conditions
[0089] To achieve the best analytical results from the constructed CRISPR-Cas12a logic gate detection system, the reaction conditions, including the ligation ratio of AuNPs to blocking crRNA, the ligation ratio of AuNPs to blocking DNAzyme, the concentration of Cas12a protein, the concentration of FQ probe, and the reaction time, were optimized. F-F0 were used as the final signal output (F is the fluorescence signal intensity when the target is present in the system, and F0 is the fluorescence signal intensity when the target is absent in the system).
[0090] Given that the AuNPs-crRNA-DNAzyme complex is crucial to this detection system and determines the detection efficiency, the composition of the AuNPs-crRNA-zyme complex was first optimized, as shown in Figure 6A. As the ratio of blocked crRNA to AuNPs increased, more blocked crRNA was loaded onto the nanoparticles, leading to greater crRNA cleavage of the FQ probe and a corresponding increase in fluorescence signal. The optimal signal-to-noise ratio was achieved at an AuNPs-to-block crRNA ratio of 1:250. When the ratio of blocked crRNA continued to increase, the fluorescence signal remained almost unchanged. This may be because the blocked crRNA was too densely packed on the AuNPs surface, and the steric hindrance effect affected the subsequent cleavage of the crRNA blocking strand (second blocking strand) by the DNAzyme. Therefore, this application selected 1:250 as the optimal ratio of AuNPs to blocked crRNA.
[0091] Based on this, the loading ratio of AuNPs-crRNA and blocking DNAzyme was optimized, as shown in Figure 6B. When the ratio of AuNPs-crRNA to blocking DNAzyme was 1:80, the system achieved the optimal signal-to-noise ratio. This is because the DNAzyme, acting as the arm of AuNPs, can cleave surrounding crRNA blocking strands and then cleave other crRNA blocking strands at greater distances, thus improving cleavage efficiency. Therefore, 1:80 was chosen as the optimal ratio of AuNPs-zyme to DNAzyme.
[0092] The amount of AuNPs-crRNA-zyme complex, obtained by loading AuNPs with the optimal ratio of blocking DNA zyme and blocking crRNA, was then optimized, such as... Figure 6 As shown in Figure C, when the volume of the AuNPs-crRNA-zyme complex reaches 1.8 μL, the signal recovery of the system gradually tends to plateau. Therefore, 1.8 μL is selected as the optimal volume of the AuNPs-crRNA-zyme complex.
[0093] This application also investigated the DNAzyme cleavage reaction time, and the results are shown in Figure 7A. The fluorescence signal recovered with increasing reaction time. The signal-to-noise ratio reached its highest value at a reaction time of 2 h. Therefore, we selected a DNAzyme cleavage reaction time of 2 h. Compared to existing analytical systems, the DNAzyme cleavage time was reduced by half.
[0094] Furthermore, the concentration of Cas12a protein, as the core of the signal release reaction process, also significantly affects the signal-to-noise ratio (SNR) of the final detection. The optimized Cas12a protein concentration is shown in Figure 7B. As the Cas12a protein concentration increases, the fluorescence of the system recovers rapidly. The highest SNR is achieved at a Cas12a protein concentration of 6.5 nmol / L. Therefore, a Cas12a protein concentration of 6 nmol / L was selected as the optimal reaction condition.
[0095] Subsequently, to improve the fluorescence recovery of the system, we optimized the concentration of the FQ probe, and the results are as follows: Figure 7 As shown in Figure C, the fluorescence change in the system gradually increases with the increase of the FQ probe concentration, and finally the system reaches the highest signal-to-noise ratio when the FQ probe concentration is 2 µmol / L. Therefore, we choose 2 µmol / L as the optimal concentration of the FQ probe.
[0096] Finally, we optimized the action time of the Cas12a protein, such as... Figure 7 As shown in Figure D, the fluorescence signal of the system increases with increasing reaction time of Cas12a protein, and then plateaus after 20 min. Therefore, 20 min was chosen as the reaction time for Cas12a in this experiment.
[0097] Example 4:
[0098] Under the optimal conditions obtained in Example 3, this example investigated the fluorescence spectra of the system at different target concentrations and the relationship between the concentrations of the two targets and the changes in the fluorescence intensity (F-F0). The results are as follows: Figure 8 As shown.
[0099] At an APE1 concentration of 50 U / mL, the fluorescence intensity and fluorescence change value (F-F0) gradually increased with increasing miRNA-141 concentration. When the miRNA-141 concentration was between 15 pmol / L and 10 nmol / L, the fluorescence change value (F-F0) showed a good linear relationship with the miRNA-141 concentration, with the linear equation: (F-F0) = 6.31 + 30.96C (R² = 0.9917). The detection limit of this method was 13 pmol / L (S / N = 3).
[0100] At a miRNA-141 concentration of 1 μmol / L, the fluorescence intensity and fluorescence change value (F-F0) gradually increased with increasing APE1 concentration. Within the APE1 concentration range of 0.01 U / mL to 5.5 U / mL, the fluorescence change value (F-F0) showed a good linear relationship with the APE1 concentration, with the linear equation: (F-F0) = 5.23 + 50.74C (R² = 0.9944). The detection limit of this method was 0.0096 U / mL (S / N = 3).
[0101] Example 5:
[0102] like Figure 9 As shown, this embodiment examines the specificity of the constructed CRISPR-Cas12a logic gate system for two target analytes, miRNA-141 and APE1, as detailed below:
[0103] First, using the system constructed in Example 1 and the working principle of this system described, the fluorescence intensity change of the system in the presence of homologous miRNAs 10 times greater than the target miRNA-141 was analyzed. When the concentration of miRNA-141 was 8 nmol / L and the concentration of other miRNAs was 80 nmol / L, the fluorescence signal of the system was as follows: Figure 9 As shown in Figure A, it can be seen from the figure that the fluorescence intensity of the system only changes significantly in the presence of miRNA-141.
[0104] Similarly, when the concentration of APE1 was 4.5 U / mL and the concentration of other nucleases was 45 U / mL, the fluorescence signal of the system was as follows: Figure 9 As shown in Figure B, the fluorescence intensity of the system only changed significantly in the presence of APE1; other proteases had no significant effect on the determination of APE1. These results demonstrate that this method has good specificity for both miRNA-141 and APE1 analytes.
[0105] Example 6:
[0106] To examine the anti-interference ability of this strategy in actual sample detection, this embodiment used a spiked recovery method to determine the measured values and recovery rates of different concentrations of miRNA-141 and APE1 in MDA-MB-231 cell lysates. The results are shown in Tables 4 and 5. The spiked recoveries of miRNA-141 and APE1 in MDA-MB-231 cell lysates were between 97.07% and 105.67% and 97.95% and 103.29%, respectively, with RSDs between 2.55% and 4.57% and 2.56% and 5.10%, respectively, indicating that this method is reliable in actual sample analysis.
[0107] Table 4. Analysis of miRNA-141 in MAD-MB-231 cell lysates (CAPE1 = 50 U / mL)
[0108] Sample number Original content (nmol / L) Dosage (nmol / L) Measurement volume (nmol / L) Recovery rate (%) RSD (%) 1 0.14 0.50 0.67 105.67% 4.57% 2 0.14 2.00 2.07 97.07% 3.27% 3 0.14 5.00 5.25 102.17% 2.55%
[0109] Table 5. APE1 analysis in MAD-MB-231 cell lysates (CmiRNA-141 = 1 μmol / L)
[0110] Sample number Original content (U / mL) Dosage (U / mL) Measured amount (U / mL) Recovery rate (%) RSD (%) 1 0.24 0.50 0.72 97.95% 5.10% 2 0.24 1.00 1.28 103.29% 3.92% 3 0.24 3.00 3.27 100.98% 2.56%
[0111] In addition, this embodiment utilizes the established CRISPR-Cas12a logic gate detection system to analyze the levels of miRNA-141 and APE1 in different types and quantities of cells. Specifically:
[0112] (1) Cell culture:
[0113] MDA-MB-231 breast cancer cells, HepG2 liver cancer cells, and HK-2 renal tubular epithelial cells were cultured in a constant temperature incubator at 37°C and 5% CO2. MDA-MB-231 and HepG2 cells were cultured in DMEM basal medium supplemented with 10% fetal bovine serum (FBS) and 100 U / mL penicillin-streptomycin. HK-2 cells were cultured in F12 complete medium. After the cells nearly filled the culture flasks, they were passaged. Impurities and floating cells were washed away with PBS buffer. 2 mL of trypsin was added. Under a microscope, the cells were observed to become rounded and some cells were found to be floating. Medium was then added to stop the digestion reaction. The cells were then repeatedly pipetted until adherent cells were suspended in the solution. All these procedures were performed under sterile conditions.
[0114] (2) Analysis of miRNA-141 and APE1 in cell lysate:
[0115] When the cells in the cell culture flasks were almost confluent, they were treated with trypsin, then repeatedly pipetted with culture medium to suspend the adherent cells. The culture medium was removed by centrifugation at 1200 r / min, and the cells were washed three times with PBS buffer, then resuspended in Tris-HCl buffer to a cell density of 1.0 × 10⁻⁶ cells / mL. 6 Cells / mL. The resuspended cells were placed in an ice-water bath and sonicated at 80 W for 40 min to disrupt the cell lysate. The disrupted cell lysate was centrifuged at 4°C and 12,000 rpm for 20 min, and the supernatant was used as the cell lysis buffer for fluorescence detection according to the conditions in step (1) of Example 2.
[0116] The results are as follows Figure 10 As shown, the detection signals of both markers increased with increasing cell count in the lysed sample, exhibiting high expression levels in metastatic breast cancer cells MDA-MB-231 and low expression levels in normal renal tubular epithelial cells HK-2, consistent with previous reports. Both the spiked recovery results and cell lysate analysis indicate that this CRISPR-Cas12a logic gate analysis method demonstrates good reliability and high sensitivity in practical sample analysis. Furthermore, this method accurately reflects the expression levels of tumor cell-specific markers miRNA-141 and APE1, and can serve as an auxiliary tool for tumor diagnosis and prognostic evaluation.
[0117] Example 7:
[0118] The CRISPR-Cas12a logic gate analysis system was incubated with three cell lines via liposome transfection, followed by two-photon laser confocal imaging for the imaging analysis of miRNA-141 and APE1 in live cells. The specific steps are as follows:
[0119] 0.5 mL of the digested cell suspension was added to a confocal dish, followed by 1 mL of culture medium. After cell attachment, the old culture medium was removed, and the cells were washed with PBS buffer. Then, 1 mL of Opti-MEM medium was added, and the cells were starved for 1 h. After starvation, the prepared cell incubation reaction solution and 5 μL of Hoechst 33342 nuclear staining agent were added to the confocal dish, and the dish was returned to the incubator for 3 h. After the reaction, the cells were removed, washed with PBS buffer, and analyzed using a laser confocal microscope for fluorescence imaging.
[0120] The results are as follows Figure 11As shown, a significant fluorescence signal was observed in MDA-MB-231 cells, while fluorescence was very weak in HepG2 cells and almost non-existent in HK-2 cells. This indicates that the expression levels of miRNA-141 and APE1 are high in MDA-MB-231 cells, hence the observed significant fluorescence recovery. In HepG2 cells, the expression levels are low, resulting in insignificant fluorescence recovery, while in HK-2 cells, the expression levels are the lowest, with almost no fluorescence recovery, consistent with previous reports. This demonstrates that the CRISPR-Cas12a logic gate analysis system can be used for fluorescence imaging analysis of different cells and can specifically identify cancer cells and normal cells.
[0121] In summary, this invention successfully constructed a CRISPR-Cas12a system based on disordered "AND" logic gates, achieving synergistic recognition and signal amplification of miRNA-141 and APE1 dual biomarkers, providing a method with good specificity for the synergistic detection of dual-target molecules. Notably, the spatial confinement effect of gold nanoparticles significantly improved the reaction efficiency, by approximately 100% compared to existing technologies.
[0122] Compared to traditional single-target detection strategies, the system constructed in this application establishes a disordered logic gate by introducing a dual-target triggering mechanism. This disordered nature allows miRNA-141 and APE1 to trigger reactions in any order or simultaneously, overcoming the time-dependent limitations of traditional biosensing. Experiments using target concentration gradients demonstrate that the cascade signal amplification is activated only when miRNA-141 and APE1 are present simultaneously. Intracellular fluorescence imaging experiments show that this strict "AND" logic gate can effectively distinguish between breast cancer cells MDA-MB-231 and normal cells HK-2, providing visual validation for the specific identification of tumor cells and offering a new approach to molecular logic gating platforms for the joint detection of multiple biomarkers.
[0123] The above description is a detailed description of the preferred embodiments of the present invention. However, the embodiments are not intended to limit the scope of the patent application of the present invention. All equivalent changes or modifications made under the technical spirit of the present invention should fall within the patent scope covered by the present invention.
Claims
1. A CRISPR-Ca12a system based on "AND" unordered logic gate, characterized in that, The system comprises: (1) a gold nanoparticle carrier; (2) a blocked DNAzyme and a blocked crRNA fixed on the surface of the gold nanoparticle carrier through Au-S bonds; the blocked DNAzyme comprises a DNAzyme sequence and a first blocking strand for blocking the activity of the DNAzyme sequence; the first blocking strand comprises a sequence complementary to the target miRNA-141; the blocked crRNA comprises a crRNA sequence and a second blocking strand for blocking the activity of the crRNA; the second blocking strand comprises a cleavage substrate sequence of the DNAzyme and a cleavage site of APE1; (3) a Cas12a protein and an activation strand; (4) a signal reporter probe F-Q labeled with a fluorescent group and a quencher group, the sequence of which can be non-specifically cleaved by the activated CRISPR-Ca12a; wherein the presence of the target miRNA-141 can release the blocking of the DNAzyme through strand displacement reaction, and the activated DNAzyme can cleave the second blocking strand; the presence of APE1 can cleave the cleavage site on the second blocking strand; only when the target miRNA-141 and APE1 exist simultaneously, the crRNA can be completely released, and then the Cas12a protein binds with the released crRNA and the activation strand, and the activated Cas12a complex cleaves the signal reporter probe F-Q to generate a detection signal.
2. The system of claim 1, wherein, The system has no order, that is, the order of the target miRNA-141 and APE1 triggering the reaction does not affect the generation of the final detection signal.
3. The system of claim 1, wherein, The sequence of the DNAzyme is shown in SEQ ID NO: 1, or a functional variant thereof.
4. The system of claim 1, wherein, The sequence of the crRNA is shown in SEQ ID NO: 4, or a variant capable of guiding the Cas12a protein to cleave the reporter probe.
5. The system of claim 1, wherein, The sequence of the blocked DNAzyme is shown in SEQ ID NO: 3; the sequence of the blocked crRNA is shown in SEQ ID NO:
5.
6. The system of claim 1, wherein, The molar ratio of the gold nanoparticle to the blocked DNAzyme is 1:80; the molar ratio of the gold nanoparticle to the blocked crRNA is 1:
250.
7. A method of simultaneous detection of miRNA-141 and APE1 using the system of any one of claims 1-6, characterized in that, The system comprises the following steps: (1) mixing and incubating the sample to be tested with the gold nanoparticle carrier loaded with the blocked DNAzyme and the blocked crRNA on the surface, so that the target miRNA-141 and / or APE1 react with the corresponding complex; (2) adding the Cas12a protein, the activation strand and the signal reporter probe F-Q to the reaction system; (3) detecting the signal generated after the signal reporter probe F-Q is cleaved, wherein the appearance of the detection signal indicates that the target miRNA-141 and APE1 exist simultaneously in the sample to be tested.
8. The method of claim 7, wherein, In step (1), the target miRNA-141 and the APE1 can be added in any order or simultaneously.
9. The method of claim 7, wherein, The sample to be tested is a cell lysate or a live cell culture system treated with a transfection reagent.
10. Use of the system according to any one of claims 1-6 for detecting the target miRNA-141 and the APE1 and for distinguishing between tumor cells and normal cells.