Early-maturing and high-yield morchella septimelata and molecular marker thereof

Abstract

The invention discloses early-maturing and high-yield morchella septimelata and a molecular marker thereof. The preservation number of the morchella septimelata is CCTCC (China Center For Type Culture Collection) NO: M 20252848. The whole anti-season planting period of the strain provided by the invention is 50-60 days, and is shortened by about 20 days compared with that of a conventional septimelate variety; the whole period of in-season cultivation (sowing in 11-December) is 60-90 days and is shortened by about one month compared with that of a conventional sextelate variety, fruiting can be achieved before the Spring Festival, and the high-temperature risk in spring is effectively avoided; the yield is improved by more than 50% compared with that of a conventional variety, and white mold infection is not easily caused. The invention also develops a strain specific InDel marker and a primer, which can be used for variety authenticity identification.

Description

Technical Field

[0001] This invention relates to the field of microorganisms, and more particularly to a high-yielding, early-maturing morel strain and its molecular markers. Background Technology

[0002] Morel mushrooms ( Morchella spp. Morel mushrooms are a precious and rare edible and medicinal fungus with a unique flavor, rich nutrition, and high market value. In recent years, the artificial cultivation of morels in my country has developed rapidly and has become an important characteristic industry for rural revitalization.

[0003] Currently, the main cultivated species in production is *Morchella esculenta* (also known as *Morchella esculenta*). M. sextelata ) and Seven Sister Morel Mushrooms ( M. eximia Morel mushrooms are low-temperature fungi, and existing varieties have a long fruiting cycle, with peak fruiting concentrated in the spring when temperatures rise. At this time, temperature fluctuations are large, and abnormally high temperatures are common, leading to the death of young mushrooms, contamination by other fungi, and severe yield reduction or even crop failure. Therefore, breeding early-maturing, high-yielding new morel varieties to achieve staggered fruiting and avoid the risks of high temperatures is of great significance for the healthy development of the industry. Summary of the Invention

[0004] This invention aims to provide an early-maturing and high-yielding *Morchella esculenta* strain, JSQM01, along with its specific molecular markers and corresponding cultivation methods. This invention isolates and selects a new *Morchella esculenta* strain, JSQM01, from a wild population in Lijiang, Yunnan. Its cultivation cycle is significantly shorter than that of conventional *Morchella esculenta* varieties, and it exhibits high yield and good stability, making it particularly suitable for cultivation in the warm winters of southern China and during the peak growing season in northern China.

[0005] To solve the above-mentioned technical problems, the technical solution of the present invention is as follows: In a first aspect, the present invention provides a strain of *Morchella esculenta* (also known as *Morchella esculenta*). Morchella eximia The strain JSQM01 was deposited at the China Center for Type Culture Collection on December 10, 2025, with accession number CCTCC NO: M 20252848.

[0006] In a second aspect, the present invention provides a specific molecular marker for identifying the strain JSQM01, the molecular marker being a specific insert located at position 241024 of the Scaffold-2 genome, the sequence of which is shown in SEQ ID NO: 1.

[0007] In a third aspect, the present invention provides specific primers for detecting the molecular marker, the primer sequences being shown in SEQ ID NO: 2 and SEQ ID NO: 3.

[0008] In a fourth aspect, the present invention also provides a nucleotide sequence for identifying *Morchella esculenta* JSQM01 based on the specific primers described above, the nucleotide sequence being shown in SEQ ID NO: 7.

[0009] In a fifth aspect, the present invention also provides a cultivation method for the strain JSQM01, including spawn preparation, soil treatment, sowing, nutrient bag placement, fruiting management and harvesting steps. By controlling the sowing period, nutrient supply and environmental control, harvesting can be achieved 50-90 days after sowing, which is about one month earlier than the conventional Qimei variety.

[0010] strain preparation The mother culture was prepared using PDA medium; the original culture medium formula was: wheat 88-92%, sawdust 8-12%, corn cob 8-12%, quicklime 0.8-1.3% and gypsum 1.0-2.0%; the cultivar formula was: wheat 60-65%, sawdust 25-30%, rice husk 5-8%, quicklime 1-3% and gypsum 1-3%.

[0011] Field cultivation Soil treatment: Adjust pH to 6.5-7.8, deep plow and sterilize by fumigation; Sowing: Sow when the soil temperature is consistently below 18℃, using 350-400 catties of inoculum per mu, and cover with 2-5 cm of soil; Nutrient bag application: 7-10 days after sowing, apply 2500 nutrient bags per mu (667 square meters). Mushroom management: After primordia formation, stimulate with light for 4-5 days, then water thoroughly to promote mushroom growth; Harvesting: Harvest the fruiting bodies promptly after they mature.

[0012] The nutrient bag formula contains 35-45% wheat, 50-60% corn cob, 0.8-1.2% quicklime, 1.5-2.0% gypsum, and 0.1-0.5% potassium dihydrogen phosphate.

[0013] Compared with the prior art, the present invention has the following beneficial effects: 1. Strong early maturity: The strain provided by this invention has a full cycle of 50-60 days for off-season cultivation, which is about 15 days shorter than the conventional Qimei variety; the full cycle of cultivation in the regular season (sowing around December) is 60-90 days, which is about one month shorter than the conventional Qimei variety, and the yield is increased by more than 50%. It can achieve fruiting before the Spring Festival and effectively avoid the risk of high temperature in spring.

[0014] 2. High yield: In northern regions such as Shandong, the yield of greenhouse cultivation can reach up to 1,700 kg per mu, while in southern regions it can reach 1,000 kg per mu. Off-season cultivation can yield up to 600 kg per mu, with a high proportion of marketable mushrooms and uniform mushroom shape.

[0015] 3. Clear molecular markers: This invention has developed strain-specific InDel markers and primers, which can be used for identification of variety authenticity.

[0016] 4. Prevention and control of white mold: The JSQM01 strain provided by this invention also has resistance to white mold.

[0017] 5. Wide range of adaptability: It is especially suitable for greenhouse cultivation areas in the north and production areas in the south such as Yunnan, Sichuan, Guizhou, Hunan and Hubei. Attached Figure Description

[0018] Figure 1 Phylogenetic tree of Morchella esculenta JSQM01 constructed using the NJ method; Figure 2 Electrophoresis results of mating type gene amplification of *Morchella esculenta* JSQM01; M: DNA marker DL2000; CK1: negative control; CK2: Mat1-1-1 positive control; CK3: Mat1-2-1 positive control; Figure 3 The field fruiting status of the Qimei morel mushroom JSQM01; Figure 4 Field performance of the early-maturing characteristics of Qimei Morel JSQM01; Left: Qimei Morel JSQM01; Right: Conventional Qimei variety; Figure 5 This is a field planting illustration of the peak season in southern China. Figure 6 The following images show the autumn field infection status of *Morchella esculenta* JSQM01; Left: *Morchella esculenta* JSQM01; Right: Conventional *Morchella esculenta*. Figure 7 This is a map showing the positions of the downstream primers of the molecular marker. Figure 8 Electrophoresis results of PCR products using specific primers for Morel JSQM01; M: DNA marker DL2000; CK: negative control. Detailed Implementation

[0019] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, but the present invention is not limited to the following technical solutions.

[0020] Example 1: Isolation and Identification of Strains JSQM01 In April 2021, a wild morel fruiting body was collected from Lijiang City, Yunnan Province. Several tissue blocks were taken in a clean bench, cleaned with sterile water, and cut into egg-sized pieces. These were then inoculated onto PDA agar plates and incubated at 23°C. When the tissue blocks germinated to 1-1.5 cm, fresh mycelia were transferred to fresh PDA agar plates and incubated at 23°C. Well-grown plates were stored at 4°C for later use.

[0021] Fresh mycelium of *Morchella esculenta* JSQM01 pure culture was collected, and genomic DNA was extracted using the CTAB method. The ITS sequence was amplified using the universal fungal primers ITS1 / ITS4 (SEQ ID NO: 4 ITS1: TCCGTAGGTGAACCTGCGG; SEQ ID NO: 5 ITS4: TCCTCCCGCTTATTGATATGC), and sequencing analysis was performed to determine species identity. The PCR reaction system was as follows: Premix Taq (Ex Taq Version 2.0 plus dye) (TaKaRa RR902Q), 12.5 μL; ITS1 (10 μmol / L), 0.5 μL; ITS4 (10 μmol / L), 0.5 μL; template DNA (100 ng / μL), 1 μL; ddH2O, to a final volume of 25 μL. The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 58℃ annealing for 30 sec, 72℃ extension for 1 min, 34 cycles; 72℃ final extension for 10 min. PCR products were stored at 4℃.

[0022] The PCR product was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing yielded an accurate target ITS sequence, as shown in SEQ ID NO: 6 (714bp).

[0023] The ITS sequence of this strain was downloaded as a reference sequence using BLAST from NCBI. A phylogenetic tree was constructed using the Neighbor-Joining method with MEGA 6.0 to identify it as *Morchella eximia*. It was named *Morchella eximiaJSQM01*. Figure 1 It was deposited at the China Center for Type Culture Collection on December 10, 2025, with accession number CCTCCNO: M 20252848.

[0024] Using the genomic DNA of *Morchella esculenta* JSQM01 as a template, mating type gene detection was performed. Gel analysis of the PCR products showed that this strain simultaneously contains both the MAT1-1-1 and MAT1-2-1 genes, exhibiting self-compatibility, which is beneficial for fruiting stability.

[0025] Example 2: Early-maturing cultivation method of Qimei Morel JSQM01 This embodiment details the early-maturing cultivation process of strain JSQM01 under two modes: regular season (winter planting) and autumn off-season, highlighting its significantly shorter growth cycle than conventional varieties.

[0026] After the microbial strains (mother culture, primary culture, and cultivated culture) are prepared, adjust the soil pH to 6.5–7.8, and perform deep plowing and fumigation for disinfection. Sowing should be done when the local temperature remains below 18℃, generally in December during the peak season, or in summer or autumn depending on the climate of high-altitude and cool regions. One week after sowing, mycelial bloom will begin to form, and nutrient bags should be placed about 10 days later. After placing the nutrient bags, they can be covered with black mulch.

[0027] The nutrient bag formula is as follows: wheat 40%, corn cob 57%, quicklime 1%, gypsum 1.75%, and potassium dihydrogen phosphate 0.25%. The moisture content of all nutrient materials is 65%–70%. Sterilize by high-temperature, high-pressure, and moist heat treatment at 0.11 MPa atmosphere and 121℃ for 2 hours. Let cool before use.

[0028] Once the nutrient bags begin to shrivel and primordia form, begin light stimulation (allowing sunlight to enter the greenhouse during the day). After 4-5 days, water thoroughly to promote mushroom growth. Young mushrooms will subsequently emerge. Maintain a constant temperature and humidity within the greenhouse. Harvest once the fruiting bodies have matured.

[0029] If pathogen infection is found during morel mushroom cultivation, the infected parts should be removed and disinfected in time; at the same time, good ventilation should be maintained in the cultivation shed to reduce the humidity of the soil and air and inhibit the reproduction and spread of pathogens.

[0030] Key points of cultivation methods To achieve early maturity, the following management measures are also required: Precision sowing: Use 350-400 catties of spawn per mu (equivalent to about 450-500 bags of cultivation spawn), cover with 2-5 cm of soil to ensure sufficient effective mycelial population per unit area, laying the foundation for rapid mycelial growth and fruiting.

[0031] Pre-planting nutrient management: 7-10 days after sowing, when the mycelium coverage on the soil surface reaches 70%, place sufficient nutrient bags (2500 bags per acre) in a timely manner. After making the incision, gently place them on the bed surface to promote the mycelium to absorb nutrients as early and as much as possible, and accelerate the transformation of mycelium from vegetative growth to reproductive growth.

[0032] Moisture: The mushroom-inducing water should be poured thoroughly at once to stimulate the simultaneous occurrence of primordia.

[0033] Temperature: During the fruiting period, use greenhouse film and shade netting to maintain the daytime temperature inside the greenhouse within a suitable range of 8-18℃, avoiding extreme low temperatures or premature high temperatures.

[0034] Gas: Keep the air inside the greenhouse fresh, with a carbon dioxide concentration below 700 ppm to prevent delayed or deformed fruiting bodies due to insufficient ventilation.

[0035] Preventive pest and disease control: Due to the early fruiting period, various pest and disease pressures may arise. Emphasis should be placed on preventing diseases (such as white mold) and slug damage under low temperature and high humidity conditions, adhering to the principle of prevention first, supplemented by physical control methods.

[0036] 1. Early-maturing cultivation model in northern China (Liaocheng, Shandong) Cultivation goal: To achieve early mushroom production in northern regions after the Spring Festival, seize the early market, and effectively avoid the high temperature risks commonly encountered after the Spring Festival.

[0037] Sowing period: December each year.

[0038] Key reproductive cycle Mycelial growth period: After sowing, maintain the average soil temperature in the greenhouse at around 10-18℃, replenish the nutrient bags in time, and the mycelium will quickly colonize and spread under suitable soil temperature.

[0039] Mushroom-inducing period: 47-55 days after sowing, when the mycelial bloom on the soil surface changes color and the nutrients in the nutrient bags are largely absorbed, water thoroughly to promote mushroom growth.

[0040] Harvesting period: The fruiting bodies will gradually mature 13-35 days after the fruiting process, and harvesting can begin.

[0041] Full growth period: Approximately 60-90 days from sowing to harvest. Throughout the growth cycle, pay attention to timely adjustments of light, temperature, and humidity within the greenhouse. The fruiting body size and yield of Qimei Morel JSQM01: High fruiting density, fruiting body length 13-17cm; Under the northern cotton quilt arched greenhouse model, considering specific conditions such as soil temperature, nutrient absorption, and weather changes, the yield can reach up to 1700kg per mu. See field fruiting conditions for details. Figure 3 Higher yields may be obtained when grown in greenhouses with better facilities.

[0042] The cultivation cycle of the conventional Qimei variety is about 90-130 days, with a yield of 800-1000 kg / mu. The cultivation cycle of Qimei morel mushroom JSQM01 is about one month shorter than that of the conventional Qimei variety, and the yield is increased by more than 50%. When the conventional Qimei variety is just starting to produce small mushrooms, the Qimei morel mushroom JSQM01 is already mature and ready for harvest. Figure 4 Suitable for early mushroom cultivation in northern regions after the Spring Festival.

[0043] 2. Southern (Xundian, Yunnan) Seasonal Cultivation Model Cultivation goal: To start mushroom production before the Spring Festival, seize the early market, and effectively avoid the risk of reduced production or even crop failure caused by high temperatures in most areas of the south after the Spring Festival.

[0044] Key reproductive cycle Sowing period: Depending on the different climate conditions in each production area, sowing can be carried out when the soil temperature in the planting area is below 18℃ for a continuous week.

[0045] Mushroom-inducing period: 40-45 days after sowing, when the nutrient bags have been fully absorbed, water thoroughly to promote mushroom growth.

[0046] Harvesting period: The fruiting bodies will gradually mature 15-20 days after the fruiting process, and harvesting can begin.

[0047] Full growth period: approximately 55-65 days from sowing to harvest.

[0048] JSQM01 Field Performance: In southern regions, during the peak season, differentiation and harvesting can be completed rapidly before the high temperatures arrive after the Spring Festival. Depending on specific conditions such as soil temperature, nutrient absorption, and weather changes, the yield can reach 1000 kg / mu (approximately 667 kg / acre). Conventional Qimei varieties enter the fruiting stage 45-55 days after sowing and are harvested in 80-100 days, with a yield of 400-600 kg / mu. Furthermore, due to their later growth period, the control variety is highly susceptible to the rapidly rising temperatures during primordia differentiation, preventing some primordia from differentiating normally and making the fruiting bodies vulnerable to contamination, affecting the marketability of the mature mushrooms. JSQM01 is an early-maturing variety, with primordia development and differentiation occurring earlier than conventional Qimei, making it suitable for fruiting before the Spring Festival for higher profits. It is particularly suitable for southern regions with shorter fruiting cycles and rapid temperature increases after the Spring Festival, such as Yunnan, Sichuan, Guizhou, Hunan, and Hubei provinces.

[0049] 3. Off-season cultivation model in southern China (Shangri-La, Yunnan) Cultivation objective: To fill the market gap for fresh morel mushrooms in autumn, achieve staggered market entry, and improve economic benefits.

[0050] Key reproductive cycle Sowing period: Depending on the climate of high-altitude, cool regions, such as Shangri-La in Yunnan, sowing can be done in early July. Taking advantage of the cool climate from late summer to autumn, mycelial growth and primordia differentiation are faster.

[0051] Mushroom-inducing period: 35-40 days after sowing, when the nutrient bags are fully absorbed and the soil surface shows signs of mushroom growth, water appropriately according to the humidity in the planting shed (the rainfall during the autumn replanting cycle is more abundant than in the regular season, so do not over-water for mushroom induction) to promote mushroom induction.

[0052] Harvesting period: The fruiting bodies will gradually mature 15-20 days after the fruiting process, and harvesting can begin.

[0053] Full growth period: approximately 50-60 days from sowing to harvest.

[0054] Field performance of JSQM01 shows that this variety is an early-maturing type, with early primordia development and differentiation, and can successfully complete differentiation and fruiting within a suitable temperature range. Because the fruiting bodies differentiate, form, and mature before the onset of high temperatures, the effects of heat stress are effectively avoided, resulting in a yield of approximately 600 kg in off-season autumn cultivation. Generally, a yield exceeding 500 kg under off-season planting conditions is considered a high-yielding variety.

[0055] In contrast, the control variety, due to its longer growth period, encountered high temperatures during the primordia differentiation stage, failing to produce fruiting normally, resulting in the death of primordia and small mushroom buds under high-temperature stress; even the few primordia that differentiated into mushrooms died due to deformities or extensive white mold infection caused by high temperatures. Figure 6 As shown. Figure 6 This result indicates that not all morel varieties of the "Seven Sisters" series are suitable for off-season planting, nor can all achieve high yields. The JSQM01 strain provided by this invention can achieve early maturity and high yield, while also exhibiting resistance to white mold.

[0056] In summary, by adopting the above-mentioned targeted early-maturing cultivation methods, strain JSQM01 can reliably achieve the goal of harvesting 15-30 days earlier than conventional varieties. Its "early-maturing" agronomical trait is fully utilized, and it is also high-yielding and resistant to white mold. It is particularly suitable for production areas that are sensitive to the fruiting cycle and high temperature risks, and has extremely high application value.

[0057] Example 3: Development and Application of Molecular Markers Whole-genome resequencing was performed on strain JSQM01 and three control morel strains (MZ18, G10, and Space Morel). It was found that strain JSQM01 had a 241024 base (G) substitution at position 241024 in Scaffold-2, replaced by an 83 bp fragment (SEQ ID NO: 1TAACTCCATGTCAAAAATCCCGGGACAAGCCACCGTAGCAACTCGCGGTTGCGTTGTCCCATGATTTTTGAACGAGAACTATA). Primers 1-F2 (SEQ ID NO: 2 CTATGACGGCGGTAATAATTGC) and 1-R2 (SEQ ID NO: 3 AGTTGCTACGGTGGCTTGT) were designed for PCR detection. The downstream primer is located within the aforementioned molecular marker, such as... Figure 7 As shown, only strains containing the SEQ ID NO:1 sequence can amplify the sequence.

[0058] The PCR system consisted of: 12.5 μL of 2X SanTaq PCR Master Mix (with Blue Dye) (Sangon Biotech B532061); 0.5 μL of 1-F2 (10 μmol / L); 0.5 μL of 1-R2 (10 μmol / L); 1 μL of template DNA (100 ng / μL); and ddH2O to a final volume of 25 μL. The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 58℃ annealing for 30 sec, 72℃ extension for 45 sec, for 32 cycles; and a final extension at 72℃ for 10 min. PCR products were stored at 4℃.

[0059] The PCR products of the specific primers were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The amplification sequence of the specific primer pair 1-F2 / 1-R2 of Morel JSQM01 was obtained by sequencing, as shown in SEQ ID NO: 7.

[0060] 10 μL of PCR product and DNA marker were loaded onto a 1% (w / v) agarose gel and electrophoresed at 150 V for 25 min. The gel was then observed using a gel imaging system. Results are as follows: Figure 8 Only the *Morchella esculenta* JSQM01 showed a specific band at approximately 1000 bp, while the control strains showed no bands. The specific nucleic acid sequence shown in SEQ ID NO: 7 totaled 1007 bp, which matched the size of the electrophoretic band. This molecular marker and amplified sequence can be used for rapid and accurate identification of JSQM01.

[0061] The above embodiments do not limit the scope of protection of this invention. Those skilled in the art can make other variations or modifications based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A high-yielding, early-maturing morel mushroom (Morchella esculenta) Morchella eximia JSQM01, with accession number CCTCC NO: M20252848.

2. A specific molecular marker for identifying the strain of claim 1, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO:

1.

3. A specific primer for detecting the molecular marker of claim 2, characterized in that, The primer sequences are shown in SEQ ID NO:2 and SEQ ID NO:

3.

4. The method for identifying the nucleotide sequence of *Morchella esculenta* JSQM01 using the specific primers described in claim 3, characterized in that... The nucleotide sequence is shown in SEQ ID NO:

7.

5. A method for cultivating the strain of claim 1, comprising the steps of strain preparation, inoculation, nutrient bag placement, and fruiting management, characterized in that, The strain can be harvested 50-90 days after sowing.

6. The method according to claim 4, characterized in that, The nutrient bag formula contains 35-45% wheat, 50-60% corn cob, 0.8-1.2% quicklime, 1.5-2.0% gypsum, and 0.1-0.5% potassium dihydrogen phosphate.

Images